Localization of specific repetitive DNA sequences in individual rice chromosomes

This paper describes the characterization and chromosomal distribution of three different rice (Oryza sativa) repetitive DNA sequences. The three sequences were characterized by sequence analysis, which gave 355, 498 and 756 bp for the length of the repeat unit in Os48, OsG3-498 and OsG5-756, respectively. Copy number determination by quantitative DNA slot-blot hybridization analysis showed 4000, 1080 and 920 copies, respectively, per haploid rice genome for the three sequences. In situ DNA hybridization analysis revealed that 95% of the silver grains detected with the Os48 probe were localized to euchromatic ends of seven long arms and one short arm out of the 12 rice chromosomes. For the OsG3-498 repetitive sequence, the majority of silver grains (58%) were also clustered at the same chromosomal ends as that of Os48. The minority (28%) of silver grains were located at heterochromatic short arms and centromeric regions. For the OsG5-756 repetitive sequence, 81% of the silver grains labeled the heterochromatic short arms and regions flanking all of the 12 centromeres. Thus, each of these three repetitive sequences was distributed at specific defined chromosomal locations rather than randomly at many chromosomal locations. The approximate copy number of a given repetitive DNA sequence at any specific chromosomal location was calculated by combining the information from in situ DNA hybridization analysis and the total copy number as determined by DNA slot-blot hybridization.by J. Huberman     

Cloning of DNA sequences localized on proximal fluorescent chromosome bands by microdissection in Pinus densiflora Sieb. & Zucc.

Japanese red pine, Pinus densiflora, has 2n=24 chromosomes, of which most carry chromomycin A3 (CMA) and 4',6-diamidino-2-phenylindole (DAPI) bands at their centromere-proximal regions. It was proposed that these regions contain highly repetitive DNA. The DNA localized in the proximal fluorescent bands was isolated and characterized. In P. densiflora, centromeric and neighboring segments of the somatic chromosomes were dissected with a manual micromanipulator. The centromeric DNA was amplified from the DNA contained in dissected centromeric segments by degenerate oligonucleotide primed-polymerase chain reaction (DOP-PCR) and a cloned DNA library was constructed. Thirty-one clones carrying highly repetitive DNA were selected by colony hybridization using Cot-1 DNA from this species as a probe, and their chromosomal localization was determined by fluorescent in situ hybridization (FISH). Clone PDCD501 was localized to the proximal CMA band of 20 chromosomes. This clone contained tandem repeats, comprising a 27 bp repeat unit, which was sufficient to provide the proximal FISH signal, with a 52.3% GC content. The repetitive sequence was named PCSR (proximal CMA band-specific repeat). Clone PDCD159 was 1700 bp in length, with a 61.7% AT content, and produced FISH signals at the proximal DAPI band of the remaining four chromosomes. Four clones hybridized strongly to the secondary constriction and gave weak signals at the centromeric region of several chromosomes. Clone PDCD537, one of the four clones, was homologous to the 26S rRNA gene. A PCR experiment using microdissected centromeric regions suggested that the centromeric region contains 18S and 26S rDNA. Another 24 clones hybridized to whole chromosome arms, with varying intensities and might represent dispersed repetitive DNA.     

Comparative FISH analysis of C-positive blocks of centromeric chromosomal regions of pygmy wood mice <Emphasis Type="Italic">Sylvaemus uralensis</Emphasis> (Rodentia,Muridae)

