Effects of A:T base pairs on the B-Z conformational transitions of DNA

Effects of A:T base pairs on the propensity of B to Z conformational transitions have been investigated by the CD salt titrations on d(CG)5' d(GC)5' terminal or central A:T replaced decamers, and terminal A:T appended dodecamers. The presence of A:T at the center greatly inhibits the B to Z transition of both G:C decamers. Moderate Z inhibitions are shown by terminal A:T replacements and additions to d(CG)5' with the former exhibiting a stronger effect. In contrast, the addition and replacement with A:T at the terminals of d(GC)5 facilitate the B to Z conversion, with the replacement exhibiting a somewhat more pronounced effect. These results may be rationalized in terms of the number of contigous CG sequences present in an oligomer and the relative inhibitory effects of other dinucleotide sequences. Our results also suggest that some short oligomers with purine at the 5'-end, such as d[A(CG)nT] with n greater than or equal to 2, may likely crystallize as Z conformations.     

Interactions of oligonucleotide analogs containing methylphosphonate internucleotide linkages and 2'-O-methylribonucleosides.

The interactions of oligonucleotide analogs, 12-mers, which contain deoxyribo- or 2'-O-methylribose sugars and methylphosphonate internucleotide linkages with complementary 12-mer DNA and RNA targets and the effect of chirality of the methylphosphonate linkage on oligomer-target interactions was studied. Oligomers containing a single Rp or Sp methylphosphonate linkage (type 1) or oligomers containing a single phosphodiester linkage at the 5'-end followed by 10 contiguous methylphosphonate linkages of random chirality (type 2) were prepared. The deoxyribo- and 2'-O-methylribo- type 1 12-mers formed stable duplexes with both the RNA and DNA as determined by UV melting experiments. The melting temperatures, Tms, of the 2'-O-methylribo-12-mer/RNA duplexes (49-53 degrees C) were higher than those of the deoxyribo-12mer/RNA duplexes (31-36 degrees C). The Tms of the duplexes formed by the Rp isomers of these oligomers were approximately 3-5 degrees C higher than those formed by the corresponding Sp isomers. The deoxyribo type 2 12-mer formed a stable duplex, Tm 34 degrees C, with the DNA target and a much less stable duplex with the RNA target, Tm < 5 degrees C. In contrast, the 2'-O-methylribo type 2 12-mer formed a stable duplex with the RNA target, Tm 20 degrees C, and a duplex of lower stability with the DNA target, Tm < 5 degrees C. These results show that the previously observed greater stability of oligo-2'-O-methylribonucleotide/RNA duplexes versus oligodeoxyribonucleotide/RNA duplexes extends to oligomers containing methylphosphonate linkages and that the configuration of the methylphosphonate linkage strongly influences the stability of the duplexes.     

A method for DNA sequencing by hybridization with oligonucleotide matrix.

A new technique of DNA sequencing by hybridization with oligonucleotide matrix (SHOM) which could also be applied for DNA mapping and fingerprinting, mutant diagnostics, etc., has been tested in model experiments. A dot matrix was prepared which contained 9 overlapping octanucleotides (8-mers) complementary to a common 17-mer. Each of the 8-mers was immobilized as individual dot in thin layer of polyacrylamide gel fixed on a glass plate. The matrix was hybridized with the 32P-labeled 17-mer and three other 17-mers differing from the first one by a single base change. The hybridization enabled us to distinguish perfect duplexes from those containing mismatches in 32 out of 35 cases. These results are discussed with respect to the applicability of the approach for sequencing. It was shown that hybridization of DNA with an immobilized 8-mer in the presence of a labeled 5-mer led to the formation of a stable duplex with the 5-mer only if the 5- and the 8-mers were in continuous stacking making a perfect nicked duplex 13 (5+8) base pairs long. These experiments and computer simulations suggest that continuous stacking hybridization may increase the efficiency of sequencing so that random or natural coding DNA fragments about 1000 bases long could be sequenced in more than 97% of cases. Miniaturized matrices or sequencing chips were designed, where oligonucleotides were immobilized within 100 x 100 micron dots disposed at 100 micron intervals. Hybridization of fluorescently labeled DNA fragments with microchips may simplify sequencing and ensure sensitivity of at least 10 attomoles per dot. The perspectives and limitations of SHOM are discussed.     

