Phylogeny of the 5S ribosomal RNA fromSynechococcus lividus II: The cyanobacterial/chloroplast 5S RNAs form a common structural class

Summary The complete nucleotide sequence of the 5S ribosomal RNA from the cyanobacteriumSynechococcus lividus II has been determined. The sequence is 5-UGCCUAGUGUUUAUGGCGCG-GUGGAACCACGCUGAUCCAUCCCGAACUC-AGAGGUGAAACAUCGCAGCGGUGAAGAU-AGUUGGAGGGUAGCCUCCUGCAAAAAUA-GCUCAAUGCUAGGCA_OH-3. This 5S RNA has the cyanobacterial- and chloroplast-specific nucleotide insertion between positions 30 and 31 (using the numbering system of the generalized eubacterial 5S RNA) and the chloroplast-specific nucleotide-deletion signature between positions 34 and 39. The 5S RNA ofS. lividus II has 27 base differences compared with the 5S RNA of the related strainS. lividus III. This large difference may reflect an ancient divergence between these two organisms. The electrophoretic mobilities on nondenaturing polyacrylamide gels of renatured 5S RNAs fromS. lividus II,S. lividus III, and spinach chloroplasts are identical, but differ considerably from that ofEscherichia coli 5S RNA. This most likely reflects differences in higher-order structure between the 5S RNA ofE. coli and these cyanobacterial and chloroplast 5S RNAs.     

Generalized structures of the 5S ribosomal RNAs.

The sequences of 5S ribosomal RNAs from a wide-range of organisms have been compared. All sequences fit a generalized 5S RNA secondary structural model. Twenty-three nucleotide positions are found universally, i.e., in 5S RNAs of eukaryotes, prokaryotes, archaebacteria, chloroplasts and mitochondria. One major distinguishing feature between the prokaryotic and eukaryotic 5S RNAs is the number of nucleotide positions between certain universal positions, e.g., prokaryotic 5S RNAs have three positions between the universal positions PuU40 and G44 (using the E. coli numbering system) and eukaryotic 5S RNAs have two. The archaebacterial 5S RNAs appear to resemble the eukaryotic 5S RNAs to varying degrees depending on the species of archaebacteria although all the RNAs conform with the prokaryotic "rule" of chain length between PuU40 and G44. The green plant chloroplast and wheat mitochondrial 5S RNAs appear prokaryotic-like when comparing the number of positions between universal nucleotides. Nucleotide positions common to eukaryotic 5S RNAs have been mapped; in addition, nucleotide sequences, helix lengths and looped-out residues specific to phyla are proposed. Several of the common nucleotides found in the 5S RNAs of metazoan somatic tissue differ in the 5S RNAs of oocytes. These changes may indicate an important functional role of the 5S RNA during oocyte maturation.     

The nucleotide sequence of phenylalanine tRNA and 5S RNA from Rhodospirillum rubrum

The complete nucleotide sequence of tRNAPhe and 5S RNA from the photosynthetic bacterium Rhodospirillum rubrum has been elucidated. A combination of in vitro and in vivo labelling techniques was used. The tRNAPhe sequence is 76 nucleotides long, 7 of which are modified. The primary structure is typically prokaryotic and is most similar to the tRNAPhe of Escherichia coli and Anacystis nidulans (14 differences of 76 positions). The 5S ribosomal RNA sequence is 120 nucleotides long and again typical of other prokaryotic 5S RNAs. The invariable GAAC sequence is found starting at position 45. When aligned with other prokaryotic 5S RNA sequences, a surprising amount of nucleotide substitution is noted in the prokaryotic loop region of the R. rubrum 5S RNA. However, nucleotide complementarity is maintained reinforcing the hypothesis that this loop is an important aspect of prokaryotic 5S RNA secondary structure. The 5S and tRNAPhe are the first complete RNA sequences available from the photosynthetic bacteria.     

The 5S ribosomal RNA of Euglena gracilis cytoplasmic ribosomes is closely homologous to the 5S RNA of the trypanosomatid protozoa.