The composition and homology of centromeric heterochromatin DNA has been compared in representatives of the Asian race and two chromosomal forms (Eastern European and Southern European) of the European race of the pygmy wood mouse Sylvaemus uralensis by means of in situ hybridization with metaphase chromosomes of microdissection DNA probes obtained from centromeric C-blocks of mice of the Southern European chromosomal form and the Asian race. Joint hybridization of both DNA probes yielded all possible variants of centromeric regions in terms of the presence of repetitive sequences homologous to those of some or another dissection region, which indicates a diversity of centromeric regions differing in DNA composition. However, most variations of the fluorescent in situ hybridization (FISH) patterns are apparently related to quantitative differences of repetitive elements of the genome. Experiments with the DNA probe obtained from the genome of the Southern European form of the pygmy wood mouse have shown that the number of intense FISH signals roughly corresponds to the number of large C-segments in representatives of the European race, which is characterized by a large amount of the centromeric C-heterochromatin in the karyotype. However, intense signals have been also detected in experiments on hybridization of this probe with chromosomes of representatives of the Asian race, which has no large C-blocks in the karyotype; thus, DNA sequences homologous to heterochromatic ones are also present in nonheterochromatic regions adjacent to C-segments. Despite the variations of the numbers of both intense and weak FISH signals, all chromosomal forms/races of S. uralensis significantly differ of the samples from one another in these characters. The number of intense FISH signals in DNA in pygmy wood mice of the samples from eastern Turkmenistan (the Kugitang ridge) and southern Omsk oblast (the vicinity of the Talapker railway station) was intermediate between those in the European and Asian races, which is apparently related to a hybrid origin of these populations (the hybridization having occurred long ago in the former case and recently in the latter case).     

Comparative FISH analysis of C-positive regions of chromosomes of wood mice (Rodentia, Muridae, Sylvaemus)

The homology of DNA of C-positive centromeric regions of chromosomes in wood mice of the genus Sylvaemus (S. uralensis, S. fulvipectus, S. sylvaticus, S. flavicollis, and S. ponticus) was estimated for the first time. DNA probes were generated by microdissection from the centromeric regions of individual autosomes of each species, and their fluorescence in situ hybridization (FISH) with metaphase chromosomes of representatives of all studied wood mouse species was carried out. Unlike in the chromosomal forms and races of S. uralensis, changes in the DNA composition of the chromosomal centromeric regions in the wood mouse species of the genus Sylvaemus (including closely related S. flavicollis and S. ponticus) are both quantitative and qualitative. The patterns of FISH signals after in situ hybridization of the microdissection DNA probes with chromosomes of the species involved in the study demonstrate significant differences between C-positive regions of wood mouse chromosomes in the copy number and the level of homology of repetitive sequences as well as in the localization of homologous repetitive sequences. It was shown that C-positive regions of wood mouse chromosomes can contain both homologous and distinct sets of repetitive sequences. Regions enriched with homologous repeats were detected either directly in C-positive regions of individual chromosomes or only on the short arms of acrocentrics, or at the boundary of C-positive and C-negative regions.     

Characterization and chromosomal distribution of satellite DNA sequences of the water buffalo (Bubalus bubalis).

Satellite DNA sequences were isolated from the water buffalo (Bubalus bubalis) after digestion with two restriction endonucleases, BamHI and StuI. These satellite DNAs of the water buffalo were classified into two types by sequence analysis: one had an approximately 1,400 bp tandem repeat unit with 79% similarity to the bovine satellite I DNA; the other had an approximately 700 bp tandem repeat unit with 81% similarity to the bovine satellite II DNA. The chromosomal distribution of the satellite DNAs were examined in the river-type and the swamp-type buffaloes with direct R-banding fluorescence in situ hybridization. Both the buffalo satellite DNAs were localized to the centromeric regions of all chromosomes in the two types of buffaloes. The hybridization signals with the buffalo satellite I DNA on the acrocentric autosomes and X chromosome were much stronger than that on the biarmed autosomes and Y chromosome, which corresponded to the distribution of C-band-positive centromeric heterochromatin. This centromere-specific satellite DNA also existed in the interstitial region of the long arm of chromosome 1 of the swamp-type buffalo, which was the junction of the telomere-centromere tandem fusion that divided the karyotype in the two types of buffaloes. The intensity of the hybridization signals with buffalo satellite II DNA was almost the same over all the chromosomes, including the Y chromosome, and no additional hybridization signal was found in noncentromeric sites.     