The transition between the B and Z conformations of DNA investigated by targeted molecular dynamics simulations with explicit solvation

The transition between the B and Z conformations of double-helical deoxyribonucleic acid (DNA) belongs to the most complex and elusive conformational changes occurring in biomolecules. Since the accidental discovery of the left-handed Z-DNA form in the late 1970s, research on this DNA morphology has been engaged in resolving questions relative to its stability, occurrence, and function in biological processes. While the occurrence of Z-DNA in vivo is now widely recognized and the major factors influencing its thermodynamical stability are largely understood, the intricate conformational changes that take place during the B-to-Z transition are still unknown at the atomic level. In this article, we report simulations of this transition for the 3'-(CGCGCG)-5' hexamer duplex using targeted molecular dynamics with the GROMOS96 force field in explicit water under different ionic-strength conditions. The results suggest that for this oligomer length and sequence, the transition mechanism involves: 1), a stretched intermediate conformation, which provides a simple solution to the important sterical constraints involved in this transition; 2), the transient disruption of Watson-Crick hydrogen-bond pairing, partly compensated energetically by an increase in the number of solute-solvent hydrogen bonds; and 3), an asynchronous flipping of the bases compatible with a zipperlike progression mechanism.     

Fidelity of DNA polymerase epsilon holoenzyme from budding yeast Saccharomyces cerevisiae

DNA polymerases delta and epsilon (pol delta and epsilon) are the major replicative polymerases and possess 3'-5' proofreading exonuclease activities that correct errors arising during DNA replication in the yeast Saccharomyces cerevisiae. This study measures the fidelity of the holoenzyme of wild-type pol epsilon, the 3'-5' exonuclease-deficient pol2-4, a +1 frameshift mutator for homonucleotide runs, pol2C1089Y, and pol2C1089Y pol2-4 enzymes using a synthetic 30-mer primer/100-mer template. The nucleotide substitution rate for wild-type pol epsilon was 0.47 x 10(-5) for G:G mismatches, 0.15 x 10(-5) for T:G mismatches, and less than 0.01 x 10(-5) for A:G mismatches. The accuracy for A opposite G was not altered in the exonuclease-deficient pol2-4 pol epsilon; however, G:G and T:G misincorporation rates increased 40- and 73-fold, respectively. The pol2C1089Y pol epsilon mutant also exhibited increased G:G and T:G misincorporation rates, 22- and 10-fold, respectively, whereas A:G misincorporation did not differ from that of wild type. Since the fidelity of the double mutant pol2-4 pol2C1089Y was not greatly decreased, these results suggest that the proofreading 3'-5' exonuclease activity of pol2C1089Y pol epsilon is impaired even though it retains nuclease activity and the mutation is not in the known exonuclease domain.     

Elsamicin A can convert the Z-form of poly[d(G-C)] and poly[(G-m5C)] back to B-form DNA.

The interaction of poly[(G-C)] and poly[d(G-m5C)] with the antitumor antibiotic elsamicin A, which binds to alternating guanine + cytosine tracts in DNA, has been studied under the B and Z conformations. Both the rate and the extent of the B-to-Z transition are diminished by the antibiotic, as inferred by spectroscopic methods under ionic conditions that otherwise favor the left-handed conformation of the polynucleotides. Moreover, elsamicin converts the Z-form DNA back to the B-form. The circular dichroism data indicate that elsamicin binds to poly[d(G-C)] and poly[d(G-m5C)] to form a right-handed bound elsamicin region(s). The transition can be followed by changes of the molar ellipticity at 250 nm, thus providing a convenient wavelength to monitor the Z-to-B conformational change of the polymers as elsamicin is added. The elsamicin A effect might be explained by a model in which the antibiotic binds preferently to a B-form DNA, playing a role as an allosteric effector on the equilibrium between the B and Z conformations, thus favoring the right-handed one.     

