Presence of 2',5'-linkages in a homopyrimidine DNA oligonucleotide promotes stable triplex formation under physiological conditions

We prepared 15-mer homopyrimidine oligonucleotides containing three or four 2',5'-linked DNA units, and their ability as a triplex-forming oligonucleotide (TFO) was analyzed in detail UV melting experiments showed that replacement of a 3',5'-linkage by a 2',5'-linkage at every third or fourth residue in TFO significantly promoted stable triplex formation under physiological conditions.     

Oligoribonucleotides containing 2',5'-phosphodiester linkages exhibit binding selectivity for 3',5'-RNA over 3',5'-ssDNA.

Oligoribonucleotides containing 2',5'-phosphodiester linkages have been synthesized on a solid support by the 'silyl-phosphoramidite' method. The stability of complexes formed between these oligonucleotides and complementary 3',5'-RNA strands have been studied using oligoadenylates and a variety of oligonucleotides of mixed base sequences including phosphorothioate backbones. In many cases, particularly for 2',5'-linked adenylates, the UV melting profiles are quite sharp and exhibit large hyperchromic changes. Substituting a few 3',5'-linkages with the 2',5'-linkage within an oligomer lowers the Tm of the complex and the degree of destabilization depends on the neighboring residues and neighboring linkages. The 2',5'-linked oligoribonucleotides prepared in this study exhibited remarkable selectivity for complementary single stranded RNA over DNA. For example, in 0.01 M phosphate buffer--0.10 M NaCl (pH 7.0), no association was observed between 2',5'-r(CCC UCU CCC UUC U) and its Watson-Crick DNA complement 3',5'-d(AGAAGGGAGAGGG). However, 2',5'-r(CCC UCU CCC UUC U) with its RNA complement 3',5'-r(AGAAGGGAGAGGG) forms a duplex which melts at 40 degrees C. The decamer 2',5'-r(Ap)9A forms a complex with both poly dT and poly rU but the complex [2',5'-r(Ap)9A]:[poly dT] is unstable (Tm, -1 degree C) and is seen only at high salt concentrations. In view of their unnatural character and remarkable selectivity for single stranded RNA, 2',5'-oligo-RNAs and their derivatives may find use as selective inhibitors of viral mRNA translation, and as affinity ligands for the purification of cellular RNA.     

DNA triplex formation of oligonucleotide analogues consisting of linker groups and octamer segments that have opposite sugar-phosphate backbone polarities

The DNA oligomer analogues 3'd(CTTTCTTT)5'-P4-5'd(TTCTTCTT)3' (IV), 5'd-(TTTCTTTC)3'-P2-3'd(CTTTCTTT)5' (V), and 5'd(TTTCTTTC)3'-P2-3'd(CTTTCTTT)5'-P4-5'd-(TTCTTCTT)3' (VI) (P2 = P*P and P4 = P*P*P*P, where P = phosphate and * = 1,3-propanediol) have been synthesized. These oligomers consist of a linker group or groups and homopyrimidine oligonucleotides which have opposite sugar-phosphate backbone polarities. These oligomer analogues are designed to form triplexes with a duplex, 5'd(AAAGAAAGCCCTTTCTTTAAGAAGAA)3'.5'd(TTCTTCTTAAA- GAAAGGGCTTTCTTT)3' (I), which contains small homopurine clusters alternately located in both strands. The length of the linker groups, P2 and P4, was based upon a computer modeling analysis. Triplex formation by the unlinked octamers 5'd(TTCTTCTT)3' (II) and 5'd(TTTCTTTC)3' (III) and the linked oligomer analogues IV-VI with the target duplex was studied by thermal denaturation at pH 5.2. The order of stabilities of triplex formation by these oligomers was I-V much much greater than I-IV greater than I-(II, III). The mixture of I and VI showed two transitions corresponding to the dissociation of the third strand. The higher transition corresponded to the dissociation of 3'-3'-linked octamer segments, and the lower one corresponded to the dissociation of 5'-5'-linked octamer segments. The Tm of the latter transition was higher than that of the I-IV triplex; thus the triplex formed by the 5'-5'-linked octamer segment was stabilized by the triplex formed by the 3'-3'-linked octamer segments in the I-VI triplex. Triplex formation of this system was also studied in the presence of ethidium bromide.(ABSTRACT TRUNCATED AT 250 WORDS)     

Ribozyme cleavage of a 2,5-phosphodiester linkage: mechanism and a restricted divalent metal-ion requirement.

