Nance-Horan syndrome: localization within the region Xp21.1-Xp22.3 by linkage analysis.

Nance-Horan Syndrome (NHS) or X-linked cataract-dental syndrome (MIM 302350) is a disease of unknown pathogenesis characterized by congenital cataracts and dental anomalies. We performed linkage analysis in three kindreds with NHS by using six RFLP markers between Xp11.3 and Xp22.3. Close linkage was found between NHS and polymorphic loci DXS43 (theta = 0 with lod score 2.89), DXS41 (theta = 0 with lod score 3.44), and DXS67 (theta = 0 with lod score 2.74), defined by probes pD2, p99-6, and pB24, respectively. Recombinations were found with the marker loci DXS84 (theta = .04 with lod score 4.13), DXS143 (theta = .06 with lod score 3.11) and DXS7 (theta = .09 with lod score 1.68). Multipoint linkage analysis determined the NHS locus to be linked completely to DXS41 (lod score = 7.07). Our linkage results, combined with analysis of Xp interstitial deletions, suggest that the NHS locus is located within or close to the Xp22.1-Xp22.2 region.     

X-linked ichthyosis,due to steroid sulphatase deficiency,associated with Kallmann syndrome (hypogonadotropic hypogonadism and anosmia): linkage relationships with Xg and cloned DNA sequences from the distal short arm of the X chromosome

Summary We report a large Italian pedigree in which five out of six males are affected by a syndrome, following an X-linked inheritance pattern, characterized by ichthyosis, hypogonadotropic hypogonadism, and anosmia. The concurrence of features of X-linked ichthyosis (XLI) with those of Kallmann syndrome, another disease often inherited as an X-linked trait, prompted us to perform biochemical, cytogenetic, and molecular studies in relation to the short arm of the X chromosome (Xp). Steroid sulphatase (STS) activity was found to be completely deficient in all affected members of the family. Prometaphase chromosome analyses of two obligate heterozygous women and one affected male showed normal karyotypes. Xg blood group antigen analysis and molecular studies employing cloned DNA sequences from the distal segment of the Xp (probes RC8, 782, dic56, and M1A), did not provide evidence for deletions or rearrangements of the X chromosome. The linkage analysis showed no crossovers between the disease, Xg, and DXS 143, the locus defined by probe dic56, thus suggesting the possibility of a linkage between these two markers of the distal segment of Xp and the X-linked ichthyosis, hypogonadism, and anosmia syndrome.     

Definitive localization of Becker muscular dystrophy in Xp by linkage to a cluster of DNA polymorphisms (DXS43 and DXS9)

Summary A study of linkage between Becker muscular dystrophy and four X chromosome-specific DNA polymorphisms in 17 kindreds has indicated that this gene is located in Xp, as already anticipated by single pedigree analysis. In particular the DXS43 and DXS9 loci, identified by probes D2 and RC8, respectively, are closely linked to each other and are both located at approximately 15 cM from the Becker locus. These linkage data, together with the previously established linkage between Becker and the DXS7 locus identified by probe L 1.28, indicate that the Becker gene is located in the same region where Duchenne has been mapped and also yield information about relative genetic distances among different DNA polymorphisms of the X chromosome.     

Multipoint linkage analysis of steroid sulfatase (X-linked ichthyosis) and distal Xp markers

Six families with steroid sulfatase deficiency (STS; X-linked ichthyosis) have been studied with the Xg blood group (XG) and the DNA markers dic56 (DXS143), 782 (DXS85), pD2 (DXS43), and GMGX9. Carrier status of females was determined by assay of STS in hair roots. GMGX9 detects a frequent restriction fragment length polymorphism and also identifies a deletion in the majority of families with STS deficiency, including five of the six reported here. The linkage relationship of this marker to the others was studied in normal three-generation families yielding 32 phase-known meioses informative for two or more markers. No recombinants were observed between STS and GMGX9, giving a maximum lod score of 8.73 at zero recombination. Multipoint linkage analysis taking STS and GMGX9 as a single locus and incorporating two-point marker data and STS-XG data from published studies gave the map (Sequence: see text). This order was 2.4 times more likely than with (STS,GMGX9) and dic56 reversed and is supported by our findings in a male with steroid sulfatase deficiency due to a deletion of Xp22.3 which encompasses the XG locus. He is deleted for GMGX9 but shows normal hybridization to dic56 and 782.     

