Clinical outcome and follow-up of the first reported case of Russell-Silver syndrome with the unique combination of maternal uniparental heterodisomy 7 and mosaic trisomy 7

BACKGROUND: Russell-Silver syndrome (RSS) has been associated with maternal uniparental disomy (UPD) for chromosome 7 although the etiology of the syndrome is still unknown. Cases of RSS associated with maternal UPD7 have involved isodisomies, heterodisomies, and mixed isodisomy with heterodisomy simultaneously. This publication is a follow-up report of the postnatal clinical outcome of the first prenatally suspected case of combined mosaic trisomy 7 with maternal uniparental disomy of chromosome 7 (UPD7). CASE: The diagnosis of RSS in the proband was suspected prenatally because trisomy 7 mosaicism (47,XX,+7[13]/46,XX[19]) and maternal uniparental heterodisomy 7 were both found in amniotic fluid cells. Cord blood karyotype analysis showed only disomic cells (46,XX[50]), whereas postpartum chorionic villus analysis was completely trisomic for chromosome 7 (47,XX,+7[19]). Postnatally, the diagnosis of RSS was confirmed by physical findings, her trisomy 7 mosaicism was confirmed by cytogenetic analysis of her skin biopsy (47,XX,+7[9]/46,XX[20]) and her UPD7 was confirmed on both peripheral blood and skin biopsy using microsatellite markers. During infancy, the proband experienced growth deficiency, persistent hypoglycemia, and psychomotor developmental delay. CONCLUSIONS: Trisomic rescue as a life-saving mechanism, with subsequent chromosomal mosaicism in combination with UPD may occur more frequently in RSS than has been reported. Systematic testing of cases suspected prenatally or postnatally would be informative regarding the individual contribution of each factor. Imprinting, loss of heterozygosity for recessive genes, and mosaicism may explain the short stature, asymmetry, and the variable expression of the phenotype. The contribution of these mechanisms to the syndrome should be evaluated in these cases.     

Chromosomal mosaicism in amniotic fluid cell cultures.

Over the past 6 years, using in situ processing methods, we have identified 32 cases of mosaicism in amniotic fluid cell cultures prepared from 1,100 samples. Two of these (45,X/46,XX and 46,XX/47,XX, + 21) were called true mosaics because multiple colonies demonstrated the same abnormal chromosome complement, and on subsequent evaluation of the newborn blood or fetal tissues, mosaicism was confirmed. Of the remaining cases, 29 were designated as pseudomosaics because only single or partial colonies exhibited an aberrant chromosome complement, 12 having a trisomy 2 line. In the final case, a double trisomy was demonstrated in only one of eight colonies in the first culture, but in the culture from a repeat sample an additional two colonies showed the same double trisomy. Since no abnormal cells were observed in infant blood, it was postulated that the mosaicism may only have been present in the extraembryonic tissues. It is our conviction that the use of these cloning methods should diminish the danger of misdiagnosis in genetic amniocentesis.     

A study of 45,X/46,XX mosaicism in Turner syndrome females: a novel primer pair for the (CAG)n repeat within the androgen receptor gene

This paper describes the procedures developed for the determining of diparental/uniparental origin of X chromosomes in mosaic Turner females (karyotype 45,X/46,XX), and accounts for results of the analysis of chromosomal material from 20 girls with Turner syndrome. An (CAG)n repeat within the androgen receptor (AR) gene was selected as a genetic marker. A novel primer pair for amplification of the (CAG)12-30 repeat was designed. These primers gave an amplification product of 338 bp in length and were following (5'-->3'): agttagggctgggaagggtc and cggctgtgaaggttgctgt. Nineteen of the subjects were heterozygous for the selected marker. In 4 cases there were distinct signals from three alleles. The only Turner female in the study who had been previously ascribed a non-mosaic 45,X karyotype by using cytogenetic techniques, proved to be a cryptic mosaic, displaying two alleles of the genetic marker in the more sensitive molecular assay. These results suggest that in most cases 45,X/46,XX mosaicism in Turner females arises through loss of one of the X chromosomes in some cell lines in originally 46,XX conceptuses, rather than through mitotic non-disjunction during early embryogenesis in originally 45,X conceptuses. A high sensitivity of the modified assay based on PCR-amplification of the (CAG)n repeat within AR gene proves its usefulness as a tool for studying mosaicism in Turner syndrome.     