The complete nucleotide sequence of the major species of cytoplasmic 5S ribosomal RNA of Euglena gracilis has been determined. The sequence is: 5' GGCGUACGGCCAUACUACCGGGAAUACACCUGAACCCGUUCGAUUUCAGAAGUUAAGCCUGGUCAGGCCCAGUUAGUAC UGAGGUGGGCGACCACUUGGGAACACUGGGUGCUGUACGCUUOH3'. This sequence can be fitted to the secondary structural models recently proposed for eukaryotic 5S ribosomal RNAs (1,2). Several properties of the Euglena 5S RNA reveal a close phylogenetic relationship between this organism and the protozoa. Large stretches of nucleotide sequences in predominantly single-stranded regions of the RNA are homologous to that of the trypanosomatid protozoan Crithidia fasticulata. There is less homology when compared to the RNAs of the green alga Chlorella or to the RNAs of the higher plants. The sequence AGAAC near position 40 that is common to plant 5S RNAs is CGAUU in both Euglena and Crithidia. The Euglena 5S RNA has secondary structural features at positions 79-99 similar to that of the protozoa and different from that of the plants. The conclusions drawn from comparative studies of cytochrome c structures which indicate a close phylogenetic relatedness between Euglena and the trypanosomatid protozoa are supported by the comparative data with 5S ribosomal RNAs.     

Unusual structural features of the 5S ribosomal RNA from Streptococcus cremoris

The nucleotide sequence of the 5S ribosomal RNA of Streptococcus cremoris has been determined. The sequence is 5' (sequence in text) 3'. Comparison of the S. cremoris 5S RNA sequence to an updated prokaryotic generalized 5S RNA structural model shows that this 5S RNA contains some unusual structural features. These features result largely from uncommon base substitutions in helices I, II and IV. Some of these unusual structural features are shared by several of the known 5S RNA sequences from mycoplasmas. However, the characteristic bloc of deletions found in helix V of these mycoplasma 5S RNAs is not present in the 5S RNA of S. cremoris.     

Structural features unique to the 5 S ribosomal RNAs of the thermophilic cyanobacterium Synechococcus lividus III and the green plant chloroplasts

The complete nucleotide sequence of the 5 S ribosomal RNA from the thermophilic cyanobacterium Synechococcus lividus III was determined. The sequence is: ^5′U-C- C-U-G-G-U-G-G-U-G-A-U-G-G-C-G-A-U-G-U-G-G-A-C-C-C-A-C-A-C-U-C-A-U-C- C-A-U-C-C-C-G-A-A-C-U-G-A-G-U-G-G-U-G-A-A-A-C-G-C-A-U-U-U-G-C-G-G-C- G-A-C-G-A-U-A-G-U-U-G-G-A-G-G-G-U-A-G-C-C-U-C-C-U-G-U-C-A-A-A-A-U-A- G-C-U-A-A-C-C-G-C-C-A-G-G-G-U_OH^3′This 5 S RNA has regional structural characteristics that are found in the green plant chloroplast 5 S RNAs and not in other known sequences of 5 S ribosomal RNAs. These homologies suggest a close phylogenetic relationship between S. lividus and the green plant chloroplasts.     

The nucleotide sequence of the chloroplast 5S ribosomal RNA from spinach.

Spinacia oleracia cholorplast 5S ribosomal RNA was end-labeled with [32P] and the complete nucleotide sequence was determined. The sequence is: pUAUUCUGGUGUCCUAGGCGUAGAGGAACCACACCAAUCCAUCCCGAACUUGGUGGUUAAACUCUACUGCGGUGACGAU ACUGUAGGGGAGGUCCUGCGGAAAAAUAGCUCGACGCCAGGAUGOH. This sequence can be fitted to the secondary structural model proposed for prokaryotic 5S ribosomal RNAs by Fox and Woese (1). However, the lengths of several single- and double-stranded regions differ from those common to prokaryotes. The spinach chloroplast 5S ribosomal RNA is homologous to the 5S ribosomal RNA of Lemna chloroplasts with the exception that the spinach RNA is longer by one nucleotide at the 3' end and has a purine base substitution at position 119. The sequence of spinach chloroplast 5S RNA is identical to the chloroplast 5S ribosomal RNA gene of tobacco. Thus the structures of the chloroplast 5S ribosomal RNAs from some of the higher plants appear to be almost totally conserved. This does not appear to be the case for the higher plant cytoplasmic 5S ribosomal RNAs.     

