Identification of an Epstein-Barr virus nuclear antigen by fluoroimmunoelectrophoresis and radioimmunoelectrophoresis.

A 65,000-dalton (65K) antigen found in Raji cells by fluoroimmunoelectrophoresis and radioimmunoelectrophoresis has been identified as an Epstein-Barr virus nuclear antigen (EBNA). This identification is based on the following evidence. The 65K antigen is detected in Raji cells but not in three Epstein-Barr virus (-) human B cell lines. It is not detected with EBNA (-) sera. The 65K antigen is found predominantly in the nucleus and co-elutes with EBNA during partial purification by DNA-Sepharose and Blue Dextran-Sepharose chromatography. Finally, the partially purified 65K antigen is an effective absorbant of EBNA antibody as measured in an anticomplement immunofluorescence assay. Antigens with molecular weights of 72, 70, and 73K have been detected in B95-8, P3HR-1, and Namalwa cells, respectively. These antigens are the likely homologues of the 65K Raji EBNA. In addition, an Epstein-Barr virus-associated, 81K DNA-binding antigen has been detected in both B95-8 and Raji cells.     

The latency-associated nuclear antigen of Kaposi's sarcoma-associated herpesvirus permits replication of terminal repeat-containing plasmids

The latency-associated nuclear antigen (LANA) of Kaposi's sarcoma-associated herpesvirus can associate with mitotic chromosomes and promote latent episome maintenance and segregation. Here we report that LANA also mediates the replication of plasmid DNAs bearing viral terminal repeats. The predicted secondary structure of LANA's C terminus reveals striking similarity to the known structure of the DNA-binding domain of Epstein-Barr virus EBNA1, despite the absence of primary sequence homology between these proteins, suggesting conservation of the key mechanistic features of latent gammaherpesvirus DNA replication.     

Binding of EBNA-1 to DNA creates a protease-resistant domain that encompasses the DNA recognition and dimerization functions.

The Epstein-Barr virus nuclear antigen EBNA-1 is essential for replication of the viral DNA during latency. EBNA-1 binds as a dimer to palindromic recognition sequences within the plasmid origin of replication, ori-P. In this study, proteinase K susceptibility has been used to further characterize the DNA-binding domain of EBNA-1. Limited protease digestion of EBNA-1 (amino acids 408 to 641) generated a smaller DNA-binding species that had a degree of inherent protease resistance. When EBNA-1 was preincubated with a specific DNA probe, the protease resistance of the smaller binding species increased 100-fold, suggesting that the conformation of EBNA-1 changes on binding. The protease-resistant species comprised an 18-kDa polypeptide that was further cleaved at high levels of protease to 11- and 5.4-kDa products. A model of the proposed protease-resistant domain structure is presented. Constructions carrying serial, internal deletions across the 18-kDa domain were created. Each of the deletions perturbed dimerization ability and abolished DNA binding. These studies suggest that the DNA-binding and dimerization motifs of EBNA-1 lie within a conformationally discrete domain whose overall integrity is necessary for EBNA-1-DNA interaction.     

Immunobiochemical characterization with monoclonal antibodies of Epstein-Barr virus-associated early antigens in chemically induced cells.

Five monoclonal antibodies which are reactive to early antigens of Epstein-Barr virus have been produced by using somatic cell hybridization techniques. The specificity of the monoclonal antibodies to early antigens was demonstrated by indirect immunofluorescence, which showed that the antigens were localized to the nucleus of early antigen-induced Raji cells. Additional indirect immunofluorescence studies showed that like patient antisera to diffuse-staining early antigen, the monoclonal antibodies gave positive staining reactions after methanol fixation. One of the antibodies, 1150-4, was positive by the anti-complement immunofluorescence technique but differed with Epstein-Barr virus-associated nuclear antigen-positive patient sera in that it only stained induced cells. Different fixation methods were found to alter dramatically the appearance of the nuclear staining reactions produced by the monoclonal antibodies. Immunoprecipitation and immunoblot experiments revealed that monoclonal antibodies 1108-1 and 1129-1 recognized two polypeptides of 55,000 and 50,000 daltons (p55;50), 1173-6 and 1180-2 recognized just p50, and 1150-4 identified a 65,000-dalton nuclear protein. Immunobiochemical characterization of these viral antigens showed that p55 is a phosphoprotein, and p55;50 has strong DNA-binding activity preferentially to single-stranded DNA. Elucidation of the role of these nuclear proteins in Epstein-Barr virus infection and the events associated with Epstein-Barr virus-directed lymphocyte transformation may provide significant information on the pathogenicity of this important human virus.     