Localization of the gene for X-linked recessive type of retinitis pigmentosa (XLRP) to Xp21 by linkage analysis.

The X-linked recessive type of retinitis pigmentosa (XLRP) causes progressive night blindness, visual field constriction, and eventual blindness in affected males by the third or fourth decade of life. The biochemical basis of the disease is unknown, and prenatal diagnosis and definitive carrier diagnosis remain elusive. Heterogeneity in XLRP has been suggested by linkage studies of families affected with XLRP and by phenotypic differences observed in female carriers. Localization of XLRP near Xp11.3 has been suggested by close linkage to an RFLP at the locus DXS7 (Xp11.3) detected by probe L1.28. In other studies a locus for XLRP with metallic sheen has been linked to the ornithine transcarbamylase (OTC) locus mapping to the Xp21 region. In this study, by linkage analysis using seven RFLP markers between Xp21 and Xcen, we examined four families with multiple affected individuals. Close linkage was found between XLRP and polymorphic sites OTC (theta = .06 with lod 5.69), DXS84 (theta = .05 with lod 4.08), and DXS206 (theta = .06 with lod 2.56), defined by probes OTC, 754, and XJ, respectively. The close linkage of OTC, 754, and XJ to XLRP localizes the XLRP locus to the Xp21 region. Data from recombinations in three of four families place the locus above L1.28 and below the Duchenne muscular dystrophy (DMD) gene, consistent with an Xp21 localization. In one family, however, one affected male revealed a crossover between XLRP and all DNA markers, except for the more distal DXS28 (C7), while his brother is recombined for this marker (C7) and not other, more proximal markers. This suggests that in this family the XLRP mutation maps near DXS28 and above the DMD locus.     

X-linked alpha-thalassemia/mental retardation (ATR-X) syndrome: localization to Xq12-q21.31 by X inactivation and linkage analysis.

We have examined seven pedigrees that include individuals with a recently described X-linked form of severe mental retardation associated with alpha-thalassemia (ATR-X syndrome). Using hematologic and molecular approaches, we have shown that intellectually normal female carriers of this syndrome may be identified by the presence of rare cells containing HbH inclusions in their peripheral blood and by an extremely skewed pattern of X inactivation seen in cells from a variety of tissues. Linkage analysis has localized the ATR-X locus to an interval of approximately 11 cM between the loci DXS106 and DXYS1X (Xq12-q21.31), with a peak LOD score of 5.4 (recombination fraction of 0) at DXS72. These findings provide the basis for genetic counseling, assessment of carrier risk, and prenatal diagnosis of the ATR-X syndrome. Furthermore, they represent an important step in developing strategies to understand how the mutant ATR-X allele causes mental handicap, dysmorphism, and down-regulation of the alpha-globin genes.     

Normal sequence of the gonadotropin-releasing hormone gene in patients with idiopathic hypogonadotropic hypogonadism.

Idiopathic hypogonadotropic hypogonadism (IHH) results from absent or greatly diminished secretion of GnRH. Defects in the GnRH gene have been identified in an animal model of IHH and have been hypothesized as a possible basis for GnRH deficiency in humans. In this study, we used the polymerase chain reaction to clone and sequence the coding regions, promoter, and 3' untranslated tract of the GnRH genes from both alleles of four unrelated patients with IHH. One of the patients studied is a member of a kindred in which X-linked inheritance has been excluded by father-to-son transmission of the disease. No DNA sequence mutations were found. We conclude that most cases of IHH in humans do not involve mutations in the GnRH gene and are presumably caused by mutations at one or more other genetic loci that are required for normal function of GnRH-producing neurons.     

X-linked dominant cone-rod degeneration: linkage mapping of a new locus for retinitis pigmentosa (RP 15) to Xp22.13-p22.11.