The natural substrate cleaved by the hepatitis delta virus (HDV) ribozyme contains a 3',5'-phosphodiester linkage at the cleavage site; however, a 2',5'-linked ribose-phosphate backbone can also be cleaved by both trans-acting and self-cleaving forms of the HDV ribozyme. With substrates containing either linkage, the HDV ribozyme generated 2',3'-cyclic phosphate and 5'-hydroxyl groups suggesting that the mechanisms of cleavage in both cases were by a nucleophilic attack on the phosphorus center by the adjacent hydroxyl group. Divalent metal ion was required for cleavage of either linkage. However, although the 3',5'-linkage was cleaved slightly faster in Ca2+ than in Mg2+, the 2',5'-linkage was cleaved in Mg2+ (or Mn2+) but not Ca2+. This dramatic difference in metal-ion specificity is strongly suggestive of a crucial metal-ion interaction at the active site. In contrast to the HDV ribozymes, cleavage at a 2',5'-phosphodiester bond was not efficiently catalyzed by the hammerhead ribozyme. The relaxed linkage specificity of the HDV ribozymes may be due in part to lack of a rigid binding site for sequences 5' to the cleavage site.     

Recognition of nucleic acid double helices by homopyrimidine 2', 5'-linked RNA.

We have studied the effect of a 2',5'-RNA third strand backbone on the stability of triple helices with a 'pyrimidine motif' targeting the polypurine strand of duplex DNA, duplex RNA and DNA/RNA hybrids. Comparative experiments were run in parallel with DNA and the regioisomeric RNA as third strands adopting the experimental design of Roberts and Crothers. The results reveal that 2',5'-RNA is indeed able to recognize double helical DNA (DD) and DNA (purine):RNA (pyrimidine) hybrids (DR). However, when the duplex purine strand is RNA and the duplex pyrimidine strand is DNA or RNA (i.e. RD or RR), triplex formation is not observed. These results exactly parallel what is observed for DNA third strands. Based on T m data, the affinities of 2',5'-RNA and DNA third strands towards DD and DR duplexes were similar. The RNA third strand formed triplexes with all four hairpins, as previously demonstrated. In analogy to the arabinose and 2'-deoxyribose third strands, the possible C2'- endo pucker of 2',5'-linked riboses together with the lack of an alpha-2'-OH group are believed to be responsible for the selective binding of 2',5'-RNA to DD and DR duplexes, over RR and RD duplexes. These studies indicate that the use of other oligonucleotide analogues will prove extremely useful in dissecting the contributions of backbone and/or sugar puckering to the recognition of nucleic acid duplexes.     

Synthesis and hybridization studies of oligonucleotides containing 1-(2-deoxy-2-alpha-C-hydroxymethyl-beta-D-ribofuranosyl)thymine (2'-alpha-hm-dT)

We report the first investigation of oligoribonucleotides containing a few 1-(2-deoxy-2-alpha-C-hydroxymethyl-beta-D-ribofuranosyl)thymine units (or 2'-hm-dT, abbreviated in this work as 'H'). Both the 2'-CH2O-phosphoramidite and 3'-O-phosphoramidite derivatives of H were synthesized and incorporated into both 2',5'-RNA and RNA chains. The hybridization properties of the modified oligonucleotides have been studied via thermal denaturation and circular dichroism studies. While 3',5'-linked H was shown previously to significantly destabilize DNA:RNA hybrids and DNA:DNA duplexes (modification in the DNA strand; DeltaT(m) approximately -3 degrees C/insert), we find that 2',5'-linked H have a smaller effect on 2',5'-RNA:RNA and RNA:RNA duplexes (DeltaT(m) = -0.3 degrees C and -1.2 degrees C, respectively). The incorporation of 3',5'-linked H into 2',5'-RNA:RNA and RNA:RNA duplexes was found to be more destabilizing (-0.7 degrees C and -3.6 degrees C, respectively). Significantly, however, the 2',5'-linked H units confer marked stability to RNA hairpins when they are incorporated into a 2',5'-linked tetraloop structure (DeltaT(m) = +1.5 degrees C/insert). These results are rationalized in terms of the compact and extended conformations of nucleotides.     