Deuteriation of sugar protons simplify NMR assignments and structure determination of large oligonucleotide by the 1H-NMR window approach.

The concept of the 1H-NMR window has been developed and examined through a comparative study of NOESY spectra of a self-complementary Dickerson's dodecamer (I) [5'd(5C6G7C8G9A10A11T12T13C-14G15C16G)2(3')], a self-complementary 20-mer (II) [(5'd(1C2G3C4G5C6G7C8G9A10A11T12T13C14G15C16G17C18G19C20G)2(3')] in which the core part consists of the same Dickerson's dodecamer sequence with the flanking CGCG residues at both 3' and 5'-ends, and the partly-deuteriated (shown by underlined CGCG residues at both 3' and 5'-ends) analogous duplex (III) [5'd(1C2G3C4G5C6G7C8G9A10A11T12T13C14G15C16G17C18G19C20G)2(3')] in which the core 5C to 16G part (i.e. 1H-NMR window) consists of the natural Dickerson's dodecamer sequence. A comparison of their NOESY spectra clearly demonstrates that the severe overlap of proton resonances in the larger DNA duplex (II) has been successfully reduced in the partly-deuterated duplex (III) as a result of specific incorporations of the sugar-deuteriated nucleotide residues in the latter [stereospecific > 97 atom % 2H enrichment at H2', H2' and H3' sites, approximately 85 atom % 2H enrichment at H4' and approximately 20 atom % 2H enrichment at H1' (see refs. 10 and 11) in the 20-mer duplex (III)]. These simplifications of the resonance overlap by the deuteriation approach have enabled unequivocal chemical shift assignments and extraction of the quantitative NOE data in the 1H-NMR window part of duplex (III). A comparison of the 12-nucleotide long 1H-NMR window in (III) with that of the 12-mer duplex (I) also shows the scope of studying the changes in conformation and dynamics of the core 12-mer region in (III) which result from the increase of molecular weight due to the DNA chain extension. It is noteworthy that such a study is clearly impossible for the natural 20-mer (II) because of the inherent problem of the overlap of resonances.     

Cooperative binding of oligonucleotides to adjacent sites of single-stranded DNA: sequence composition dependence at the junction

The quantitative parameters of cooperative binding of deoxyribooligonucleotides to adjacent sites by double helix formation have been determined as a function of sequence composition at the junction. The base stacks 5'-Py/p-Py-3', 5'-Pu/p-Py-3' and 5'-Pu/p-Pu-3' (p is phosphate group, Py and Pu are pyrimidine and purine nucleoside, respectively) including mismatches on the 3'-side of the junction were studied using complementary addressed modification titration (CAMT) at 25 degrees C and pH 7.5, 0.16 M NaCl, 0.02 M Na2HPO4, 0.1 mM EDTA. The equilibrium binding constants of alkylating derivatives of 8-mer oligonucleotides (reagents) with 22-mer oligonucleotides (targets) were determined using the dependence of the target limit modification extents on the concentrations of the reagents. The parameters of cooperativity were calculated as the ratio of binding constants of reagents in the presence and the absence of a second 8-mer oligonucleotides (effectors) occupying the adjacent site on the 22-mer targets. For the stacks 5'-Py/p-Py-3' the parameters of cooperativity were around unity both for matched and mismatched nucleotides at the junction indicating the absence of cooperativity. The parameters of cooperativity for the stacks 5'-Pu/p-Pu-3' were higher than for the stacks 5'-Pu/p-Py-3' in perfect and non-perfect duplexes. Discrimination of mismatches was higher in nicked than in normal duplexes.     

Solution structure of [d(ATGAGCGAATA)]2. Adjacent G:A mismatches stabilized by cross-strand base-stacking and BII phosphate groups.