Secondary structure of prokaryotic 5S ribosomal ribonucleic acids: a study with ribonucleases

The structures of 5S ribosomal RNAs from Escherichia coli and Bacillus stearothermophilus were examined by using ribonucleases A, T1, and T2 and a double helix specific cobra venom ribonuclease. By using both 5' and 3'-32P-end labeling methods and selecting for digested but intact 5S RNA molecules, we were able to distinguish between primary and secondary cutting positions and also to establish the relative degree of cutting. The data reveal the predicted similarities of the higher order structure in the two RNAs but also demonstrate a few significant differences. The data also provide direct evidence for three of the helical regions of the Fox and Woese model of 5S RNA [Fox, G. E., & Woese, C. (1975) Nature (London) 256, 505] and support other important structural features which include a nucleotide looped out from a helical region which has been proposed as a recognition site for protein L18.     

Heterogeneity of the genes coding for 5 S RNA in three related strains of the genus Bacillus.

Summary Three related strains of the genus Bacillus, viz. B. licheniformis, B. subtilis and Bacillus Q were all found to contain a minor species of 5 S RNA in an amount indicating that it is transcribed from only one of the multiple 5 S RNA cistrons known to be present in these strains. The major and minor types of 5 S RNA from each of the three strains could be separated from each other by polyacrylamide gel electrophoresis in the presence of urea. The complete nucleotide sequences of the minor B. subtilis and Bacillus Q 5 S RNAs have been determined. Comparison of these sequences to the previously determined sequence of the minor 5 S RNA from B. licheniformis (Raué et al., 1976) showed the three minor types of 5 S RNA to be identical except for the residues at positions 79, 85 and 95. Moreover, seven out of the eight sequence differences between the major and the minor 5 S RNA are the same in all three strains. Thus, the single cistron coding for minor 5 S RNA has been strongly conserved in all three strains, which may indicate a biological significance for the minor 5 S RNA species.     

Three helical domains form a protein binding site in the 5S RNA-protein complex from eukaryotic ribosomes.

A ribosomal protein binding site in the eukaryotic 5S rRNA has been delineated by examining the effect of sequence variation and nucleotide modification on the RNA's ability to exchange into the EDTA-released, yeast ribosomal 5S RNA-protein complex. 5S RNAs of divergent sequence from a variety of eukaryotic origins could be readily exchanged into the yeast complex but RNA from bacterial origins was rejected. Nucleotide modifications in any of three analogous helical regions in eukaryotic 5S RNAs of differing origin reduced the ability of this RNA molecule to form homologous or heterologous RNA-protein complexes. Because sequence comparisons did not indicate common nucleotide sequences in the interacting helical regions, a model is suggested in which the eukaryotic 5S RNA binding protein does not simply recognize specific nucleotide sequences but interacts with three strategically oriented helical domains or functional groups within these domains. Two of the domains bear a limited sequence homology with each other and contain an unpaired nucleotide or "bulge" similar to that recently reported for one of the 5S RNA binding proteins in Escherichia coli (Peattie, D.A., Douthwaite, S., Garrett, R.A. and Noller, H.F. (1981) Proc. Natl. Acad. Sci. 78, 7331-7335). The results further indicate that the single ribosomal protein of eukaryotic 5S RNA-protein complexes interacts with the same region of the 5S rRNA molecule as do the multiple protein components in complexes of prokaryotic origin.     

The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria.     

Binding oligonucleotides to Escherichia coli and Bacillus stearothermophilus 5 S RNA.

Binding complementary tri- and tetranucleotides to Escherichia coli A19 and Bacillus stearothermophilus 799 5 S RNAs permitted identification of single-stranded regions in these RNAs. Sequences around positions 10, 30, 60, 70, 85 and 95 are in a single-stranded conformation in both 5 S RNAs. It is concluded that the overall structure of bacterial 5 S RNA has been conserved during evolution. Two types of structural conservation have been observed at specific sites of the 5 S RNA: firstly, nucleotide sequence and single strandedness and secondly, single strandedness only. The oligonucleotide binding data for E. coli 5 S RNA are in general agreement with a previous study (Lewis and Doty, 1970) and do not support fully any proposed structural model.     

