Nucleotide sequence of the gene for the b subunit of human factor XIII

Factor XIII (Mr 320,000) is a blood coagulation factor that stabilizes and strengthens the fibrin clot. It circulates in blood as a tetramer composed of two a subunits (Mr 75,000 each) and two b subunits (Mr 80,000 each). The b subunit consists of 641 amino acids and includes 10 tandem repeats of 60 amino acids known as GP-I structures, short consensus repeats (SCR), or sushi domains. In the present study, the human gene for the b subunit has been isolated from three different genomic libraries prepared in lambda phage. Fifteen independent phage with inserts coding for the entire gene were isolated and characterized by restriction mapping, Southern blotting, and DNA sequencing. The gene was found to be 28 kilobases in length and consisted of 12 exons (I-XII) separated by 11 intervening sequences. The leader sequence was encoded by exon I, while the carbonyl-terminal region of the protein was encoded by exon XII. Exons II-XI each coded for a single sushi domain, suggesting that the gene evolved through exon shuffling and duplication. The 12 exons in the gene ranged in size from 64 to 222 base pairs, while the introns ranged in size from 87 to 9970 nucleotides and made up 92% of the gene. The introns contained four Alu repetitive sequences, one each in introns A, E, I, and J. A fifth Alu repeat was present in the flanking 3' end of the gene. Two partial KpnI repeats were also found in the introns, including one in intron I and one in intron J. The KpnI repeat in intron J was 89% homologous to a sequence of approximately 2200 nucleotides flanking the gene coding for human beta globin and approximately 3800 nucleotides from the L1 insertion present in the gene for human factor VIII. Intron H also contained an "O" family repeat, while two potential regions for Z-DNA were identified within introns G and J. One nucleotide change was found in the coding region of the gene when its sequence was compared to that of the cDNA. This difference, however, did not result in a change in the amino acid sequence of the protein.     

A catalase from the freshwater mussel Cristaria plicata with cloning, identification and protein characterization

Catalase is an important antioxidant protein which can protect organisms against various oxidative stresses by eliminating hydrogen peroxide. The catalase cDNA of Cristaria plicata (cpCAT) was cloned from the haemocytes using degenerate primers by the method of 3' and 5' rapid amplification of cDNA ends PCR. The gene is 4863 bp long and has a total of two introns and three exons. The precise size and location of the introns and exons have been determined. In addition the full-length cDNA of cpCAT contained 2618 bp, The cDNA contained a 5' untranslated region (UTR) of 136 nucleotides, the 3' UTR of 979 bp with a canonical polyadenylation signal sequence AATAAA and a polyA tail, and an open reading frame (ORF) of 1503 bp, encoding 501 amino acid residues with 56.86 kDa predicted molecular weight. The theoretical isoelectric point was 6.77. BLAST analysis showed that the deduced amino acid sequence of cpCAT had significant homology to catalases from animals, plants and bacteria. The deduced amino acid sequence of cpCAT had characteristic features of catalase family such as catalytic site motif (61FNRERIPERVVHAKGAG77), heme-ligand signature motif (351RLYSYSDTH359), two glycosylation sites (N145, N436), NADPH binding site and the three catalytic amino acid residues (His72, Asn145 and Tyr355). It had no signal peptide. The phylogenetic tree indicated that cpCAT gene was very close to the gene of scallops, Chlamys farreri. The enzymatic activity of purified recombinant cpCAT was 11194.4 ± 40.4 U/mg, it might resist against H(2)O(2). The recombinant enzyme held higher thermal stability, the optimum temperature was 25 °C, it retained more than 82% activity between 25 and 60 °C. The stability of the recombinant enzyme were higher between pH 5 and 10, and the optimal pH value was 7.0. When cpCAT was treated with 2-4 moL/L urea and 1%-3% SDS, the activity was also stable, it kept more than 80% activity.     

Larval salivary gland secretion proteins in Drosophila structural analysis of the Sgs-5 gene

The structure of the Drosophila melanogaster salivary gland secretion gene Sgs-5 has been determined by DNA sequence analysis of cloned genomic DNA. This developmentally and tissue-specific gene is a member of the third instar intermolt gene set and is under control of the insect molting hormone ecdysterone. RNA protection experiments show that the RNA coding region of Sgs-5 contains 769 nucleotides and is divided into three exons by two small introns. The protein-coding region appears to begin after a short untranslated RNA leader (33 nucleotides) and to result in a protein of 163 amino acids. The first 18 amino acids give the amino-terminal end the highly hydrophobic nature characteristic of a signal peptide.     

Structure of the human pancreatic cholesterol esterase gene.