The solution structure of a rather unusual B-form duplex [d(ATGAGCGAATA)]2 has been determined using two-dimensional nuclear magnetic resonance (2D-NMR) and distance geometry methods. This sequence forms a stable ten base-pair B-form duplex with 3' overhangs and two pairs of adjacent G:A mismatches paired via a sheared hydrogen-bonding scheme. All non-exchangeable protons, including the stereo-specific H-5'S/H-5'R of the 3G and 7G residues, were assigned by 2D-NMR. The phosphorus spectrum was assigned using heteronuclear correlation with H-3' and H-4' reasonances. The complete assignments reveal several unusual nuclear Overhauser enhancements (NOEs) and unusual chemical shifts for the neighboring G:A mismatch pairs and their adjacent nucleotides. Inter-proton distances were derived from time-dependent NOEs and used to generate initial structures, which were further refined by iterative back-calculation of the two-dimensional nuclear Overhauser enhancement spectra; 22 final structures were calculated from the refined distance bounds. All these final structures exhibit fully wound helical structures with small penalty values against the refined distance bounds and small pair-wise root-mean-square deviation values (typically 0.5 A to 0.9 A). The two helical strands exchange base stacking at both of the two G:A mismatch sites, resulting in base stacking down each side rather than down each strand of the twisted duplex. Very large twist angles (77 degrees) were found at the G:A mismatch steps. All the final structures were found to have BII phosphate conformations at the adjacent G:A mismatch sites, consistent with observed downfield 31P chemical shifts and Monte-Carlo conformational search results. Our results support the hypothesis that 31P chemical shifts are related to backbone torsion angles. These BII phosphate conformations in the adjacent G:A mismatch step suggest that hydrogen bonding of the G:A pair G-NH2 to a nearby phosphate oxygen atom is unlikely. The unusual structure of the duplex may be stabilized by strong interstrand base stacking as well as intrastrand stacking, as indicated by excellent base overlap within the mismatch stacks.     

Conformation, dynamics, and structural transitions of the TATA box region of self-complementary d[(C-G)n-T-A-T-A-(C-G)n] duplexes in solution

Structural and kinetic features of the TATA box located in the center of the alternating self-complementary d(C-G-C-G-T-A-T-A-C-G-C-G) duplex (TATA 12-mer) and d(C-G-C-G-C-G-T-A-T-A-C-G-C-G-C-G) duplex (TATA 16-mer) have been probed by high-resolution proton and phosphorus NMR spectroscopy in aqueous solution. The imino exchangeable Watson-Crick protons and the nonexchangeable base protons in the TATA box of the TATA 12-mer and TATA 16-mer duplexes have been assigned from intra and inter base pair nuclear Overhauser effect (NOE) measurements. Imino proton line-width and hydrogen exchange saturation recovery measurements demonstrate that the dA X dT base pairs in the TATA box located in the center of the TATA 12-mer and TATA 16-mer duplexes are kinetically more labile than flanking dG X dC base pairs. The proton and phosphorus NMR parameters of the TATA 12-mer monitor a cooperative premelting transition in the TATA box prior to the onset of the melting transition to unstacked strands. Phosphorus NMR studies have been unable to detect any indication of a right-handed B DNA to a left-handed Z DNA transition for the TATA 12-mer duplex in saturated NaCl solution. By contrast, we do detect the onset of the B to Z transition for the TATA 16-mer in saturated NaCl solution. Proton and phosphorus NMR studies demonstrate formation of a loop conformation with chain reversal at the TATA segment for the TATA 12-mer and TATA 16-mer duplexes on lowering the DNA and counterion concentration. The imino protons (10-11 ppm) and phosphorus resonances (3.5-4.0 ppm; 4.5-5.0 ppm) of the loop segment fall in spectral windows well resolved from the corresponding markers in fully paired segments so tha it should be possible to identify loops in longer DNA helixes. The equilibrium between the loop and fully paired duplex conformations of the TATA 12-mer and TATA 16-mer is shifted toward the latter on addition of moderate salt.     