RNAi in human cells: basic structural and functional features of small interfering RNA

We investigated the mechanism of RNA interference (RNAi) in human cells. Here we demonstrate that the status of the 5' hydroxyl terminus of the antisense strand of a siRNA determines RNAi activity, while a 3' terminus block is tolerated in vivo. 5' hydroxyl termini of antisense strands isolated from human cells were phosphorylated, and 3' end biotin groups were not efficiently removed. We found no requirement for a perfect A-form helix in siRNA for interference effects, but an A-form structure was required for antisense-target RNA duplexes. Strikingly, crosslinking of the siRNA duplex by psoralen did not completely block RNA interference, indicating that complete unwinding of the siRNA helix is not necessary for RNAi activity in vivo. These results suggest that RNA amplification by RNA-dependent RNA polymerase is not essential for RNAi in human cells.     

Improvements in siRNA properties mediated by 2'-deoxy-2'-fluoro-beta-D-arabinonucleic acid (FANA)

RNA interference (RNAi) has emerged recently as an efficient mechanism for specific gene silencing. Short double-stranded small interfering RNAs (siRNAs) are now widely used for cellular or drug target validation; however, their use for silencing clinically relevant genes in a therapeutic setting remains problematic because of their unfavourable metabolic stability and pharmacokinetic properties. To address some of these concerns, we have investigated the properties of siRNA modified with 2'-deoxy-2'-fluoro-beta-d-arabinonucleotide units (araF-N or FANA units). Here we provide evidence that these modified siRNAs are compatible with the intracellular RNAi machinery and can mediate specific degradation of target mRNA. We also show that the incorporation of FANA units into siRNA duplexes increases activity and substantially enhances serum stability of the siRNA. A fully modified sense 2'-deoxy-2'-fluoro-beta-D-arabinonucleic acid (FANA) strand when hybridized to an antisense RNA (i.e. FANA/RNA hybrid) was shown to be 4-fold more potent and had longer half-life in serum (approximately 6 h) compared with an unmodified siRNA (<15 min). While incorporation of FANA units is well tolerated throughout the sense strand of the duplex, modifications can also be included at the 5' or 3' ends of the antisense strand, in striking contrast to other commonly used chemical modifications. Taken together, these results offer preliminary evidence of the therapeutic potential of FANA modified siRNAs.     

Kinetic scheme for intermolecular RNA cleavage by a ribozyme derived from hepatitis delta virus RNA

A minimal kinetic mechanism for a trans-acting ribozyme derived from the HDV antigenomic RNA self-cleaving element was established from steady-state, pre-steady-state, single-turnover, and binding kinetics. Rate constants for individual steps, including substrate binding and dissociation, cleavage, and product release and binding, were measured at 37 degrees C at pH 8.0 in 10 mM Mg(2+) using oligonucleotides as either substrates, noncleavable analogues or 3' product mimics. A substrate containing a normal 3',5'-linkage was cleaved with a first-order rate constant (k(2)) of 0.91 min(-)(1). The association rate constant for the substrate to the ribozyme (2.1 x 10(7) M(-)(1) min(-)(1)) was at the lower range of the expected value for RNA duplex formation, and the substrate dissociated with a rate constant (1.4 min(-)(1)) slightly faster than that for cleavage. Thus the binary complex was not at equilibrium with free enzyme and substrate prior to the cleavage step. Following cleavage, product release was kinetically ordered in that the 5' product was released rapidly (>12 min(-)(1)) relative to the 3' product (6.0 x 10(-)(3) min(-)(1)). Rapid 5' product release and lack of a demonstrable binding site for the 5' product could contribute to the difficulty in establishing the ribozyme-catalyzed reverse reaction (ligation). Slow release of the 3' product was consistent with the extremely low turnover under steady-state conditions as 3' product dissociation was rate-limiting. The equilibrium dissociation constant for the substrate was 24-fold higher than that of the 3' cleavage product. A substrate with a 2',5'-linkage at the cleavage site was cleaved with a rate constant (k(2)) of 1.1 x 10(-)(2) min(-)(1). Thus, whereas cleavage of a 3',5'-linkage followed a Briggs-Haldane mechanism, 2', 5' cleavage followed a Michaelis-Menten mechanism.     

Studies on aminoisonucleoside modified siRNAs: stability and silencing activity

A novel class of aminoisonucleoside was synthesized and incorporated into a luciferase gene-targeting siRNA. Structural and functional analyses of such a kind of siRNAs indicated that sense strand modifications with aminoisonucleoside at the 3' or 5' terminal, such as ssIso-1 and ssIso-2, have less effect on RNA duplex thermal and serum stabilities, and their functional activities are also comparable to their native siRNAs. In contrast, antisense strand modifications with aminoisonucleoside at the corresponding positions, such as asIso-2 or asIso-1, bring a striking negative effect on RNA duplex stability but still maintain around 40-50% of gene knockdown.     

