Effects of deletion of the gene for the development-specific protein S on differentiation in Myxococcus xanthus

A deletion mutation of the gene for protein S (tps), a development-specific protein of Myxococcus xanthus, was constructed. No significant differences in the process of fruiting body formation or the yield of myxospores were observed between mutant and wild-type cells. On the other hand, when the tps gene was deleted together with a 2.0-kilobase sequence including the ops gene immediately upstream of the tps gene, fruiting body formation was substantially delayed, and the yield of myxospores was reduced. These results indicate that protein S is not essential for differentiation of M. xanthus, whereas a gene product(s) coded from the sequence upstream of the tps gene appears to be required for normal fruiting body formation.     

Identification of the RNA products of the ops gene of Myxococcus xanthus and mapping of ops and tps RNAs.

The expression of the ops gene, like that of the highly homologous and closely linked tps gene, is induced during development of the fruiting bacterium Myxococcus xanthus. The RNA products of the ops gene have been identified and compared with tps RNA. The ops RNA was observed in developmental cells only after spore formation had commenced, and it was necessary to use a sporulation-defective mutant strain or to disrupt spores to isolate this RNA. RNA from the ops gene was not observed in vegetative cells but was readily detected in cells subjected to glycerol-induced sporulation. In contrast, a large amount of developmental tps RNA was observed in cells well before sporulation had occurred; low levels of tps RNA were observed in vegetative cells; and only a slight increase in tps RNA was found during glycerol-induced sporulation. Several ops and tps RNAs were observed in this study, and the positions of these RNAs were mapped on the M. xanthus genome. The 5' ends of both the ops and tps RNAs mapped predominantly to positions about 50 bases upstream from the respective translational initiation sites. The 3' ends of RNAs from both genes were heterogeneous. The four ops RNAs were 620, 775, 845, and 1,230 bases in length, while the tps RNAs were 612, 695, 730, and 935 bases.     

Differential expression of protein S genes during Myxococcus xanthus development

Protein S, the most abundant protein synthesized during development of the fruiting bacterium Myxococcus xanthus, is coded by two highly homologous genes called protein S gene 1 (ops) and protein S gene 2 (tps). The expression of these genes was studied with fusions of the protein S genes to the lacZ gene of Escherichia coli. The gene fusions were constructed so that expression of beta-galactosidase activity was dependent on protein S gene regulatory sequences. Both the gene 1-lacZ fusion and the gene 2-lacZ fusion were expressed exclusively during fruiting body formation (development) in M. xanthus. However, distinct patterns of induction of fusion protein activity were observed for the two genes. Gene 2 fusion activity was detected early during development on an agar surface and could also be observed during nutritional downshift in dispersed liquid culture. Gene 1 fusion activity was not detected until much later in development and was not observed after downshift in liquid culture. The time of induction of gene 1 fusion activity was correlated with the onset of sporulation, and most of the activity was spore associated. This gene fusion was expressed during glycerol-induced sporulation when gene 2 fusion activity could not be detected. The protein S genes appear to be members of distinct regulatory classes of developmental genes in M. xanthus.     

Myxococcus xanthus protein C is a major spore surface protein.

Fruiting body formation in Myxococcus xanthus involves the aggregation of cells to form mounds and the differentiation of rod-shaped cells into spherical myxospores. The surface of the myxospore is composed of several sodium dodecyl sulfate (SDS)-soluble proteins, the best characterized of which is protein S (Mr, 19,000). We have identified a new major spore surface protein called protein C (Mr, 30,000). Protein C is not present in extracts of vegetative cells but appears in extracts of developing cells by 6 h. Protein C, like protein S, is produced during starvation in liquid medium but is not made during glycerol-induced sporulation. Its synthesis is blocked in certain developmental mutants but not others. When examined by SDS-polyacrylamide gel electrophoresis, two forms of protein C are observed. Protein C is quantitatively released from spores by treatment with 0.1 N NaOH or by boiling in 1% SDS. It is slowly washed from the spore surface in water but is stabilized by the presence of magnesium. Protein C binds to the surface of spores depleted of protein C and protein S. Protein C is a useful new marker for development in M. xanthus because it is developmentally regulated, spore associated, abundant, and easily purified.     

Sporulation of Myxococcus xanthus in liquid shake flask cultures.