Two 5S genes are expressed in chicken somatic cells.

Two 5S RNA species were detected in chicken cells. 5S I RNA has the nucleotide sequence of chicken 5S RNA previously published by Brownlee et al. (1) and 5S II RNA differs from it by 10 mutations. The secondary structure of both species is compatible with that proposed for other eukaryotic 5S RNAs. 5S II RNA represents 50-60% of 5S I RNA. Both species were found in total chicken liver and brain and were present in polysomes in the same relative proportions. Only one 5S RNA species could be detected in rat liver and HeLa cells. Chicken is the first vertebrate described so far in which two 5S RNA genes are expressed in somatic cells.     

5S RNA sequence from the Philosamia silkworm: evidence for variable evolutionary rates in insect 5S RNA.

The primary structure of 5S RNA isolated from the posterior silkgland of Philosamia cynthia ricini was determined using three in vitro labelling techniques. The derived sequence consists of 119 nucleotides and can be folded into the secondary structure model proposed for eukaryotic 5S RNAs. This 5S RNA differs from the Bombyx mori molecule in 9 positions and from the Drosophila melanogaster sequence in 14 positions. The comparison of evolutionary rates in insect 5S RNA with inferred rates in other eukaryotic phyla leads to the conclusion that 5S RNA evolution is not constant in different eukaryotic branches, a condition which must be taken into account in phylogenetic tree constructions.     

The topography of the 5' end of 16-S RNA in the presence and absence of ribosomal proteins S4 and S20

A ribonucleoprotein prepared by strong ribonuclease digestion of a complex of 16-S ribosomal RNA and proteins S4 and S20 from Escherichia coli has been characterized; its nucleotide sequence, the positions of enzyme cuts and the sequence excisions have been placed in the completed sequence of 16-S RNA. The positions and yields of enzyme cuts, and excisions of sequence, are compared with those of various ribonucleoproteins prepared with S4 or S20 alone, and with the ribonuclease-resistant S4 RNA prepared from renatured 16-s RNA in the absence of ribosomal protein. These data yield important information on the topography and organisation of the 5' third of the 16-s RNA which is selectively maintained in its native conformation by the bound proteins; they also provide criteria for testing secondary structural models of this region of 16-S RNA.     

The nucleotide sequence of ribosomal 5S RNA from Rhizobium meliloti: comparison with 5S rRNA of Agrobacterium

The complete nucleotide sequence of R. meliloti 5S ribosomal RNA has been determined and compared with the already known sequence of A. tumefaciens 5S rRNA (Vandenberghe et al., 1985, Eur. J. Biochem., 149, 537-542) and of other 5S rRNAs from Rodobacteria Alpha-2 (Wolters et al., 1988, Nucleic Acids Res., 16, rl-r70). The differences found at eight positions (23, 73, 83, 72 in helical fragments; 16, 40, 88 in loops; 54 in bulge), which might affect secondary structures of 5S rRNA, are small. Moreover, the sequence analysis specifies both variable and common positions in 5S rRNA secondary structure of Rodobacteria Alpha-2.     

Sequence analysis and in vitro maturation of five precursor 5S RNAs from Bacillus Q.

Bacillus Q, which is closely related to B. subtilis, contains at least six different precursors of 5S rRNA. The complete nucleotide sequences of four of these precursors, as well as the major part of the sequence of a fifth one, have been determined. They all contain the same 5'-terminal non-conserved segment which is to a large degree homologous with the corresponding segment of the B. subtilis p5S RNAs (Sogin, M.L., Pace, N.R., Rosenberg, M., Weissman, S.M. (1976) J. Biol. Chem. 251, 3480-3488). On the other hand the 3'-terminal non-conserved sequences of the various Bacillus Q precursors show considerable differences both in length and in nucleotide sequence, while there is also little or no homology with the 3'-terminal non-conserved sequence of the B. subtilis precursors. Bacillus Q p5S RNAs do not possess tetranucleotide repeats around the sites which are cleaved during maturation, as does B. subtilis p5S RNA. Like in B. subtilis, however, the cleavage sites are contained within a double-helical region of the precursor molecules. Crude RNAse M5 isolated from various Bacillus strains can maturate the Bacillus Q p5S RNAs with high efficiency. Despite considerable differences in primary structure between the precursors from the various strains, each RNAs M5 preparation can maturate all these precursors with about the same efficiency.     