46,X,i(Xq)/47,XX,+13 mosaicism

A 10-year-old girl with short stature and other features of Turner's syndrome was found to be a mosaic consisting of 46,X,i(Xq) and 47,XX,+13 cell lines, a hitherto undescribed situation. She had none of the clinical features of trisomy 13 syndrome, with a possible exception of postaxial polydactyly of the left foot. Her PHA-stimulated blood lymphocytes and EB virus-transformed B lymphocytes both revealed the Xi(Xq)/XX,+13 mosaicism, while her skin fibroblasts showed an exclusively 46,X,i(Xq) karyotype. Studies using Q-and R-banding heteromorphisms as markers indicated that the patient started as a 13 trisomic zygote resulting from a maternal meiotic error, followed by the loss of chromosome 13 at an early mitotic division. C-banding analysis revealed two C banding blocks in the iso X chromosome, an indication that the chromosome was dicentric. BrdU-Hoechst-Giemsa analysis revealed that the iso X chromosome was late-replicating with both its arms either synchronously or asynchronously replicating. The iso X chromosome was thus designated as idic (Xq)(p11:p11). In view of the presence of the XX cell line, it was concluded that the patient started as an XX,+13 zygote, followed by two mitotic events, the loss of a chromosome 13 and the formation of the iso X chromosome, occurring either simultaneously or in succession.     

Dynamic mosaicism manifesting as loss, gain and rearrangement of an isodicentric Y chromosome in a male child with growth retardation and abnormal external genitalia

Isodicentric chromosomes are considered the most common structural abnormality of the human Y chromosome. Because of their instability during cell division, loss of an isodicentric Y seems mainly to lie at the origin of mosaicism in previously reported patients with a 45,X cell line. Here, we report on a similar case, which, however, turned out to be an example of dynamic mosaicism involving isodicentric chromosome Y and isochromosome Y after FISH with a set of chromosome Y-specific probes and multicolor banding. Cytogenetic analyses (GTG-, C-, and Q-banding) have shown three different cell lines: 45,X/46, X,idic(Y)(q12)/46,X,+mar. The application of molecular cytogenetic techniques established the presence of four cell lines: 45,X (48%), 46,X,idic(Y)(q11.23) (42%), 46,X,i(Y)(p10) (6%) and 47,X,idic(Y)(q11.23),+idic(Y)(q11.23) (4%). According to the available literature, this is the first case of dynamic mosaicism with up to four different cell lines involving loss, gain, and rearrangement of an idic(Y)(q11.23). The present report indicates that cases of mosaicism involving isodicentric and isochromosome Ys can be more dynamic in terms of somatic intercellular variability that probably has an underappreciated effect on the phenotype.     

Double autosomal/gonosomal mosaic aneuploidy: study of nondisjunction in two cases with trisomy of chromosome 8

We report cytogenetic and molecular investigations performed in two cases of mosaic trisomy 8 combined with mosaic sex chromosome aneuploidy. In a 35-year-old female, presenting with short stature, gonadal dysgenesis, and a multiple congenital anomalies/mental retardation syndrome typical of trisomy 8, chromosome analysis from peripheral lymphocytes showed the presence of three cell lines, whose karyotypes were 45,X (59.2%), 46,X,+8 (1.2%), and 47,XX,+8 (39.6%), respectively. The same cell lines were found in a skin fibroblast culture, though in different proportions. The second patient, a 9-month-old male with multiple skeletal abnormalities, showed a 47,XY,+8 and a 47,XXY cell line in both peripheral lymphocytes (61.7% and 38.3%, respectively) and skin fibroblasts (92.8% and 7.2%, respectively). To determine the events underlying the origin of these complex karyotypes we performed Southern blot and polymerase chain reaction (PCR) analysis using polymorphic DNA markers from the X chromosome and from chromosome 8. Both supernumerary chromosomes 8, and, in case 2, the two X chromosomes, appeared to be identical, lacking detectable recombination events. We conclude that, in both cases, the most likely mechanism underlying the origin of the mosaic cell lines was formation of a normal zygote, followed by mitotic errors during early divisions.     