When suspended in a liquid starvation medium, exponentially growing Myxococcus xanthus sporulated within 3 days. These myxospores were similar to spores developed within fruiting bodies, as determined by electron microscopy and the production of spore-specific protein S. This liquid sporulation system may be useful as a means of preparing large quantities of myxospores and extracellular fluid for biochemical studies, including isolation of chemical signals produced during the sporulation process.     

Gene expression during development of Myxococcus xanthus. Analysis of the genes for protein S

Protein S is an abundant spore coat protein produced during fruiting body formation (development) of the bacterium Myxococcus xanthus. We have cloned the DNA which codes for protein S and have found that this DNA hybridizes to three protein S RNA species from developmental cells but does not hybridize to RNA from vegetative cells. The half-life of protein S RNA was found to be unusually long, about 38 minutes, which, at least in part, accounts for the high level of protein S synthesis observed during development. Hybridization of restriction fragments from cloned M. xanthus DNA to the developmental RNAs enabled us to show that M. xanthus has two directly repeated genes for protein S (gene 1 and gene 2) which are separated by about 10(3) base-pairs on the bacterial chromosome. To study the expression of the protein S genes in M. xanthus, eight M. xanthus strains were isolated with Tn5 insertions at various positions in the DNA which codes for protein S. The strains which contained insertions in gene 1 or between gene 1 and gene 2 synthesized all three protein S RNA species and exhibited normal levels of protein S on spores. In contrast, M. xanthus strains exhibited normal levels of protein S on spores. In contrast, M. xanthus strains with insertions in gene 2 had no detectable protein S on spores and lacked protein S RNA. Thus, gene 2 is responsible for most if not all of the production of protein S during M. xanthus development. M. xanthus strains containing insertions in gene 1, gene 2 or both genes, were found to aggregate and sporulate normally even though strains bearing insertions in gene 2 contained no detectable protein S. We examined the expression of gene 1 in more detail by constructing a fusion between the lacZ gene of Escherichia coli and the N-terminal portion of protein S gene 1 of M. xanthus. The expression of beta-galactosidase activity in an M. xanthus strain containing the gene fusion was shown to be under developmental control. This result suggests that gene 1 is also expressed during development although apparently at a much lower level than gene 2.     

Small acid-soluble proteins with intrinsic disorder are required for UV resistance in Myxococcus xanthus spores

Bacterial sporulation in Gram-positive bacteria results in small acid-soluble proteins called SASPs that bind to DNA and prevent the damaging effects of UV radiation. Orthologs of Bacillus subtilis genes encoding SASPs can be found in many sporulating and nonsporulating bacteria, but they are noticeably absent from spore-forming, Gram-negative Myxococcus xanthus. This is despite the fact that M. xanthus can form UV-resistant spores. Here we report evidence that M. xanthus produces its own unique group of low-molecular-weight, acid-soluble proteins that facilitate UV resistance in spores. These M. xanthus-specific SASPs vary depending upon whether spore formation is induced by starvation inside cell aggregations of fruiting bodies or is induced artificially by glycerol induction. Molecular predictions indicate that M. xanthus SASPs may have some association with the cell walls of M. xanthus spores, which may signify a different mechanism of UV protection than that seen in Gram-positive spores.     

The lonD gene is homologous to the lon gene encoding an ATP-dependent protease and is essential for the development of Myxococcus xanthus.

Myxococcus xanthus contains two genes (lonV and lonD) homologous to the Escherichia coli lon gene for an ATP-dependent protease. We found that the lonD gene encodes a 90-kDa protein consisting of 827 amino acid residues. The lonD gene product shows 49, 48, and 52% sequence identity to the products of the M. xanthus lonV, E. coli lon, and Bacillus brevis lon genes, respectively. When a lonD-lacZ fusion was used, lonD was expressed during both vegetative growth and development. However, while lonD-disrupted strains were able to grow normally vegetatively, the development of M. xanthus was found to be arrested at an early stage in these strains. The mutant strains were able to form neither fruiting bodies nor myxospores.     