Use of EDTA derivatization to characterize interactions between oligodeoxyribonucleoside methylphosphonates and nucleic acids

EDTA-derivatized oligonucleoside methylphosphonates were prepared and used to characterize hybridization between the oligomers and single-stranded DNA or RNA. The melting temperatures of duplexes formed between an oligodeoxyribonucleotide 35-mer and complementary methylphosphonate 12-mers were 4-12 degrees C higher than those of duplexes formed by oligodeoxyribonucleotide 12-mers as determined by spectrophotometric measurements. Derivatization of the methylphosphonate oligomers with EDTA reduced the melting temperature by 5 degrees C. Methylphosphonate oligomer-nucleic acid complexes were stabilized by base stacking interactions between the terminal bases of the two oligomers binding to adjacent binding sites on the target. In the presence of Fe2+ and DTT, the EDTA-derivatized oligomers produce hydroxyl radicals that cause degradation of the sugar-phosphate backbone of both targeted DNA and RNA. Degradation occurs specifically in the region of the oligomer binding site and is approximately 20-fold more efficient for single-stranded DNA than for RNA. In comparison to the presence of one oligomer, the extent of target degradation was increased considerably by additions of two oligomers that bind at adjacent sites on the target. For example, the extent of degradation of a single-stranded DNA 35-mer caused by two contiguously binding oligomers, one of which was derivatized by EDTA, was approximately 2 times greater than that caused by the EDTA-derivatized oligomer alone. Although EDTA-derivatized oligomers are stable for long periods of time in aqueous solution, they undergo rapid autodegradation in the presence of Fe2+ and DTT with half-lives of approximately 30 min. This autodegradation reaction renders the EDTA-derivatized oligomers unable to cause degradation of their complementary target nucleic acids.(ABSTRACT TRUNCATED AT 250 WORDS)     

Thermal stability, structural features, and B-to-Z transition in DNA tetraloop hairpins as determined by optical spectroscopy in d(CG)(3)T(4)(CG)(3) and d(CG)(3)A(4)(CG)(3) oligodeoxynucleotides

NMR and CD data have previously shown the formation of the T(4) tetraloop hairpin in aqueous solutions, as well as the possibility of the B-to-Z transition in its stem in high salt concentration conditions. It has been shown that the stem B-to-Z transition in T(4) hairpins leads to S (south)- to N (north)-type conformational changes in the loop sugars, as well as anti to syn orientations in the loop bases. In this article, we have compared by means of UV absorption, CD, Raman, and Fourier transform infrared (FTIR), the thermodynamic and structural properties of the T(4) and A(4) tetraloop hairpins formed in 5'-d(CGCGCG-TTTT-CGCGCG)-3' and 5'-d(CGCGCG-AAAA-CGCGCG)-3', respectively. In presence of 5M NaClO(4), a complete B-to-Z transition of the stems is first proved by CD spectra. UV melting profiles are consistent with a higher thermal stability of the T(4) hairpin compared to the A(4) hairpin. Order-to-disorder transition of both hairpins has also been analyzed by means of Raman spectra recorded as a function of temperature. A clear Z-to-B transition of the stem has been confirmed in the T(4) hairpin, and not in the A(4) hairpin. With a right-handed stem, Raman and FTIR spectra have confirmed the C2'-endo/anti conformation for all the T(4) loop nucleosides. With a left-handed stem, a part of the T(4) loop sugars adopt a N-type (C3'-endo) conformation, and the C3'-endo/syn conformation seems to be the preferred one for the dA residues involved in the A(4) tetraloop.     

DNA triplex formation of oligonucleotide analogues consisting of linker groups and octamer segments that have opposite sugar-phosphate backbone polarities