Uniparentale Disomien und Mosaike

Of the various mechanisms of formation of uniparental disomy (UPD) discussed in the literature, the mechanism of trisomy rescue is mostly prone to mosaicism from a trisomy cell line and from a disomy 46, XN uniparental cell line. Therefore, low level or undetected mosaicism has been assumed for a significant number of UPD cases. The clinical consequences of trisomy/UPD mosaicism probably depend on the chromosome involved and the proportional content in individual tissues. As the trisomy cell line of some mosaics might have a disadvantage in biological selection it might not be detected in routine lymphocyte investigations. For evaluation of the clinical relevance in the case of an imprinted chromosome the associated imprinting disorder must also be considered. In a postnatal setting analysis of UPD is indicated in the case of clinical, cytogenetic and molecular data. In the prenatal setting genetic counseling of the parents should be offered prior to any laboratory testing. In total, the impact of mosaicism associated with UPD has to consider the affected chromosome, the associated phenotype, the mechanism of formation and the laboratory method used.     

Interphase cytogenetics on paraffin-embedded sections of ovary for detection of genomic constitution in a patient with Turner's syndrome and chromosomal mosaicism

The difficulty of detecting sex chromosome mosaicism cytogenetically hinders the finding of an acceptable explanation for phenotypic-genotypic discrepancy amongst those patients. Fluorescence in situ hybridization (FISH) permits the genomic identification of patients with mosaic karyotypes in interphase nuclei by utilising an X chromosome-specific DNA probe (interphase cytogenetics). We evaluated the efficiency of interphase cytogenetics in the detection of the genomic constitution of the ovary from a patient with Turner's syndrome having mosaicism (46,XX/45,X0) previously established by blood lymphocyte karyotyping. We used a biotin-labelled alphoid repetitive sequence, pBAMX5, specific for the centromeric region of the human X chromosome. Although examination of ovarian sections and blood lymphocytes by FISH showed the presence of both 46,XX and 45,X0 cell lines, the genomic constitution of the germ cells/oocytes in ovarian primordial follicles was shown to be normal (46,XX). Our results (1) show the high applicability of interphase cytogenetics on paraffin sections, (2) indicate the possibility of genomic screening of different tissues that are otherwise not amenable to routine cytogenetic investigation and (3) offer a reliable methodological approach to defining accurate by the percentage of abnormal karyotypes in mosaicism of different organs and non-dividing tissues.     

The origin of 45,X males.

Maleness in association with the karyotype 45,X is a very rare and hitherto unexplained condition previously described in only four or five patients. This study was carried out to determine whether such males might actually possess Y-chromosomal material. Of the two 45,X males studied, one was found to be a low-grade mosaic with a 46,XY karyotype in less than 3% of fibroblasts; all lymphocytes karyotyped were 45,X. Fibroblast DNA from this individual was found to contain Y-specific repeated sequences in 1%-3% the amount observed in the father, consistent with mosaicism for a 46,XY cell line. No Y-specific repeated sequences were detected in the other patient, in whom all mitoses were 45,X. In neither patient were there detectable amounts of any of the single-copy Y-specific DNA sequences for which we tested. Studies of Xg blood groups and of X-linked restriction fragment length polymorphisms indicated that the single X chromosome was of maternal origin in both 45,X male probands. In contrast to the situation in XX males, we can exclude paternal X-Y interchange as the etiology in the cases described here. Our findings are compatible with mosaicism being the explanation of at least some "45,X" males.     

Chromosome 14 maternal uniparental disomy in the euploid cell line of a fetus with mosaic 46,XX/47,XX,+14 karyotype

We investigated the parental origin of the extra chromosome 14 and of the two chromosomes 14 of the euploid cell line, in a case of fetal mosaicism 46,XX/47,XX+14 diagnosed at amniocentesis. Molecular analysis of five polymorphic loci of the short tandem repeat type was performed. Markers D14S43 and D14S49 showed the presence of maternal uniparental disomy of chromosome 14 in the apparently normal cell line. The distribution of the markers analysed along the chromosome suggests maternal heterodisomy with a large isodisomic segment in the telomeric region, possibly caused by meiotic crossing-over.     