Hematologic and immunologic responses in common marmosets (Callithrix jacchus) infected with Plasmodium knowlesi and Epstein-Barr virus

The hematologic and immunologic responses to infection with either the Epstein-Barr virus alone or infection with Epstein-Barr virus and Plasmodium knowlesi were studied using common marmosets (Callithrix jacchus). The assays performed included complete blood cell counts, determinations of natural killer cell activity, and determinations of antibody titers to Epstein-Barr virus early antigen, virus capsid antigen and the nuclear antigen. While no animal showed signs of lymphoproliferative disease, it was found that animals infected with Epstein-Barr virus became positive for early antigen, virus capsid antigen and nuclear antigen at low levels. No difference in antibody titers between Epstein-Barr virus infected animals and co-infected animals was observed. An increase also was found in the number of leukocytes in all groups, and an increase in natural killer cells following infection with Epstein-Barr virus. Some depression in natural killer cells was observed in the co-infected animals when compared to Epstein-Barr virus infected animals.     

Partial purification of the Epstein-Barr virus nuclear antigen(s)

The Epstein-Barr virus nuclear antigen (EBNA) is speculated to be involved in cell transformation by the virus. Studies on the molecular properties of EBNA, however, have yielded conflicting results. In this study, three Epstein-Barr virus(EBV)-induced antigens were isolated and purified from extracts prepared from Raji cells. These antigens were able to block the anticomplement immunofluorescence reaction, indicating that all three were related to EBNA. The soluble antigen was found wholly in the cytosol fraction. An EBV-induced nuclear antigen I was found both in the cytosol and the nucleus. The EBV-induced nuclear antigen II was found associated with the chromatin. The soluble antigen and the nuclear antigen I were separated and partially purified using phosphocellulose chromatography. Each was further purified 1,400-fold with respect to the whole cell state by chromatography on CL-Sepharose 6B followed by blue dextran-Sepharose. subunit molecular weights of 70,000 were determined for each of these antigens, both in the crude and purified state, by radioimmunoelectrophoresis and gel filtration. The nuclear antigen II was purified 2,500-fold using hydroxylapatite, CL-Sepharose 6B, and blue dextran-Sepharose chromatographies. This antigen displayed two subunits by radioimmunoelectrophoresis with molecular weights of 65,000 and 70,000. Although all antigens shared similar molecular weights, the extent of their homology remains to be determined.     

Induction of Epstein-Barr virus nuclear antigens.

Lymphocytes were infected with the QIMR-WIL strain of Epstein-Barr virus, and the induction of Epstein-Barr virus-associated nuclear antigens was determined by using the protein immunoblot. There was a temporal increase in six antigens, with Epstein-Barr nuclear antigen 2 being detected 1 day after infection. The appearance of these antigens was shown to be independent of cellular DNA synthesis.     

Identification of a short amino acid sequence essential for efficient nuclear targeting of the Epstein-Barr virus nuclear antigen 3A.

The Epstein-Barr virus nuclear antigen 3A is expressed in the nuclei of cells latently infected by the Epstein-Barr virus. We have previously shown that a fragment of 265 amino acids was essential for the proper subcellular localization of the Epstein-Barr virus nuclear antigen 3A. As described in this paper, we have used deletion analysis to identify a decapeptide, RDRRRNPASR, which is essential for nuclear localization of this protein. Furthermore, this decapeptide is a functional nuclear localization signal as demonstrated by its ability to target expression of beta-galactosidase in the nuclei of transfected cells.     

Epstein-Barr virus nuclear antigen forms a complex that binds with high concentration dependence to a single DNA-binding site.