The DNA oligomer analogues 3'd(CTTTCTTT)5'-P4-5'd(TTCTTCTT)3' (IV), 5'd-(TTTCTTTC)3'-P2-3'd(CTTTCTTT)5' (V), and 5'd(TTTCTTTC)3'-P2-3'd(CTTTCTTT)5'-P4-5'd-(TTCTTCTT)3' (VI) (P2 = P*P and P4 = P*P*P*P, where P = phosphate and * = 1,3-propanediol) have been synthesized. These oligomers consist of a linker group or groups and homopyrimidine oligonucleotides which have opposite sugar-phosphate backbone polarities. These oligomer analogues are designed to form triplexes with a duplex, 5'd(AAAGAAAGCCCTTTCTTTAAGAAGAA)3'.5'd(TTCTTCTTAAA- GAAAGGGCTTTCTTT)3' (I), which contains small homopurine clusters alternately located in both strands. The length of the linker groups, P2 and P4, was based upon a computer modeling analysis. Triplex formation by the unlinked octamers 5'd(TTCTTCTT)3' (II) and 5'd(TTTCTTTC)3' (III) and the linked oligomer analogues IV-VI with the target duplex was studied by thermal denaturation at pH 5.2. The order of stabilities of triplex formation by these oligomers was I-V much much greater than I-IV greater than I-(II, III). The mixture of I and VI showed two transitions corresponding to the dissociation of the third strand. The higher transition corresponded to the dissociation of 3'-3'-linked octamer segments, and the lower one corresponded to the dissociation of 5'-5'-linked octamer segments. The Tm of the latter transition was higher than that of the I-IV triplex; thus the triplex formed by the 5'-5'-linked octamer segment was stabilized by the triplex formed by the 3'-3'-linked octamer segments in the I-VI triplex. Triplex formation of this system was also studied in the presence of ethidium bromide.(ABSTRACT TRUNCATED AT 250 WORDS)     

CC/GG contacts facilitate the B to A transition of DNA in solution

Self-complementary decadeoxynucleotides, CCGATATCGG, CCAGATCTGG, CCCTGCAGGG, GGGGGCCCCC, were designed and synthesized to estimate the A-philic free energy of CC/GG contacts. First, regions of temperature-stability of the double-stranded conformation were determined for each 10-mer. Then, circular dichroism spectra were recorded for the B-family forms at different temperatures, counter-ion concentrations and trifluoroethanol contents. A cooperative change typical of the B-A transition is observed in the CD spectra at a trifluoroethanol content specific for each duplex. The positions of half-transition points were functions not only of the nucleotide sequence but of the duplex length as well: the B to A transitions were hindered in these 10-mers in comparison with a lengthy DNA. The B-phility value was estimated to be 3 kcal/mol of 10-mer. The B-A transition point was shown to drop with an increase in the number of CC/GG contacts in a duplex. The designed 10-mers made it possible to estimate quantitatively the A-phility of CC/GG contact as compared with an average DNA: (FA-FB)CC = 0.2 Kcal/mol, (FA-FB)DNA = 0.7 Kcal/mol.     

Novel methods for the preparation and characterization of hyaluronan oligosaccharides of defined length.

Hyaluronan is a ubiquitous glycosaminoglycan of high molecular weight that acts as a structural component of extracellular matrices and mediates cell adhesion. There have been numerous recent reports that fragments of hyaluronan have different properties compared to the intact molecule. Though many of these results may be genuine, it is possible that some activities are due to minor components in the preparations used. Therefore, it is important that well-characterized and highly purified oligosaccharides are used in cell biological and structural studies so that erroneous results are avoided. We present methods for the purification of hyaluronan oligomers of defined size using size exclusion and anion-exchange chromatography following digestion of hyaluronan with testicular hyaluronidase. These preparations were characterized by a combination of electrospray ionization mass spectrometry, matrix-assisted laser desorption/ionization mass spectrometry with time-of-flight analysis, and fluorophore-assisted carbohydrate electrophoresis. Hyaluronan oligomers ranging from tetrasaccharides to 34-mers were separated. The 4- to 16-mers were shown to be homogeneous with regard to length but did contain varying amounts of chondroitin sulfate. This contaminant could have been minimized if digestion had been performed with medical-grade hyaluronan rather than the relatively impure starting material used here. The 18- to 34-mer preparations were mixtures of oligosaccharides of different lengths (e.g., the latter contained 87% 34-mer, 10% 32-mer, and 3% 30-mer) but were free of detectable chondroitin sulfate. In addition to oligomers with even numbers of sugar rings, novel 5- and 7-mers with terminal glucuronic acid residues were identified.     