Locations of a Human Satellite DNA in Human Chromosomes

USING techniques for DNA/RNA or DNA/DNA hybridization in situ, Pardue and Gall¹ and Jones² made several significant discoveries on the chromosomal locations of the mouse satellite DNA: (1) this fraction of DNA is found in all chromosomes except the Y, (2) the cytological location of the satellite DNA is limited to the centromeric region of each chromosome and is probably absent in other regions and (3) the centromeric regions of all mouse chromosomes are hetero-chromatic.     

Comparative FISH analysis of C-positive regions of chromosomes of wood mice (Rodentia,Muridae, <Emphasis Type="Italic">Sylvaemus</Emphasis>)

The homology of DNA of C-positive centromeric regions of chromosomes in wood mice of the genus Sylvaemus (S. uralensis, S. fulvipectus, S. sylvaticus, S. flavicollis, and S. ponticus) was estimated for the first time. DNA probes were generated by microdissection from the centromeric regions of individual autosomes of each species, and their fluorescence in situ hybridization (FISH) with metaphase chromosomes of representatives of all studied wood mouse species was carried out. Unlike in the chromosomal forms and races of S. uralensis, changes in the DNA composition of the chromosomal centromeric regions in the wood mouse species of the genus Sylvaemus (including closely related S. flavicollis and S. ponticus) are both quantitative and qualitative. The patterns of FISH signals after in situ hybridization of the microdissection DNA probes with chromosomes of the species involved in the study demonstrate significant differences between C-positive regions of wood mouse chromosomes in the copy number and the level of homology of repetitive sequences as well as in the localization of homologous repetitive sequences. It was shown that C-positive regions of wood mouse chromosomes can contain both homologous and distinct sets of repetitive sequences. Regions enriched with homologous repeats were detected either directly in C-positive regions of individual chromosomes or only on the short arms of acrocentrics, or at the boundary of C-positive and C-negative regions.     

Chromosomal localization of Sau3A repetitive DNA revealed by in situ hybridization

The Sau3A DNA family consists of unique alphoid human repetitive DNA which is prone to be excised from the chromosomes and exhibits restriction fragment length polymorphism. We studied the chromosomal localization of the DNA by in situ hybridization using cultured normal human lymphocytes. Under standard hybridization conditions, the sequence hybridized with the centromeric regions of chromosomes 1, 2, 4, 11, 15, 17, 18, 19 and X, but under high stringency hybridization conditions, it hybridized with the centromeric regions of chromosomes 1, 17 and X, and particularly chromosome 11. Based on these results, we discuss the evolutionary relationship among the sequences of the Sau3A DNA family.     

Chromosomal and nuclear distribution of the HindIII 1.9-kb human DNA repeat segment

A human interspersed repetitive DNA cloned in pBR322, the HindIII 1.9-kb (kilobase pair) sequence, was labeled with biotinylated dUTP and hybridized to acid-fixed chromosomes and paraformaldehyde-fixed whole cells in situ. Using our most sensitive detection techniques this probe highlighted on the order of 200 discrete loci, in punctate or banded arrays, that resembled a Giemsa-dark band pattern on chromosome arms. Interphase cells also displayed many discrete punctate spots of hybridization along chromosome fibers. The ubiquitous Alu sequence repeat also appeared to be concentrated in specific regions of the chromosome and predominantly highlighted Giemsa-light bands. Centromeric or ribosomal spacer DNA repeats used as controls in all studies gave the expected hybridization profiles and showed no non-specific labeling of chromosome arms. Cohesive groups of centromeric DNA arrays and rDNA clusters were observed in interphase nuclei. Refinements in methods for detecting biotin-labeled probes in situ were developed during these studies and calculations indicated that about 20 kb or more of the 1.9-kb repeat were present at each hybridization site. The chromosomal distribution of the 1.9-kb repeat suggests that this sequence may reflect, or participate in defining, ordered structureal domains along the chromosome.     

A degenerate alpha satellite probe, detecting a centromeric deletion on chromosome 21 in an apparently normal human male, shows limitations of the use of satellite DNA probes for interphase ploidy analysis.