The sequence of the ribosomal 16S RNA from Proteus vulgaris. Sequence comparison with E. coli 16S RNA and its use in secondary model building.

The complete nucleotide sequence of the 16S RNA from Proteus vulgaris has been determined. The molecule (1544 nucleotides) shows 93% homology with the sequence of E. coli 16S RNA. Six methylated nucleotides have been localized in positions homologous to those observed in the E. coli RNA molecule. Both E. coli and P. vulgaris 16S RNA chains can be folded up into a common secondary structure scheme. Comparative sequence analysis of the two molecules has provided a valuable contribution to 16S RNA secondary structure model building.     

Insect small nuclear RNA gene promoters evolve rapidly yet retain conserved features involved in determining promoter activity and RNA polymerase specificity

In animals, most small nuclear RNAs (snRNAs) are synthesized by RNA polymerase II (Pol II), but U6 snRNA is synthesized by RNA polymerase III (Pol III). In Drosophila melanogaster, the promoters for the Pol II-transcribed snRNA genes consist of approximately 21 bp PSEA and approximately 8 bp PSEB. U6 genes utilize a PSEA but have a TATA box instead of the PSEB. The PSEAs of the two classes of genes bind the same protein complex, DmSNAPc. However, the PSEAs that recruit Pol II and Pol III differ in sequence at a few nucleotide positions that play an important role in determining RNA polymerase specificity. We have now performed a bioinformatic analysis to examine the conservation and divergence of the snRNA gene promoter elements in other species of insects. The 5' half of the PSEA is well-conserved, but the 3' half is divergent. Moreover, within each species positions exist where the PSEAs of the Pol III-transcribed genes differ from those of the Pol II-transcribed genes. Interestingly, the specific positions vary among species. Nevertheless, we speculate that these nucleotide differences within the 3' half of the PSEA act similarly to induce conformational alterations in DNA-bound SNAPc that result in RNA polymerase specificity.     

The CafA protein required for the 5'-maturation of 16 S rRNA is a 5'-end-dependent ribonuclease that has context-dependent broad sequence specificity

The CafA protein, which was initially described as having a role in either Escherichia coli cell division or chromosomal segregation, has recently been shown to be required for the maturation of the 5'-end of 16 S rRNA. The sequence of CafA is similar to that of the N-terminal ribonucleolytic half of RNase E, an essential E. coli enzyme that has a central role in the processing of rRNA and the decay of mRNA and RNAI, the antisense regulator of ColE1-type plasmids. We show here that a highly purified preparation of CafA is sufficient in vitro for RNA cutting. We detected CafA cleavage of RNAI and a structured region from the 5'-untranslated region of ompA mRNA within segments cleavable by RNaseE, but not CafA cleavage of 9 S RNA at its "a" RNase E site. The latter is consistent with the finding that the generation of 5 S rRNA from its 9 S precursor can be blocked by inactivation of RNase E in cells that are wild type for CafA. Interestingly, however, a decanucleotide corresponding in sequence to the a site of 9 S RNA was cut efficiently indicating that cleavage by CafA is regulated by the context of sites within structured RNAs. Consistent with this notion is our finding that although 23 S rRNA is stable in vivo, a segment from this RNA is cut efficient by CafA at multiple sites in vitro. We also show that, like RNase E cleavage, the efficiency of cleavage by CafA is dependent on the presence of a monophosphate group on the 5'-end of the RNA. This finding raises the possibility that the context dependence of cleavage by CafA may be due at least in part to the separation of a cleavable sequence from the 5'-end of an RNA. Comparison of the sites surrounding points of CafA cleavage suggests that this enzyme has broad sequence specificity. Together with the knowledge that CafA can cut RNAI and ompA mRNA in vitro within segments whose cleavage in vivo initiates the decay of these RNAs, this finding suggests that CafA may contribute at some point during the decay of many RNAs in E. coli.