Conformational transitions of synthetic DNA sequences with inserted bases, related to the dodecamer d(CGCGAATTCGCG).

Conformational transitions for a series of imperfect palindromes related to the dodecamer d(CGCGAATTCGCG) have been investigated. These sequences are: two isomeric 13-mers - d(CGCAGAATTCGCG) (13-merI) and d(CGCGAATTACGCG) (13-merII), 17-mer d(CGCGCGAATTACGCGCG) and 15-mer d(CGCGAAATTTACGCG). Insertion of a single adenine nucleotide prevents these sequences from being self-complementary. Analysis of thermodynamic parameters derived from the melting profiles together with other data at higher concentrations (NMR and calorimetry) indicates that the insertion of the additional nucleotide which lacks a complement in the opposite strand does not change the enthalpy of the duplex formation, but does alter the number of stable nucleation configurations. The relative position of the insertion within the self-complementary sequence determines the equilibrium between the duplex form and the single-stranded hairpin loop. C-G segments separated by the insertion from the rest of the molecule can undergo an independent conformational transition at high salt concentration, probably to the Z form.     

Photo-cross-linking of psoralen-derivatized oligonucleoside methylphosphonates to single-stranded DNA.

The preparation of oligodeoxyribonucleoside methylphosphonates derivatized with 3-[(2-aminoethyl)carbamoyl]psoralen [(ae)CP] is described. These derivatized oligomers are capable of cross-linking with single-stranded DNA via formation of a photoadduct between the furan side of the psoralen ring and a thymidine of the target DNA when the oligomer-target duplex is irradiated with 365-nm light. The photoreactions of (ae)CP-derivatized methylphosphonate oligomers with single-stranded DNA targets in which the position of the psoralen-linking site is varied are characterized and compared to results obtained with oligomers derivatized with 4'-[[N-(aminoethyl)amino]methyl]-4,5',8-trimethylpsoralen [(ae)AMT]. It appears that the psoralen ring can stack on the terminal base pair formed between the oligomer and its target DNA or can intercalate between the last two base pairs of the oligomer-target duplex. Oligomers derivatized with (ae)CP cross-link efficiently to a thymidine located in the last base pair (n position) or 3' to the last base pair (n + 1 position) of the target, whereas the (ae)AMT-derivatized oligomers cross-link most efficiently to a thymidine located in the n + 1 position. The results show that both the extent and kinetics of cross-linking are influenced by the location of the psoralen-linking site in the oligomer-target duplex.     

Interaction of psoralen-derivatized oligodeoxyribonucleoside methylphosphonates with single-stranded DNA

Oligodeoxyribonucleoside methylphosphonates derivatized at the 5' end with 4'-(amino-alkyl)-4,5',8-trimethylpsoralen were prepared. The interaction of these psoralen-derivatized methylphosphonate oligomers with synthetic single-stranded DNAs 35 nucleotides in length was studied. Irradiation of a solution containing the 35-mer and its complementary methylphosphonate oligomer at 365 nm gave a cross-linked duplex produced by cycloaddition between the psoralen pyrone ring of the derivatized methylphosphonate oligomer and a thymine base of the DNA. Photoadduct formation could be reversed by irradiation at 254 nm. The rate and extent of cross-linking were dependent upon the length of the aminoalkyl linker between the trimethylpsoralen group and the 5' end of the methylphosphonate oligomer. Methylphosphonate oligomers derivatized with 4'-[[N-(2-aminoethyl)amino]methyl]- 4,5',8-trimethylpsoralen gave between 70% and 85% cross-linked product when irradiated for 20 min at 4 degrees C. Further irradiation did not increase cross-linking, and preirradiation of the psoralen-derivatized methylphosphonate oligomer at 365 nm reduced or prevented cross-linking. These results suggest that the methylphosphonate oligomers undergo both cross-linking and deactivation reactions when irradiated at 365 nm. The extent of cross-linking increased up to 10 microM oligomer concentration and dramatically decreased at temperatures above the estimated Tm of the methylphosphonate oligomer-DNA duplex. The cross-linking reaction was dependent upon the fidelity of base-pairing interactions between the methylphosphonate oligomers and the single-stranded DNA. Noncomplementary oligomers did not cross-link, and the extent of cross-linking of oligomers containing varying numbers of noncomplementary bases was greatly diminished or eliminated.(ABSTRACT TRUNCATED AT 250 WORDS)     