The gene for human pancreatic cholesterol esterase consists of 11 exons and 10 introns and is 9.2 kb in length. The last and longest exon (841 nucleotides) is unique to the human gene. Functional amino acids are encoded on separate exons. The leader sequence is encoded by a single exon which carries two additional N-terminal amino acids of the mature functional protein. A positive TATA element is identified 43 nucleotides from the start codon. Pulse-field gel electrophoresis and hybridization with various cDNA probes and direct sequence data revealed the existence of a CEase-like gene. Partial sequence analysis of this gene from a human cosmid library and human genomic DNA showed a premature stop signal in exon 10, shortly after the codon for the active-site histidine. Both the functional gene and the CEase-like gene have a polyadenylation signal in the 3'-untranslated region. Thus, the complex gene structure for this intestinally active enzyme may provide in part a potential molecular explanation for the well-known heterogeneity of the intestinal absorption of cholesterol.     

Cloning and characterization of a novel gene,WS-3, in human chromosome 8p11-p12

A novel human gene referred to as the WS-3 gene, in the short arm of human chromosome 8, was cloned by a combination of exon trapping, thermal asymmetric interlaced-PCR (TAIL-PCR) and the Marathon-Ready cDNA amplification method. The gene consists of 7 exons separated by 6 introns, and is at the telomere side of the STS marker, D8S1055. The full-length WS-3 gene contains 1052 nucleotides and codes for a protein of 190 amino acids with a calculated mol. wt. of 20 747. Southern blot experiments showed that the WS-3 gene exists as a single copy in the human genome. A protein encoded by the WS-3 gene has an R-G-D (Arg-Gly-Asp) motif in the N-terminal region, which seems to confer adhesive properties to macromolecular proteins like fibronectin. Although WS-3 is a small gene with unknown biological function, its ubiquitous expression in various tissues and organs suggests that the encoded protein is one of the essential components of all organs and tissues.     

Structural organization and complete sequence of the human alpha-N-acetylgalactosaminidase gene: homology with the alpha-galactosidase A gene provides evidence for evolution from a common ancestral gene.

Human alpha-N-acetylgalactosaminidase (alpha-GalNAc; EC 3.2.1.49), the lysosomal glycohydrolase that cleaves alpha-N-acetylgalactosaminyl moieties in glycoconjugates, is encoded by a gene localized to chromosome 22q13----qter. The deficient activity of this enzyme results in Schindler disease, an autosomal recessive disorder characterized by the increased urinary excretion of glycopeptides and oligosaccharides containing alpha-N-acetylgalactosaminyl moieties. Recently, the 3.6-kb full-length alpha-GalNAc cDNA sequence was isolated and found to have remarkable nucleotide and predicted amino acid homology (55.8 and 46.9%, respectively) with the human alpha-galactosidase A (alpha-Gal A) cDNA. To investigate the possible evolutionary relatedness of the two glycosidases, the alpha-GalNAc chromosomal gene was isolated and characterized. Screening of a human genomic DNA cosmid library resulted in the identification of a clone, gAGB-1, with an approximately 35-kb insert that contained the entire alpha-GalNAc gene. A single approximately 15-kb EcoRI fragment of gAGB-1, which contained the complete 3.6-kb cDNA sequence, was digested and the subcloned fragments were sequenced in both orientations. The 13,709-bp alpha-GalNAc gene had nine exons ranging from 95 to 2028 bp and intronic sequences of 304 to 2684 bp. All exon/intron junctions conformed to the GT/AG consensus rule. Analysis of 1.4 kb of 5' flanking sequence revealed three Sp1 and two CAAT-like promoter elements. This region was GC-rich (56%), but no HTF island was identified. The gene contained six Alu-repetitive elements, all in the reverse orientation. Comparison of the structural organization of the alpha-GalNAc and the alpha-Gal A genes revealed that all six alpha-Gal A introns were identically positioned in the homologous alpha-GalNAc exonic sequence. Two additional introns, 1 and 8, were identfied in the alpha-GalNAc gene. The predicted amino acid sequences of alpha-GalNAc exons 2 through 7 and those of corresponding alpha-Gal A exons 1 through 6 were 46.2 to 62.7% identical. In contrast, there was little, if any, similarity between the deduced amino acid sequences of alpha-Gal A exon 7 and alpha-GalNAc exons 8 and 9. The remarkable amino acid identity and the identical exonic interruption by six introns of the alpha-GalNAc and alpha-Gal A genes suggest that this region in both genes is evolutionarily related and arose through duplication and divergence from a common ancestral gene.     

Isolation and characterization of the three Waxy genes encoding the granule-bound starch synthase in hexaploid wheat.