Turner syndrome: a study of chromosomal mosaicism

We report the results of a molecular investigation of 25 patients who had Turner syndrome and who had previously been subject to analysis using cytogenetic techniques. When in situ hybridization and polymerase chain reaction (PCR) techniques were applied, a larger number of mosaic individuals were observed than were detected by cytogenetic methods. This was mainly because of the presence of the cell line 46,XX. The most frequent mosaics were 45,X/46,XX (36%); the presence of isochromosomes comprised 24% and fragments 12%. The patients who had been previously diagnosed with mosaicism displayed a higher complexity in their karyotypes because of the presence of new cellular lines. The isodicentric X chromosome for the long arm, idic(Xq), gave rise to complex mosaics of up to nine cell lines. The application of fluorescence in situ hybridization and PCR led to a clearer definition of alterations at the centromeric level and the identification of the nature of chromosome fragments. Received: 2 August 1995 / Revised: 5 February 1996     

Origin of acrocentric trisomies in spontaneous abortuses

Summary A total of 33 spontaneous abortuses with various acrocentric trisomies were studied for the origin of the extra chromosomes using Q- and R-band polymorphisms as markers. Eleven trisomic abortuses were informative: nine trisomic abortuses (one with trisomy 13, three with trisomy 21, and five with trisomy 22 including one with a 46,XX/47,XX,+22 mosaicism) originated at maternal first meiosis; a 21-trisomic abortus resulted from an error at maternal second meiosis (or first mitosis); and a 13-trisomic abortus was of maternal first or second meiotic origin. The abortus with mosaic trisomy 22 started as a 22-trisomic zygote resulting from an error at maternal first meiosis, followed by a mitotic (in vivo or in vitro) loss of the paternally derived chromosome 22.     

Hypomelanosis of ito and a 'mirror image' whole chromosome duplication resulting in trisomy 14 mosaicism

We describe a female infant with multiple congenital anomalies including unusual hyperpigmentation, tetralogy of Fallot, absent corpus callosum and wide prominent nasal bridge. The infant was initially seen for genetic consultation on day one after birth. Chromosome analysis from cultured lymphocytes showed a normal 46,XX karyotype. However, cultured skin fibroblasts showed mosaicism with 46,XX,add(14)(q32).ish psu dic dup(14)(q32p13)(wcp14+)/46,XX complements. A review of the published report with chromosome mosaicism and hypomelanosis of Ito (HMI) is included. We suggest that the trisomy 14 mosaicism seen in fibroblast cultures has importance in the expression of pigmentation dysplasias in this patient. Pigmentary anomaly may be due to loss or gain of specific genes that influence pigmentation located on the long arm of chromosome 14 in this patient.     

Exclusively paternal X chromosomes in a girl with short stature

A 13 1/2 year-old girl with short stature and very few Turner stigmata revealed 45,X/46,XX mosaicism with 90%–100% 46,XX cells in three sequential blood lymphocyte cultures. Molecular investigation of the parental origin of her X chromosomes revealed homozygosity for paternal X markers and an absence of maternal markers. Luteinizing hormone response to growth hormone releasing hormone was increased. Impaired gonadal function and shortness of stature in this case could be a result of the mild mosaicism with a 45,X cell line and/or is a consequence of the paternal-only origin of her X chromosomes.     

Trisomy 8

Summary Trisomy 8, in mosaic or non-mosaic form is an extremely rare chromosomal condition in man. Liveborn subjects usually present with mental retardation, bone and joint anomalies and a variety of other physical anomalies. The mental retardation associated with the condition is, however, usually moderate compared to that found in other viable human autosomal trisomic conditions. The present report describes a trisomy 8 mosaic male subject with normal IQ and near-normal phenotype, ascertained through infertility. Chromosome studies on peripheral blood lymphocytes reveal a pure trisomy 8 constitution; cultured skin fibroblasts show 46,XY/47,XY+8 mosaicism. At meiosis, the extra No. 8 chromosome is missing from the germ line. The testicular histology indicates a germ cell maturation arrest in many spermatocytes and the patient is severely oligospermic. Biochemical studies to assay levels of glutathione reductase, a red cell enzyme, the gene for which resides in chromosome 8, show increased levels in the trisomy 8 patient compared with controls.     

