Mitochondrial telomeres: surprising diversity of repeated telomeric DNA sequences among six species of Tetrahymena

The DNA sequences at the ends of the linear mtDNA of 6 species of Tetrahymena encompassing 13 strains were determined. All the strains have variable numbers of a tandemly repeated DNA sequence, 31 bp to 53 bp in size, at their mtDNA termini. Based upon the size and nucleotide sequence of the terminal repeats, the telomeres can be separated into four classes. T. pigmentosa, hyperangularis, and hegewischi have different telomeric repeats on the two ends of their mtDNAs. The only conserved feature of the mtDNA termini is the presence of tandem repeats. The function of the repeats might be to promote unequal crossing over during recombination, thereby overcoming the problem of telomere replication for these linear DNAs.     

Sequence homologies of diverse length tandem repetitions near ends of vaccinia virus genome suggest unequal crossing over.

The 180,000 base pair (bp), covalently closed, linear duplex DNA genome of vaccinia virus contains a 10,000 bp inverted terminal repetition within which are one set of 13 and one set of 18 tandem 70 bp repeating units. A 967 bp segment containing the innermost 70 bp repeat and an adjacent region notable for a scarcity of restriction endonuclease sites has been sequenced. This was facilitated by the cloning of TaqI and partial TaqI fragments in pBR322. We found that the innermost 70 bp repeat overlaps one of two adjacent 125 bp repeats, following which are eight repeats of 54 bp, parts of 54 bp and 70 bp repeats, and four consecutive 6 to 7 bp repeats. The 70, 125, and 54 bp repeating units have extensive sequence homologies and redundancies that suggest evolution by unequal crossing over. Schemes whereby unequal crossovers of 54 bp repeats lead to a recombinant segment 86% homologous to the 125 bp repeat and unequal crossovers of 125 bp repeats lead to a recombinant segment 94% homologous to the 70 bp repeat were considered. This propensity for sequence divergence should provide a useful marker for comparing the relatedness of poxviruses.     

Tandem repeats within the inverted terminal repetition of vaccinia virus DNA

A tandemly repeated sequence within the genome of vaccinia virus is cut to fragments of approximately 70 bp by Hinf I, Taq I or Mbo II. The 70 bp repetition was localized within the much larger (10,300 bp) inverted terminal repetition by restriction analysis of cloned DNA fragments and by hybridization of the purified 70 bp repeat to vaccinia virus DNA restriction fragments. The molar abundance of the 70 bp fragment corresponds to a 30 fold repetition at each end of the genome. The repeating restriction endonuclease sites were mapped by agarose gel electrophoresis of partial Hinf I digests of the terminally labeled cloned DNA fragment. The first of 13 repetitive Hinf I sites occurred approximately 150 bp from the end of the cloned DNA. After an intervening sequence of approximately 435 bp, a second series of 17 repetitive Hinf I sites occurred. The DNA between the two blocks of repetitions has a unique sequence containing single Dde I, Alu I and Sau 3A sites. Tandem repeats within the inverted terminal repetition could serve to accelerate self-annealing of single strands of DNA to form circular structures during replication.     

Circular DNA of human immunodeficiency virus: analysis of circle junction nucleotide sequences.

During infection of cells by retroviruses, some of the nonintegrated viral DNA can be found as a circular form containing two tandem, directly repeated long terminal repeats. The nucleotide sequence at the point where the long terminal repeats join (the circle junction) can be used to deduce the terminal nucleotides of the linear form of the viral DNA. Comparison of the termini of linear viral DNA with sequences at the junctions between the integrated provirus and the host chromosome has revealed that for most retroviruses 2 bp are removed from each end of the linear viral DNA during integration. For human immunodeficiency virus type 1 (HIV-1), however, sequence considerations involving primer-binding sites had suggested that only 1 bp is removed during integration. We obtained the nucleotide sequences at the ends of HIV-1 DNA by using the polymerase chain reaction to amplify fragments corresponding to the HIV-1 circle junction. Of 17 clones containing amplified sequences, 10 had identical circle junctions that contained an additional 4 bp (GTAC) relative to the integrated provirus. This indicates that, as for other retroviruses, 2 bp are removed from each end of the linear HIV-1 viral DNA during integration. The remaining seven isolates contained insertions or deletions at the circle junction.     

Tnat1 and Tnat2 from Arabidopsis thaliana: novel transposable elements with tandem repeat sequences.