Strand-specific 5'-O-methylation of siRNA duplexes controls guide strand selection and targeting specificity

Small interfering RNAs (siRNAs) and microRNAs (miRNAs) guide catalytic sequence-specific cleavage of fully or nearly fully complementary target mRNAs or control translation and/or stability of many mRNAs that share 6-8 nucleotides (nt) of complementarity to the siRNA and miRNA 5' end. siRNA- and miRNA-containing ribonucleoprotein silencing complexes are assembled from double-stranded 21- to 23-nt RNase III processing intermediates that carry 5' phosphates and 2-nt overhangs with free 3' hydroxyl groups. Despite the structural symmetry of a duplex siRNA, the nucleotide sequence asymmetry can generate a bias for preferred loading of one of the two duplex-forming strands into the RNA-induced silencing complex (RISC). Here we show that the 5'-phosphorylation status of the siRNA strands also acts as an important determinant for strand selection. 5'-O-methylated siRNA duplexes refractory to 5' phosphorylation were examined for their biases in siRNA strand selection. Asymmetric, single methylation of siRNA duplexes reduced the occupancy of the silencing complex by the methylated strand with concomitant elimination of its off-targeting signature and enhanced off-targeting signature of the phosphorylated strand. Methylation of both siRNA strands reduced but did not completely abolish RNA silencing, without affecting strand selection relative to that of the unmodified siRNA. We conclude that asymmetric 5' modification of siRNA duplexes can be useful for controlling targeting specificity.     

2',5'-linked oligo-3'-deoxyribonucleoside phosphorothioate chimeras: thermal stability and antisense inhibition of gene expression.

2',5'-Linked oligo-3'-deoxyribonucleotides bind selectively to complementary RNA but not to DNA. These oligonucleotides (ODNs) do not recognize double-stranded DNA by Hoogsteen triplex formation and the complexes formed by these ODNs with RNA are not substrates for Escherichia coli RNase H. Substitution of the 2',5'-phosphodiester backbone by phosphorothioate linkages gives 2',5'-linked oligo-3'-deoxynucleoside phosphorothioate ODNs that exhibit significantly less non-specific binding to cellular proteins or thrombin. Incorporation of a stretch of seven contiguous 3',5'-linked oligo-2'-deoxynucleoside phosphorothioate linkages in the center of 2',5'-linked ODNs (as a putative RNase H recognition site) afford chimeric antisense ODNs that retain the ability to inhibit steroid 5alpha-reductase (5alphaR) expression in cell culture.     

Helix-destabilizing properties of the adenovirus DNA-binding protein.

The adenovirus DNA-binding protein (DBP) is a multifunctional protein that is essential for viral DNA replication. DBP binds both single-stranded and double-stranded DNA as well as RNA in a sequence-independent manner. Previous studies showed that DBP does not promote melting of duplex poly(dA-dT) in contrast to prokaryotic single-strand-binding proteins. However, here we show that DBP can displace oligonucleotides annealed to single-stranded M13 DNA. Depending upon the DBP concentration, strands of at least 200 nucleotides can be unwound. Although unwinding of short (17-bp), fully duplex DNA is facilitated by DBP, unwinding of larger (28-bp) duplexes is only possible if single-stranded protruding ends are present. These protruding ends must be at least 4 nucleotides long for optimal unwinding, and both 5' and 3' single-stranded overhangs suffice. DBP-promoted strand displacement is sensitive to MgCl2 and NaCl and not dependent upon ATP. Our results suggest that DBP, through formation of a protein chain on the displaced strand, may destabilize duplex DNA ahead of the replication fork, thereby assisting in strand displacement during replication.     

Short interfering RNA strand selection is independent of dsRNA processing polarity during RNAi in Drosophila

Short interfering RNAs (siRNAs) guide mRNA cleavage during RNA interference (RNAi). Only one siRNA strand assembles into the RNA-induced silencing complex (RISC), with preference given to the strand whose 5' terminus has lower base-pairing stability. In Drosophila, Dcr-2/R2D2 processes siRNAs from longer double-stranded RNAs (dsRNAs) and also nucleates RISC assembly, suggesting that nascent siRNAs could remain bound to Dcr-2/R2D2. In vitro, Dcr-2/R2D2 senses base-pairing asymmetry of synthetic siRNAs and dictates strand selection by asymmetric binding to the duplex ends. During dsRNA processing, Dicer (Dcr) liberates siRNAs from dsRNA ends in a manner dictated by asymmetric enzyme-substrate interactions. Because Dcr-2/R2D2 is unlikely to sense base-pairing asymmetry of an siRNA that is embedded within a precursor, it is not clear whether processed siRNAs strictly follow the thermodynamic asymmetry rules or whether processing polarity can affect strand selection. We use a Drosophila in vitro system in which defined siRNAs with known asymmetry can be generated from longer dsRNA precursors. These dsRNAs permit processing specifically from either the 5' or the 3' end of the thermodynamically favored strand of the incipient siRNA. Combined dsRNA-processing/mRNA-cleavage assays indicate that siRNA strand selection is independent of dsRNA processing polarity during Drosophila RISC assembly in vitro.     