A degenerate alpha satellite DNA probe specific for a repeated sequence on human chromosomes 13 and 21 was synthesized using the polymerase chain reaction (PCR). Fluorescence in situ hybridization (FISH) with this probe to normal metaphase spreads revealed strong probe binding to the centromeric regions of human chromosomes 13 and 21 with negligible cross-hybridization with other chromosomes. FISH to normal interphase cell nuclei showed four distinct domains of probe binding. However, hybridization with probe to interphase and metaphase preparations from one apparently normal human male resulted in only three major binding domains. Metaphase chromosome analysis revealed a centromeric deletion on one chromosome 21 that caused greatly reduced probe binding. The result suggest caution in the interpretation of interphase ploidy studies performed with chromosome-specific alphoid DNA probes.     

Breakpoints in Robertsonian translocations are localized to satellite III DNA by fluorescence in situ hybridization.

We characterized 21 t(13;14) and 3 t(14;21) Robertsonian translocations for the presence of DNA derived from the short arms of the translocated acrocentric chromosomes and identified their centromeres. Nineteen of these 24 translocation carriers were unrelated. Using centromeric alpha-repeat DNA as chromosome-specific probe, we found by in situ hybridization that all 24 translocation chromosomes were dicentric. The chromatin between the two centomeres did not stain with silver, and no hybridization signal was detected with probes for rDNA or beta-satellite DNA that flank the distal and proximal ends of the rDNA region on the short arm of the acrocentrics. By contrast, all 24 translocation chromosomes gave a distinct hybridization signal when satellite III DNA was used as probe. This result strongly suggests that the chromosomal rearrangements leading to Robertsonian translocations occur preferentially in satellite III DNA. We hypothesize that guanine-rich satellite III repeats may promote chromosomal recombination by formation of tetraplex structures. The findings localize satellite III DNA to the short arm of the acrocentric chromosomes distal to centromeric alpha-repeat DNA and proximal to beta-satellite DNA.     

Labeling of human centromeres using an alphoid DNA consensus sequence: application to the scoring of chromosome aberrations

Precise identification of centromeres is required for accurate scoring of asymmetrical chromosome aberrations, such as dicentrics. The centromeric regions of all human chromosomes can be labeled by in situ hybridization of a 30 nucleotide oligomer having the sequence of a conserved region of an alphoid DNA consensus sequence. Fluorescent detection of the hybridized probe allows rapid identification of centromeres and accurate scoring of dicentrics, multicentrics, acentric fragments, and the centromeric content of ring chromosomes. This procedure provides a novel approach for scoring these complex chromosome aberrations, particularly damage induced by radiation or radiomimetic agents.     

Centromeric tandem repeat from the chaffinch genome: isolation and molecular characterization.

A new family of avian centromeric satellites is described. The highly repeated sequence, designated FCP (Fringilla coelebs PstI element), was cloned from the 500-bp PstI digest fraction of the chaffinch (Fringilla coelebs L.) genomic DNA, sequenced, and characterized. The FCP repeat was found to have 505-506 bp length of monomer, 57% content of GC, to compose about 0.9% of the chaffinch genome, and to be highly methylated. Results of Southern-blot hybridization of cloned FCP element onto genomic DNA digested with different restriction enzymes, and sequencing directly from total genomic DNA using FCP-specific primers and ThermoFidelase enzyme (Fidelity Systems Inc.) were in agreement with a tandem arrangement of this repeat in the chaffinch genome. Five positions of single-nucleotide polymorphism (SNP) were found in the FCP monomers using direct genomic sequencing. Fluorescence in situ hybridization (FISH) with FCP probe and primed in situ labelling (PRINS) with FCP specific primers showed that the FCP elements occupy pericentric regions of all chaffinch chromosomes. On chromosome spreads, the fluorescent signals were also observed in the intercentromeric connectives between nonhomologous chromosomes. The results suggest that the centromeric FCP repeat is responsible for chromosome ordering during mitosis in chaffinch.     