46,XX/46,XX,del (10) (p13)/47,XX,+r/47,XX,del (10) (p13), + r mosaicism and partial trisomy 10p phenotype (author's transl)]

The mosaicism 46,XX/46,XX,del(10)(p13)/47,XX, +r/47,XX,del(10)(p13), +r was found in the lymphocytes and the fibroblasts of a patient with the following : profound mental retardation; craniofacial dysmorphism with frontal bossing, fine eyebrows, a large hypoplastic nasal bridge, prognathism of the upper jaw, thick lips; a long and thin neck; congenital heart disease; skeletal malformations, with club feet; and hypotonia and lax ligaments. These malformations, compatible with the trisomy 10p syndrome, suggest that the supernumerary ring chromosome was composed of 10p material. An increase of HK1 and GOT1 activities was found. This is in favour of a partial trisomy of chromosome 10. The relative frequencies of the clones constituting the mosaic vary from tissue to tissue and with time.     

Localized chromosomal mosaicism as a cause of dysmorphic development

Regional chromosomal mosaicism has been found in tissue from the clitoral mass of an infant presenting with ambiguous genitalia. Chromosome analysis of skin from the clitoral mass was interpreted as 46,XX/52,XX, +2, +7, +8, +12, +13, +20, whereas study of ovarian tissue and peripheral lymphocytes found each to have normal 46,XX karyotypes with no indication of mosaicism. We believe that somatic cell mutation led to a hyperdiploid clonal cell line resulting in maldevelopment of this patient's external genitalia. This observation, which to our knowledge has not been previously reported, indicates that localized chromosomal abnormalities in some cases may be etiologic of isolated congenital malformations.     

Detection of mosaic and non-mosaic chromosome abnormalities in 6- to 8-day-old human blastocysts

A reliable technique has been developed for the production of good quality G-banded chromosome preparations from 6- to 8-day-old human blastocysts (20– 800 cell stage) from an in vitro fertilization programme. The technique involves a thymidine cell division synchronization step to reduce the exposure time to colcemid, in conjunction with a simple 70% acetic acid disaggregation procedure to produce discrete metaphases for analysis. Of 105 blastocysts processed by this technique, 9 were lost during handling and 10 showed no dividing cells. The remaining 86 produced useful separate metaphases with a mean mitotic activity of 6.5%. A full G-banded karyotype was obtained from 1–6 cells in 55 blastocysts (64%), incomplete G-banded analysis but with full information of ploidy was obtained from 18 blastocysts (21%), with 13 (15%) producing no useful cytogenetic results. Abnormalities observed included polyploidy, diploid/polyploid mosaicism, non-mosaic trisomy 16 (2 cases), 46,Xdel(X)(q21)/46,XX (1 case) and several single cells with trisomies or structural anomalies in otherwise normal blastocysts. Variable levels of structural chromosome damage, with apparent interchanges, chromosome branching and anomalous chromatid pairing were also seen. Received: 22 April 1997 / Accepted: 27 May 1997     

A rare case: mosaic trisomy 22.

A 9-year-old female child of healthy parents (mother: 43 years, father: 44 years) was referred to our center because of severe mental retardation. While pedigree analysis was not contributory, two older sibs were normal and healthy. Physical examination revealed facial dysmorphism, microcephaly and hyperflexibility of all joints. Her chromosome constitution showed a mosaic pattern; mos 46,XX[98]/47,XX,+22[2]. So skin biopsy was performed and mosaic trisomy 22 was confirmed with FISH analysis (46,XX[73]/47,XX,+22[27]). Physical features of this case seemed consistent with her mosaic constitution. This report would be a demonstrative example to show the significant contribution of FISH in states of mosaicism.