Complete genomic DNA sequences of three homoeologous Waxy structural genes, located on the chromosomes 7A, 4A, and 7D in hexaploid wheat (Triticum aestivum L. cv. Chinese Spring), were separately determined and analyzed. Those structural genes in lengths from start to stop codon were 2781bp in Wx-7A, 2794bp in Wx-4A, and 2862bp in Wx-7D, each of which consisted of 11 exons and ten introns. They were closely similar to one another in the nucleotide sequences, with 95.6-96.3% homology in mature protein regions, 88. 7-93.0% in transit-peptide regions, and 70.5-75.2% in the introns. These wheat Waxy genes were GC-rich when compared with standard values for plant genomes reported so far. This was reflected in the extremely high G/C occupation frequency at the third position of the codons in the coding regions. The sequence divergence in the exon regions was mostly due to the substitution of nucleotides, whereas that found in the introns was attributed to substitution, insertion and/or deletion of nucleotides. Only the Wx-4A gene contained a trinucleotide insertion (CAA) in the region encoding the transit peptide. Most of the substitutions observed in the exon regions were categorized as synonymous, and higher sequence similarities (96.5-97. 4%) were conserved at the protein level. The phylogenetic tree obtained in terms of the amino acid sequence variations showed a well-resolved phylogenetic relationship among wheat Waxy genes and those from other plants.     

Characterization of the human platelet glycoprotein IIIa gene. Comparison with the fibronectin receptor beta-subunit gene

This study was designed to determine the structure of the gene for glycoprotein (GP) GPIIIa, the beta-subunit of the platelet membrane GPIIb-IIIa complex. The complexity of the gene was determined after Southern analysis of human chromosomal DNA. Overlapping genomic clones were isolated from cosmid and phage lambda libraries that contained the entire coding unit of the human gene for the mature GPIIIa protein. The genomic clones spanned approximately 60 kilobase pairs of human DNA sequence. The exon containing segments of the clones was mapped and the exons, including the exonintron junctions, were sequenced. The GPIIIa protein is divided into 14 exons ranging in size from 87 to 430 nucleotides separated by introns, which were 0.3 to 9 kilobase pairs in size. The 3' exon was larger than 1700 nucleotides and contained the 3'-untranslated region. Several structural domains of the GPIIIa protein were contained within individual exons. These included (i) the transmembrane spanning segment, (ii) the cytoplasmic region containing the potential phosphorylation sites, and (iii) the six domains in the NH2-terminal half of GPIIIa that are highly conserved between two other integrin beta-subunits. In contrast, other domains such as the four cysteine-rich repeats were interrupted by introns. Genomic clones for the beta-subunit of the fibronectin receptor (beta 1) were also isolated, partially mapped, and sequenced. Of the eight splice sites identified in beta 1, six occurred at the same amino acid residue in GPIIIa. These results provide genetic evidence that GPIIIa and beta 1 have a common evolutionary origin within the integrin family.     

Cloning and characterization of the carp prolactin gene

A carp genomic DNA clone containing the carp prolactin (Prl) gene was isolated with carp Prl cDNA as a probe. The organization of the carp Prl gene was determined by restriction nuclease mapping and nucleotide sequencing. The Prl gene comprises approx. 2.8 kilobasepairs (kb) of DNA including the 5'-flanking region, five exons, four introns and the 3'-flanking region. Analysis of the 5'-flanking region reveals (1) the sequence TATATAAT at positions -38 to -31 upstream from the cap site which was found to be a guanine residue, and (2) the palindrome, CTCATTGCATATACAAATGAG at positions -79 to -59. The carp Prl gene matches with the reported cDNA except for one difference in coding region and five in the 3'-flanking region, while the encoded amino acid sequences are identical. The arrangement of exons and introns is very similar to that seen in carp GH as well as mammalian Prl, which, however, have much longer introns.     

Partial structure of the gene for chicken cartilage proteoglycan core protein

A genomic DNA fragment (gCORE-1), encoding a portion of the cartilage proteoglycan core protein, has been isolated from a phage library using cDNA as a probe. The genomic insert is about 17 kilobase pairs; two BamHI fragments of the insert (1.3 and 4.8 kilobase pairs) contain most of the hybridizable sequences found in the cDNA. Sequence analysis of these fragments shows that they contain a total of five exons that encompass 216 amino acid residues, all of which are identical to those of the corresponding cDNA sequence. Three of the exons, which are adjacent to one another, are very similar to the corresponding exons in the gene of a rat hepatic lectin as well as to an exon in the gene of human pulmonary surfactant-associated protein. There is a strong degree of conservation of amino acid sequences encoded in the three genes, although there is no similarity between their introns. The sizes of the five exons in gCORE-1, except for one (which is indeterminate because only a partial cDNA sequence is available), are less than 184 base pairs, whereas the sizes of the introns range from 218 to greater than 2629 base pairs. Four of the introns interrupt an exon codon at either their donor or acceptor sites, between the first and second nucleotides. Only one intron does not split a codon. Intron and exon boundary sites are in agreement with known consensus sequences for introns. The dispersed distribution and relatively small size of the exons, if representative of the entire gene, suggest that the complete gene which codes for the core protein may be quite sizable.