A highly repeated FCP centromeric sequence from chaffinch (Fringilla coelebs: Aves) genome is revealed within interchromosomal connectives during mitosis

A highly repeated FCP (Fringilla coelebs PstI element) sequence was localized by FISH in centromeric regions of all chromosomes of the chaffinch. Besides, FISH signal was found also in interchromosomal connectives linking centromeres of non-homologous chromosomes in mitotic cells. The presence of DNA in the connectives was confirmed by immunostaining with anti-dsDNA antibodies as well as in experiments on nick-translation and random primed labeling in situ. Non-denaturing FISH with FCP probe and random primed labeling of non-denatured chromosomes resulted in fluorescence signal on both centromeres and intercentromeric connectives, thus providing evidence for the availability of single-strand DNA tracts in FCP sequence. It is suggested that the highly repeated FCP centromeric sequence may be respondible for interconnection of mitotic chromosomes and may by involved in nuclear architecture maintenance in the chaffinch.     

Visualization of chromosome territories in interphase nuclei of ovarian nurse cells in Calliphora erythrocephala Mg. (Diptera: Calliphoridae)

Analysis of localization of chromosomes 2, 3, and 6 of Calliphora erythrocephala Mg. in ovarian nurse cell nuclei with different chromatin structure has shown that the regions of DNA probe hybridization reduced with increasing chromatin compaction. Hybridization of DNA probes of chromosomes 3 and 6 to secondary reticular nuclei demonstrated that chromosomes retain their territories in the nuclei when the chromatin acquires a reticular structure. These results suggest regular organization of the chromosomal apparatus at all stages of the endomitotic cycle, including the stage of highly polyploid reticular nuclei. FISH of DNA probe of the chromosome 2 telomeric region to secondary reticular nuclei revealed a peripheral distribution of the signal. Zones of more intensive DNA probe hybridization have been distinguished. These zones probably are the regions of accumulation of telomeric and (or) centromeric chromosome regions.     

Localization and characterization of recombinant DNA clones derived from the highly repetitive DNA sequences in the Indian muntjac cells: their presence in the Chinese muntjac

A total of seven, highly repeated, DNA recombinant M13 mp8 clones derived from a Hpa II digest of cultured cells of the Indian muntjac (Muntiacus muntjac vaginalis) were analyzed by restriction enzymes, in situ hybridization, and DNA sequencing. Two of the clones, B1 and B8, contain satellite DNA inserts which are 80% homologous in their DNA sequences. B1 contains 781 nucleotides and consist of tandem repetition of a 31 bp consensus sequence. This consensus sequence, TCCCTGACGCAACTCGAGAGGAATCCTGAGT, has only 3 bp changes, at positions 7, 24, and 27, from the consensus sequence of the 31 bp subrepeats of the bovine 1.715 satellite DNA. The satellite DNA inserts in B1 and B8 hybridize primarily but not specifically to chromosome X, and secondarily to other sites such as the centromeric regions of chromosomes 1 and 2. Under less stringent hybridization conditions, both of them hybridize to the interior of the neck region and all other chromosomes (including chromosomes 3 and Y). The other five DNA clones contain highly repetitive, interdispersed DNA inserts and are distributed throughout the genome except for the neck region of the compound chromosome X+3. Blot hybridization results demonstrate that the satellite DNA component is also present in Chinese muntjac DNA (Muntiacus reevesi) in spite of the very different karyotypes of the Chinese and Indian muntjacs.     

In situ hybridization at the electron microscope level: hybrid detection by autoradiography and colloidal gold