Retinitis pigmentosa is the name given to a heterogeneous group of hereditary retinal degenerations characterized by progressive visual field loss, pigmentary changes of the retina, abnormal electroretinograms, and, frequently, night blindness. In this study, we investigated a family with dominant cone-rod degeneration, a variant form of retinitis pigmentosa. We used microsatellite markers to test for linkage to the disease locus and excluded all mapped autosomal loci. However, a marker from the short arm of the X chromosome, DXS989, showed 0% recombination to the disease locus, with a maximum lod (log-odds) score of 3.3. On the basis of this marker, the odds favoring X-linked dominant versus autosomal dominant inheritance are > 10(5):1. Haplotype analysis using an additional nine microsatellite markers places the disease locus in the Xp22.13-p22.11 region and excludes other X-linked disease loci causing retinal degeneration. The clinical expression of the retinal degeneration is consistent with X-linked dominant inheritance with milder, variable effects of Lyonization affecting expression in females. On the basis of these data we propose that this family has a novel form of dominant, X-linked cone-rod degeneration with the gene symbol "RP15."     

Localization of the microsatellite probe DXS426 between DXS7 and DXS255 on Xp and linkage to X-linked retinitis pigmentosa.

The microsatellite marker DXS426 maps to the interval Xp21.1-Xp11.21, the chromosomal region which contains two loci for X-linked retinitis pigmentosa (XLRP; RP2 and RP3). We have refined the localization of DXS426 both physically, by mapping it to a deletion which spans the interval Xp21.3-Xp11.23, and genetically, by studying multiply informative crossovers which indicate that DXS426 lies between DXS7 and DXS255 (i.e., Xp11.4-Xp11.22). As this is the region which contains the RP2 gene, RP2 families could be identified on the basis of linkage of XLRP to DXS426. Multiply informative crossovers in two RP2 families indicate that the most likely location of the RP2 gene is between DXS426 and DXS7. DXS426 is therefore an important highly informative marker for the purposes of carrier detection and early diagnosis of RP2 and for the localization of the disease gene.     

Linkage of the gene for an X-linked mental retardation disorder to a hypervariable (AGAT)n repeat motif within the human hypoxanthine phosphoribosyltransferase (HPRT) locus (Xq26).

We recently reported a new X-linked mental retardation (XLMR) disorder in a four-generation family of Dutch descent. Features included Dandy-Walker malformation, basal ganglia disease, and seizures. Twenty-six family members, including two living affected males and two obligate carriers, were available for study. No evidence of linkage was observed between the disease locus and RFLPs from several X-chromosome regions, including Xp21-p22 (13 markers), proximal Xq (four markers), and Xq28 (three markers). However, a new hypervariable short tandem repeat (STR) within the HPRT gene at Xq26 showed positive linkage to the disease locus, with a maximum lod score of 2.19 at a recombination fraction of 0. A second hypervariable marker in Xq26, the dinucleotide repeat XL90A3 (DXS425), showed a lod score of .84 at a recombination fraction of .11. Both the HPRT and DXS425 markers were typed in 40 CEPH families, and subsequent multipoint linkage analysis showed the following order: Xcen-DXS425-(HPRT,XLMR)-F9-qter. HPRT and these flanking markers are therefore useful for carrier detection and prenatal diagnosis in this family. This study illustrates that hypervariable STRs will be powerful tools for linkage analysis and genetic diagnosis, particularly when relatively small families are involved.     

Linkage analysis of X-linked cone-rod dystrophy: localization to Xp11.4 and definition of a locus distinct from RP2 and RP3.