A bacterially synthesized 28-kilodalton carboxyl-terminal fragment (28K-EBNA of Epstein-Barr virus nuclear antigen shows highly concentration dependent binding to monomer, dimer, and trimer copies of synthetic DNA-binding site 5' GATCTAGGATAGCATATGCTACCCCGGGG 3' 3' ATCCTATCGTATACGATGGGGCCCCCTAG 5' in bacterial plasmids. The rate of the binding reaction is independent of the number of sites, but dependent upon the length of the DNA containing the sites. These data are consistent with 28K-EBNA locating its binding sites by a process of facilitated transfer or sliding along the DNA. The highly concentration dependent binding suggests that multiple 28K-EBNA monomer polypeptides form a complex before or during binding. Binding occurs equally well at 24 and 37 degrees C, but not at 0 degrees C. A 28K-EBNA complex bound to a single site has unoccupied binding sites capable of interacting with additional DNA molecules. Such interaction is confirmed by agarose gel electrophoresis of protein-DNA complexes which indicate that a 28K-EBNA complex forms bridges between two DNA molecules. A bridge between the two binding regions in the Epstein-Barr virus origin of plasmid replication (oriP) would form a loop structure which could be an important feature for the regulatory function of authentic Epstein-Barr virus nuclear antigen.     

Two domains of the epstein-barr virus origin DNA-binding protein, EBNA1, orchestrate sequence-specific DNA binding

The EBNA1 (for Epstein-Barr nuclear antigen 1) protein of Epstein-Barr virus governs the replication and partitioning of the viral genomes during latent infection by binding to specific recognition sites in the viral origin of DNA replication. The crystal structure of the DNA binding portion of the EBNA1 protein revealed that this region comprises two structural motifs; a core domain, which mediates protein dimerization and is structurally homologous to the DNA binding domain of the papillomavirus E2 protein, and a flanking domain, which mediated all the observed sequence-specific contacts. To test the possibility that the EBNA1 core domain plays a role in sequence-specific DNA binding not revealed in the crystal structure, we examined the effects of point mutations in potential hydrogen bond donors located in an alpha-helix of the EBNA1 core domain whose structural homologue in E2 mediates sequence-specific DNA binding. We show that these mutations severely reduce the affinity of EBNA1 for its recognition site, and that the core domain, when expressed in the absence of the flanking domain, has sequence-specific DNA binding activity. Flanking domain residues were also found to contribute to the DNA binding activity of EBNA1. Thus, both the core and flanking domains of EBNA1 play direct roles in DNA recognition.     

Structure of the p53 binding domain of HAUSP/USP7 bound to Epstein-Barr nuclear antigen 1 implications for EBV-mediated immortalization

USP7/HAUSP is a key regulator of p53 and Mdm2 and is targeted by the Epstein-Barr nuclear antigen 1 (EBNA1) protein of Epstein-Barr virus (EBV). We have determined the crystal structure of the p53 binding domain of USP7 alone and bound to an EBNA1 peptide. This domain is an eight-stranded beta sandwich similar to the TRAF-C domains of TNF-receptor associated factors, although the mode of peptide binding differs significantly from previously observed TRAF-peptide interactions in the sequence (DPGEGPS) and the conformation of the bound peptide. NMR chemical shift analyses of USP7 bound by EBNA1 and p53 indicated that p53 binds the same pocket as EBNA1 but makes less extensive contacts with USP7. Functional studies indicated that EBNA1 binding to USP7 can protect cells from apoptotic challenge by lowering p53 levels. The data provide a structural and conceptual framework for understanding how EBNA1 might contribute to the survival of Epstein-Barr virus-infected cells.     

KyoT3, an isoform of murine FHL1, associates with the transcription factor RBP-J and represses the RBP-J-mediated transactivation

Previously, we have shown that KyoT2, an isoform of the four and a half LIM domain protein 1 (FHL1), modulates Notch signaling via repressing RBP-J-mediated transactivation. In this study, we investigated the effect of another isoform of FHL1, KyoT3, on transactivation of a RBP-J-dependent promoter. We found that KyoT3 was expressed widely in a variety of tissues. By constructing EGFP fusion proteins, we showed that KyoT3 locates preferentially in nucleus. KyoT3 interacted with RBP-J, as shown by co-immunoprecipitation assays. Moreover, we demonstrated by a reporter assay that KyoT3 repressed transactivation of a RBP-J-dependent promoter, which was activated by both the Notch intracellular domain and Epstein-Barr virus nuclear antigen 2, an EB virus-encoded oncoprotein. These results suggest a multi-elemental control of the Notch signaling pathway, which is critical for cell differentiation in development.