In situ hybridization has become a standard method for localizing DNA or RNA sequences in cytological preparations. We developed two methods to extend this technique to the transmission electron microscope level using mouse satellite DNA hybridization to whole mount metaphase chromosomes as the test system. The first method devised is a direct extension of standard light microscope level using mouse satellite DNA hybridization to whole mount metaphase chromosomes as the test system. The first method devised is a direct extension of standard light microscope in situ hybridization. Radioactively labeled complementary RNA (cRNA) is hybridized to metaphase chromosomes deposited on electron microscope grids and fixed in 70 percent ethanol vapor; hybridixation site are detected by autoradiography. Specific and intense labeling of chromosomal centromeric regions is observed even after relatively short exposure times. Inerphase nuclei present in some of the metaphase chromosome preparations also show defined paatterms of satellite DNA labeling which suggests that satellite-containing regions are associate with each other during interphase. The sensitivity of this method is estimated to at least as good as that at the light microscope level while the resolution is improved at least threefold. The second method, which circumvents the use of autoradiogrphic detection, uses biotin-labeled polynucleotide probes. After hybridization of these probes, either DNA or RNA, to fixed chromosomes on grids, hybrids are detected via reaction is improved at least threefold. The second method, which circumvents the use of autoradiographic detection, uses biotin-labeled polynucleotide probes. After hybridization of these probes, either DNA or RNA, to fixed chromosomes on grids, hybrids are detected via reaction with an antibody against biotin and secondary antibody adsorbed to the surface of over centromeric heterochromatin and along the associated peripheral fibers. Labeling is on average ten times that of background binding. This method is rapid and possesses the potential to allow precise ultrastructual localization of DNA sequences in chromosomes and chromatin.     

Selective digestion of mouse metaphase chromosomes

Metaphase chromosomes prepared from colcemid-treated mouse L929 cells by non-ionic detergent lysis exhibit distinct heterochromatic centromere regions and associated kinetochores when viewed by whole mount electron microscopy. Deoxyribonuclease I treatment of these chromosomes results in the preferential digestion of the chromosomal arms leaving the centromeric heterochromatin and kinetochores apparently intact. Enrichment in centromere material after DNase I digestion was quantitated by examining the increase in 10,000xg pellets of the 1.691 g/cc satellite DNA relative to main band DNA. This satellite species has been localized at the centromeres of mouse chromosomes by in situ hybridization. From our analysis it was determined that DNase I digestion results in a five to six-fold increase in centromeric material. In contrast to the effect of DNase I, micrococcal nuclease was found to be less selective in its action. Digestion with this enzyme solubilized both chromosome arms and centromeres leaving only a small amount of chromatin and intact kinetochores.     

Sequence organization and cytological localization of the minor satellite of mouse.

A complete 120 bp genomic consensus sequence for the mouse minor satellite has been determined from enriched L929 centromeric sequences. The extensive sequence homology existing between the major and minor satellite suggests an evolutionary relationship. Some sequences flanking the minor satellite has also been identified and they provide insight into centromeric DNA organization. Isotopic in situ hybridization analysis of the minor satellite to mouse L929 and Mus musculus metaphase spreads showed that this repetitive DNA class is localized specifically to centromeres of all chromosomes of the karyotype. With the use of high resolution non-isotopic fluorescence in situ hybridization the minor satellite is further localized to the outer surface of the centromere in a discrete region at or immediately adjacent to the kinetochore. Our cytological data suggests that the minor satellite might play a role in the organization of the kinetochore region rather than, as previously suggested, sites for general anchoring of the genome to the nuclear matrix.     

Visualization of Chromosome Territories in Interphase Nuclei of Ovarian Nurse Cells in <Emphasis Type="Italic">Calliphora erythrocephala</Emphasis> Mg. (Diptera: Calliphoridae)

Analysis of localization of chromosomes 2, 3, and 6 of Calliphora erythrocephala Mg. in ovarian nurse cell nuclei with different chromatin structure has shown that the regions of DNA probe hybridization reduced with increasing chromatin compaction. Hybridization of DNA probes of chromosomes 3 and 6 to secondary reticular nuclei demonstrated that chromosomes retain their territories in the nuclei when the chromatin acquires a reticular structure. These results suggest regular organization of the chromosomal apparatus at all stages of the endomitotic cycle, including the stage of highly polyploid reticular nuclei. FISH of DNA probe of the chromosome 2 telomeric region to secondary reticular nuclei revealed a peripheral distribution of the signal. Zones of more intensive DNA probe hybridization have been distinguished. These zones probably are the regions of accumulation of telomeric and (or) centromeric chromosome regions.