Progressive X-linked cone-rod dystrophy (COD1) is a retinal disease affecting primarily the cone photoreceptors. The COD1 locus originally was localized, by the study of three independent families, to a region between Xp11.3 and Xp21.1, encompassing the retinitis pigmentosa (RP) 3 locus. We have refined the COD1 locus to a limited region of Xp11.4, using two families reported elsewhere and a new extended family. Genotype analysis was performed by use of eight microsatellite markers (tel-M6CA, DXS1068, DXS1058, DXS993, DXS228, DXS1201, DXS1003, and DXS1055-cent), spanning a distance of 20 cM. Nine-point linkage analysis, by use of the VITESSE program for X-linked disorders, established a maximum LOD score (17.5) between markers DXS1058 and DXS993, spanning 4.0 cM. Two additional markers, DXS977 and DXS556, which map between DXS1058 and DXS993, were used to further narrow the critical region. The RP3 gene, RPGR, was excluded on the basis of two obligate recombinants, observed in two independent families. In a third family, linkage analysis did not exclude the RPGR locus. The entire coding region of the RPGR gene from two affected males from family 2 was sequenced and was found to be normal. Haplotype analysis of two family branches, containing three obligate recombinants, two affected and one unaffected, defined the COD1 locus as distal to DXS993 and proximal to DXS556, a distance of approximately 1.0 Mb. This study excludes COD1 as an allelic variant of RP3 and establishes a novel locus that is sufficiently defined for positional cloning.     

Assignment of the gene for complete X-linked congenital stationary night blindness (CSNB1) to Xp11.3

X-linked congenital stationary night blindness (CSNB) is a nonprogressive retinal disorder characterized by a presumptive defect of neurotransmission between the photoreceptor and bipolar cells. Carriers are not clinically detectable. A new classification for CSNB includes a complete type, which lacks rod function by electroretinography and dark adaptometry, and an incomplete type, which shows some rod function on scotopic testing. The refraction in the complete CSNB patients ranges from mild to severe myopia; the incomplete ranges from moderate hyperopia to moderate myopia. To map the gene responsible for this disease, we studied eight multigeneration families, seven with complete CSNB (CSNB1) and one with incomplete CSNB, by linkage analysis using 17 polymorphic X-chromosome markers. We found tight genetic linkage between CSNB1 and an Xp11.3 DNA polymorphic site, DXS7, in seven families with CSNB1 (LOD 7.35 at theta = 0). No recombinations to CSNB1 were found with marker loci DXS7 and DXS14. The result with DXS14 may be due to the small number of scored meioses (10). No linkage could be shown with Xq loci PGK, DXYS1, DXS52, and DXS15. Pairwise linkage analysis maps the gene for CSNB1 at Xp11.3 and suggests that the CSNB1 locus is distal to another Xp11 marker, TIMP, and proximal to the OTC locus. Five-point analysis on the eight families supported the order DXS7-CSNB1-TIMP-DXS225-DXS14. The odds in favor of this order were 9863:1. Removal of the family with incomplete CSNB (F21) revealed two most favored orders, DXS7-CSNB1-TIMP-DXS255-DXS14 and CSNB1-DXS7-TIMP-DXS255-DXS14. Heterogeneity testing using the CSNB1-M27 beta and CSNB1-TIMP linkage data (DXS7 was not informative in F21) was not significant to support evidence of genetic heterogeneity (P = 0.155 and 0.160, respectively).     

X-linked severe combined immunodeficiency: localization within the region Xq13.1-q21.1 by linkage and deletion analysis.

X-linked severe combined immunodeficiency (SCID) (McKusick 30040; IMD4) is a disease of unknown pathogenesis characterized by severe and persistent infections from early in life that are due to absence of both cellular and humoral immune function. Although the disease has been provisionally mapped to proximal Xq, high lethality and lack of a carrier test have limited the number of scorable meioses. We performed linkage analysis in six new kindreds with X-linked SCID, using a random pattern of T-cell X inactivation to rule out the carrier state in at-risk women. Our linkage results, combined with analysis of Xq interstitial deletions, confirmed the regional assignment of X-linked SCID, narrowed the boundaries within which this locus lies to Xq13.1-q21.1, and established the locus order DXS159-(PGK1, SCID)-DXS72-DXS3, defining flanking markers for prenatal diagnosis and carrier testing.     

Linkage relationships between X-linked retinitis pigmentosa and nine short-arm markers: exclusion of the disease locus from Xp21 and localization to between DXS7 and DXS14.