Identification of major sporulation proteins of Myxococcus xanthus using a proteomic approach

Myxococcus xanthus is a soil-dwelling, gram-negative bacterium that during nutrient deprivation is capable of undergoing morphogenesis from a vegetative rod to a spherical, stress-resistant spore inside a domed-shaped, multicellular fruiting body. To identify proteins required for building stress-resistant M. xanthus spores, we compared the proteome of liquid-grown vegetative cells with the proteome of mature fruiting body spores. Two proteins, protein S and protein S1, were differentially expressed in spores, as has been reported previously. In addition, we identified three previously uncharacterized proteins that are differentially expressed in spores and that exhibit no homology to known proteins. The genes encoding these three novel major spore proteins (mspA, mspB, and mspC) were inactivated by insertion mutagenesis, and the development of the resulting mutant strains was characterized. All three mutants were capable of aggregating, but for two of the strains the resulting fruiting bodies remained flattened mounds of cells. The most pronounced structural defect of spores produced by all three mutants was an altered cortex layer. We found that mspA and mspB mutant spores were more sensitive specifically to heat and sodium dodecyl sulfate than wild-type spores, while mspC mutant spores were more sensitive to all stress treatments examined. Hence, the products of mspA, mspB, and mspC play significant roles in morphogenesis of M. xanthus spores and in the ability of spores to survive environmental stress.     

Characterization of calcium-binding sites in development-specific protein S of Myxococcus xanthus using site-specific mutagenesis

Protein S, the most abundant protein synthesized during development of the Gram-negative bacterium Myxococcus xanthus, assembles on the surface of the spores. It can be dissociated from the spores using divalent metal chelators and will reassemble on the spores in the presence of calcium. The amino acid sequence of protein S contains regions which have homology to the calcium-binding sites of calmodulin. Protein S was found to bind 2 mol of calcium/mol of protein with Kd values of 27 and 76 microM. Using oligonucleotide-directed site-specific mutagenesis, the gene coding for protein S was changed in each of two regions of homology to calmodulin (Ser40----Arg,Ser129----Arg), and a double mutant was also constructed. Each mutant gene was then transduced into the genome of a M. xanthus strain from which the wild-type genes had been deleted. All three mutants produced protein S normally during development. One of the mutants (Ser129----Arg) had normal amounts of protein S on its spores, whereas the other (Ser40----Arg) bound much less and the double mutant had virtually none. Analysis of the calcium binding affinities of the purified proteins showed that [Arg40]protein S and [Arg40, Arg129]protein S did not bind detectable quantities of calcium, whereas [Arg129]protein S bound less calcium than the wild-type protein and with a reduced affinity.     

Cloning and characterization of the socA locus which restores development to Myxococcus xanthus C-signaling mutants.

The csgA gene produces an intercellular signal during fruiting body formation of the myxobacterium Myxococcus xanthus. Sporulating pseudorevertants were isolated to allow us to understand the mechanism by which CsgA is perceived by cells and used to regulate developmental gene expression. Two strains, LS559 and LS560, which have closely linked transposon insertions, soc-559 (formerly csp-559) and soc-560 (formerly csp-560), respectively, regained all the developmental behaviors lost by the csgA mutation including the ability to ripple, form fruiting bodies, and sporulate. The sequence analysis of the socA locus revealed that there are three putative protein-coding regions, designated socA1, socA2, and socA3. The deduced amino acid sequence of socA1 exhibits characteristics of the short-chain alcohol dehydrogenase family. The deduced amino acid sequence of socA2 shares 48% identity with the frdD gene product of the frd operon in Proteus vulgaris which anchors fumarate reductase to the membrane. The deduced amino acid sequence of socA3 does not show homology to any known proteins. Genotypic complementation, Northern (RNA) blotting, DNA sequence analysis, and the pattern of gene expression all suggest that these three genes are polycistronic. Since the socA mutations effectively bypass CsgA, the question of why csgA is maintained in M. xanthus was examined by studying the long-term stability of socA spores. Unlike the wild type, socA mutant spores germinated on starvation agar. Transmission electron micrographs of spore thin sections revealed that germination is not due to an obvious structural deficiency of the socA spores. These results suggest that the ability of socA myxospores to survive long periods under unfavorable environmental conditions is severely comprised. Therefore, soxA appears to be essential for the development of M. xanthus.     

A unique repetitive DNA sequence in the Myxococcus xanthus genome.

We found a novel type of repetitive DNA sequence in the Myxococcus xanthus genome. The first repetitive sequence is located in the spacer region between the ops and tps genes. We cloned five other repetitive sequences using the first repetitive sequence as a probe and determined their nucleotide sequences. Comparison of these sequences revealed that the repetitive sequences consist of a 87-bp core sequence and that some clones share additional homology on their flanking regions.     