Structural studies of the O6meG.T interaction in the d(C-G-T-G-A-A-T-T-C-O6meG-C-G) duplex

High-resolution proton and phosphorus NMR studies are reported on the self-complementary d(C1-G2-T3-G4-A5-A6-T7-T8-C9-O6meG10-C11-G12) duplex (henceforth called O6meG.T 12-mer), which contains T3.O6meG10 interactions in the interior of the helix. The imino proton of T3 is observed at 9.0 ppm, exhibits a temperature-independent chemical shift in the premelting transition range, and broadens out at the same temperature as the imino proton of the adjacent G2.C11 toward the end of the helix at pH 6.8. We observed inter base pair nuclear Overhauser effects (NOEs) between the base protons at the T3.O6meG10 modification site and the protons of flanking G2.C11 and G4.C9 base pairs, indicative of the stacking of the T3 and O6meG10 bases into the helix. Two-dimensional correlated (COSY) and nuclear Overhauser effect (NOESY) studies have permitted assignment of the base and sugar H1', H2', and H2' nonexchangeable protons in the O6meG.T 12-mer duplex. The observed NOEs demonstrate an anti conformation about all the glycosidic bonds, and their directionality supports formation of a right-handed helix in solution. The observed NOEs between the T3.O6meG10 interaction and the adjacent G2.C11 and G4.C9 base pairs at the modification site exhibit small departures from patterns for a regular helix in the O6.meG.T 12-mer duplex. The phosphorus resonances exhibit a 0.5 ppm spectral dispersion indicative of an unperturbed phosphodiester backbone for the O6meG.T 12-mer duplex. We propose a model for pairing of T3 and O6meG10 at the modification site in the O6meG.T 12-mer duplex.(ABSTRACT TRUNCATED AT 250 WORDS)     

A dumbbell-shaped, double-hairpin structure of DNA: a thermodynamic investigation

We report the first calorimetric and spectroscopic investigation on a member of a new class of nucleic acid secondary structures in which both ends of a duplex core are closed by single-stranded loops. Such structures can be formed intramolecularly from appropriately designed base sequences. We have synthesized the 24-mer sequence shown, and we present calorimetric, spectroscopic, and electrophoretic (formula; see text) evidence that it adopts a dumbbell-shaped, double-hairpin structure. Our data allow us to reach the following conclusions: (1) The phosphodiester gap in the center of the core duplex of the dumbbell does not reduce the transition enthalpy relative to that measured for the corresponding octameric duplex d(GGAATTCC)2. (2) Incorporation of a 5'-phosphate group into the gap decreases the thermal stability of the dumbbell relative to its unphosphorylated sequence. On the basis of the salt dependence of this effect, we propose that the phosphorylation--induced decrease in thermal stability is electrostatic in origin. From the changes in the transition enthalpy and entropy, we suggest that the phosphorylation-induced decrease in thermal stability of the double hairpin arises from electrostatically induced based unstacking at the nick. (3) The thymine residues in the loop behave both electrostatically and enthalpically like denatured single strands. Published nuclear magnetic resonance studies reveal partial stacking of thymine residues in the loops of linear hairpin structures. If this feature persists in the double-hairpin structure, then the spatial overlap of thymine residues in the loops does not necessarily produce a favorable enthalpic contribution. (4) When both ends of the nicked octameric core duplex are constrained by loops of only four thymine residues, the dumbbell structure may adopt conformations in which the 5' and 3' ends at the nick are twisted relative to the helical axis and therefore are not in phase. Such conformations would account for the observed resistance of the double-hairpin structure to ligation, since the 3'OH and 5'P would no longer be collinear.