Linkage data between X-linked retinitis pigmentosa (XLRP) and nine X-chromosomal markers are reported. To test the assignment of XLRP to the Xp21 region (as considered at Human Gene Mapping 8), an analysis of XLRP and six markers flanking this region was undertaken. The XLRP locus was found to be excluded from the chromosome distal to ornithine transcarbamylase (OTC) (P = 6.5 X 10(-5]. Further data were accumulated with three more probes proximal to DXS7 (L1.28), the closest linked probe. Multipoint analysis of these data suggests a posterior probability of .94 that XLRP is proximal to DXS7 (L1.28), which has been mapped to the region Xp11.3.     

Characterization of the patterns of polymorphism in a "cryptic repeat" reveals a novel type of hypervariable sequence.

Alternating purine and pyrimidine repeats (RY(i)) are an abundant source of polymorphism. The subset with long tandem repeats of GT or AC (GT(i)) have been studied extensively, but cryptic RY(i) (i.e., no single tandem repeat predominates) have received little attention. The factor IX gene has a polymorphic cryptic RY(i) of 142-216 bp. Previously, there were four known polymorphic alleles, of the form AB, A2B, A2B2, and A3B2, where A = (GT)(AC)3(AT)3(GT)(AT)4 and B = A with an additional 3'' AT dinucleotide. To further characterize this locus, we examined more than 1,700 additional human chromosomes and determined the sequences of the homologous sites in orangutans and chimpanzees. The novel alleles found in humans expand the repertoire of A/B alleles to A0-4B1 and A1-3B2. The AnB2 series are abundant in Caucasians but are absent in blacks and Asians. Conversely, the A0B1 allele is common in blacks but is not found in more than 1,700 Caucasian chromosomes. The data are compatible with a model in which recombination is more frequent than polymerase slippage at this locus. In orangutans, the RY(i) is present, but the sequence is markedly different. An A/B-type of pattern was discerned in which B differs from A by an additional six (AT) dinucleotides at the 3'' end. In chimpanzees, the size of the RY(i) locus was greatly expanded, and the sequence showed a novel pattern of hypervariability in which there are many tandem repeats of the form (GT)n(AC)o(AT)p(GT)q(AT)s, where n, o, p, q, and s are different integers. The sequences of the factor IX intron 1 cryptic RY(i) in three primates provide perspective on the range of possible patterns of polymorphism. Analysis of the patterns suggests how the RY(i) can be conserved during evolution, while the precise sequence varies.     

Human werner syndrome DNA helicase unwinds tetrahelical structures of the fragile X syndrome repeat sequence d(CGG)n

Formation of hairpin and tetrahelical structures by a d(CGG) trinucleotide repeat sequence is thought to cause expansion of this sequence and to engender fragile X syndrome. Here we show that human Werner syndrome DNA helicase (WRN), a member of the RecQ family of helicases, efficiently unwinds G'2 bimolecular tetraplex structures of d(CGG)7. Unwinding of d(CGG)7 by WRN requires hydrolyzable ATP and Mg2+ and is proportional to the amount of added helicase and to the time of incubation. The efficiencies of unwinding of G'2 d(CGG)7 tetraplex with 7 nucleotide-long single-stranded tails at their 3' or 5' ends are, respectively, 3.5- and 2-fold greater than that of double-stranded DNA. By contrast, WRN is unable to unwind a blunt-ended d(CGG)7 tetraplex, bimolecular tetraplex structures of a telomeric sequence 5'-d(TAGACATG(TTAGGG)2TTA)-3', or tetramolecular quadruplex forms of an IgG switch region sequence 5'-d(TACAGGGGAGCTGGGGTAGA)-3'. The ability of WRN to selectively unwind specific tetrahelices may reflect a specific role of this helicase in DNA metabolism.     

A (CA)n repeat polymorphism for the human skeletal muscle alpha-actinin gene ACTN2 and its localization on the linkage map of chromosome 1.

A CA dinucleotide repeat polymorphism has been identified for the skeletal muscle alpha-actinin gene ACTN2. The observed heterozygosity is 44% (predicted heterozygosity 50%, PIC 0.47). This polymorphic marker has been localized between D1S74 and D1S103 on the multipoint linkage map of chromosome 1 at a position 44.4 cM from the most distal marker D1S68 at 1 qter.