Patterns of Protein Production in Myxococcus xanthus During Spore Formation Induced by Glycerol, Dimethyl Sulfoxide, and Phenethyl Alcohol

Spore formation of Myxococcus xanthus can occur not only on agar plates during fruiting body formation, but also in a liquid culture by simply adding glycerol, dimethyl sulfoxide, or phenethyl alcohol to the culture. This chemically-induced spore formation occurs synchronously and much faster than that occurring during fruiting body formation. Dramatic changes in patterns of protein synthesis were observed during chemically-induced spore formation, as had previously been observed during fruiting body formation (Inouye et al., Dev. Biol. 68:579-591, 1979). However, the production of protein S, one of the major development-specific proteins during fruiting body formation, was not detected at all, although protein U, another development-specific protein, was produced in a late stage of spore formation as in the case of fruiting body formation. This indicates that the control of the gene expression during chemically-induced spore formation is significantly different from that during fruiting body formation. It was also found that during spore formation, every cell seems to have a potential to form a spore regardless of its age, since smaller cells as well as larger cells separated by sucrose density gradient centrifugation could equally form spores upon the addition of glycerol. Patterns of protein synthesis were almost identical for all the three chemicals. However, the final yield of spores was significantly different depending upon the chemicals used. When phenethyl alcohol was added with glycerol or dimethyl sulfoxide, the final yields were determined by the multiple effect of the two chemicals added. This suggests that although these chemicals are able to induce the gene functions required for spore formation, they may have inhibitory effects on some of the gene functions or the processes of spore formation.     

Protein U, a late-developmental spore coat protein of Myxococcus xanthus, is a secretory protein.

Protein U is a spore coat protein produced at the late stage of development of Myxococcus xanthus. This protein was isolated from developmental cells, and its amino-terminal sequence was determined. On the basis of this sequence, the gene for protein U (pru) was cloned and its DNA sequence was determined, revealing an open reading frame of 179 codons. The product from this open reading frame has a typical signal peptide of 25 amino acid residues at the amino terminal end, followed by protein U of 154 residues. This result indicates that protein U is produced as a secretory precursor, pro-protein U, which is then secreted across the membrane to assemble on the spore surface. This is in sharp contrast to protein S, a major spore coat protein produced early in development, which has no signal peptide, indicating that there are two distinct pathways for trafficking of spore coat proteins during the differentiation of M. xanthus.     

Analysis of dofA,a fruA-dependent developmental gene,and its homologue,dofB, in Myxococcus xanthus

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.     

Trehalose-6-P synthase is dispensable for growth on glucose but not for spore germination in Schizosaccharomyces pombe.

Trehalose-6-P inhibits hexokinases in Saccharomyces cerevisiae (M. A. Blázquez, R. Lagunas, C. Gancedo, and J. M. Gancedo, FEBS Lett. 329:51-54, 1993), and disruption of the TPS1 gene (formerly named CIF1 or FDP1) encoding trehalose-6-P synthase prevents growth in glucose. We have found that the hexokinase from Schizosaccharomyces pombe is not inhibited by trehalose-6-P even at a concentration of 3 mM. The highest internal concentration of trehalose-6-P that we measured in S. pombe was 0.75 mM after heat shock. We have isolated from S. pombe the tps1+ gene, which is homologous to the Saccharomyces cerevisiae TPS1 gene. The DNA sequence from tps1+ predicts a protein of 479 amino acids with 65% identity with the protein of S. cerevisiae. The tps1+ gene expressed from its own promoter could complement the lack of trehalose-6-P synthase in S. cerevisiae tps1 mutants. The TPS1 gene from S. cerevisiae could also restore trehalose synthesis in S. pombe tps1 mutants. A chromosomal disruption of the tps1+ gene in S. pombe did not have a noticeable effect on growth in glucose, in contrast with the disruption of TPS1 in S. cerevisiae. However, the disruption prevented germination of spores carrying it. The level of an RNA hybridizing with an internal probe of the tps1+ gene reached a maximum after 20 min of heat shock treatment. The results presented support the idea that trehalose-6-P plays a role in the control of glycolysis in S. cerevisiae but not in S. pombe and show that the trehalose pathway has different roles in the two yeast species.