Pestivirus NS3 (p80) protein possesses RNA helicase activity.

The pestivirus bovine viral diarrhea virus (BVDV) p80 protein (referred to here as the NS3 protein) contains amino acid sequence motifs predictive of three enzymatic activities: serine proteinase, nucleoside triphosphatase, and RNA helicase. We have previously demonstrated that the former two enzymatic activities are associated with this protein. Here, we show that a purified recombinant BVDV NS3 protein derived from baculovirus-infected insect cells possesses RNA helicase activity. BVDV NS3 RNA helicase activity was specifically inhibited by monoclonal antibodies to the p80 protein. The activity was dependent on the presence of nucleoside triphosphate and divalent cation, with a preference for ATP and Mn2+. Hydrolysis of the nucleoside triphosphate was necessary for strand displacement. The helicase activity required substrates with an un-base-paired region on the template strand 3' of the duplex region. As few as three un-base-paired nucleotides were sufficient for efficient oligonucleotide displacement. However, the enzyme did not act on substrates having a single-stranded region only to the 5' end of the duplex or on substrates lacking single-stranded regions altogether (blunt-ended duplex substrates), suggesting that the directionality of the BVDV RNA helicase was 3' to 5' with respect to the template strand. The BVDV helicase activity was able to displace both RNA and DNA oligonucleotides from RNA template strands but was unable to release oligonucleotides from DNA templates. The possible role of this activity in pestivirus replication is discussed.     

Enhanced bleomycin-mediated damage of DNA opposite charged nicks. A model for bleomycin-directed double strand scission of DNA

The anticancer drug, bleomycin, causes both single and double strand scission of duplex DNA in vitro, with double strand scission occurring in excess of that expected from the random accumulation of single strand nicks. The mechanism of the preferential double strand scission of DNA by bleomycin has been investigated through the synthesis of a series of double hairpin and linear oligonucleotides designed to contain a single nick-like structure at a defined site to serve as models of bleomycin-damaged duplex DNA. The 3' and/or 5' hydroxyls flanking the nick have been phosphorylated to model the increased negative charge at a bleomycin-generated nick. The ability of bleomycin to cleave the intact strand opposite the nick was then determined by autoradiography. The results demonstrate that phosphorylation at either the 3' or 5' hydroxyl, and especially when both sites are phosphorylated, strongly enhances selective cleavage by bleomycin of the opposite strand. These experiments indicate that bleomycin-mediated double strand scission is a form of self-potentiation in which the high affinity of bleomycin for the initially generated nicked sites leads to a greatly enhanced probability of scission of the strand opposite those sites.     

Hybrid characteristics of oligonucleotides consisting of isonucleoside 2',5'-anhydro-3'-deoxy-3'-(thymin-1-yl)-D-mannitol with different linkage modes

Oligonucleotides consisting of the isonucleoside repeating unit 2',5'-anhydro-3'-deoxy-3'-(thymin-1-yl)-D-mannitol (4) were synthesized with the monomeric unit 4 incorporated into oligonucleotides as 1'-->4' linkage 4a (oligomer I) or 6'-->4' linkage 4b (oligomer II). The hybrid properties of the two oligonucleotides I and II with their complementary strands were investigated by thermal denaturation and CD spectra. Oligonucleotide I (4a) formed a stable duplex with d(A)(14) with a slightly reduced T(m) value of 36.6 degrees C, relative to 38.2 degrees C for the control duplex d(T)(14)/d(A)(14), but oligomer II (4b) failed to hybridize with a DNA complementary single strand. The spectrum of the duplex oligomer I/d(A)(14) showed a positive CD band at 217 nm and a negative CD band at 248 nm attributable to a B-like conformation. Molecular modeling showed that in the case of oligomer I: the C6' hydroxy group of each unit could be located in the groove area when hybridized to the DNA single strand, which might contribute additional hydrogen bonding to the stability of duplex formation.