A computer-aided homology search of databases found that the nucleotide sequences flanking ATLN44, a non-LTR retrotransposon (LINE) from Arabidopsis thaliana, are repeated in the A. thaliana genome. These sequences are homologous to flanking sequences of 664 bp with terminal inverted repeat sequences of about 70 bp. The 664-bp sequence and most of the 14 homologues identified were flanked by direct repeat sequences of 9 bp. These findings indicate that the repeated sequence, named Tnat1, is a transposable element that duplicates a 9-bp sequence at the target site on transposition and that ATLN44 is inserted in one Tnat1 member. Interestingly, all of the Tnat1 members had tandem repeats comprised of several units of a 60-bp sequence, the number of repeats differing among Tnat1 members. Of the Tnat1 members identified, one was inserted into another sequence repeated in the A. thaliana genome: that sequence is about 770 bp long and has terminal inverted repeat sequences of about 110 bp. The sequence is flanked by direct repeats of a 9-bp sequence, indicating that it is another transposable element, named Tnat2, from A. thaliana. Moreover, Tnat2 members had a tandem repeat about 240 bp long. Tnat1 and Tnat2 with tandem repeats in their internal regions show no homology to each other or to any of the elements identified previously; therefore they appear to be novel transposable elements.     

Relationship of micro-and minisatellites in the human genome

Micro-and minisatellites constitute an essential part of DNA with low sequence complexity and perform a number of important functions. The TandemSWAN program was used to search the human genome for tandem repeats with a length of a repeated unit to 70 bp, including repeats with a large number of nucleotide substitutions. It was shown that, for a significant fraction of the program-found minisatellites with a repeat unit length less than 25 bp, a shorter repeated motif can be discerned in this sequence, which is often similar to the sequence of microsatellites occurring widely in the human genome. A model of hierarchical origin of minisatellites in the human genome was proposed.     

The telomeres of Streptomyces chromosomes contain conserved palindromic sequences with potential to form complex secondary structures

The chromosomes of the Gram-positive soil bacteria Streptomyces are linear DNA molecules, usually of about 8 Mb, containing a centrally located origin of replication and covalently bound terminal proteins (which are presumably involved in the completion of replication of the telomeres). The ends of the chromosomes contain inverted repeats of variable lengths. The terminal segments of five Streptomyces chromosomes and plasmids were cloned and sequenced. The sequences showed a high degree of conservation in the first 166–168 bp. Beyond the terminal homology, the sequences diverged and did not generally cross-hybridize. The homologous regions contained seven palindromes with a few nucleotide differences. Many of these differences occur in complementary pairs, such that the palindromicity is preserved. Energy-optimized modelling predicted that the 3' strand of the terminal palindromes can form extensive hairpin structures that are similar to the 3' ends of autonomous parvovirus genomes. Most of the putative hairpins have a GCGCAGC sequence at the loop, with the potential to form a stable single C-residue loop closed by a sheared G:A pairing. The similarity between the terminal structures of the Streptomyces replicons and the autonomous parvoviral genomes suggests that they may share some structural and/or replication features.     

Nucleotide sequence required for resolution of the concatemer junction of vaccinia virus DNA.

The mature form of the vaccinia virus genome consists of a linear, 185,000-base-pair (bp) DNA molecule with a 10,000-bp inverted terminal repetition and incompletely base-paired 104-nucleotide hairpin loops connecting the two strands at each end. In concatemeric forms of intracellular vaccinia virus DNA, the inverted terminal repetitions of adjacent genomes form an imperfect palindrome. The apex of this palindrome corresponds in sequence to the double-stranded form of the hairpin loop. Circular plasmids containing palindromic concatemer junction fragments of 250 bp or longer are converted into linear minichromosomes with hairpin ends when they are transfected into vaccinia virus-infected cells, providing a model system with which to study the resolution process. To distinguish between sequence-specific and structural requirements for resolution, plasmids with symmetrical insertions, deletions, and oligonucleotide-directed mutations within the concatemer junction were constructed. A sequence (ATTTAGTGTCTAGAAAAAAA) located on both sides of the apex segment was found to be critical for resolution. Resolution was more efficient when additional nucleotides, TGTG, followed the run of A residues. Both the location and sequence of the proposed resolution signal are highly conserved among poxviruses.     

Relationship between micro- and minisatellites in the human genome

Micro- and minisatellites constitute an essential part of DNA with a low sequence complexity and carry several important functions. A search for tandem repeats in the human genome with a length of a repeat unit of up to 70 bp, including repeats with a great number of nucleotide substitutions, has been performed using the TaadeaSWAN program. It was shown that, for a considerable number of minisatellites with the length of the repeating unit of less than 25 nt, a shorter repeating motif can be distinguished in the sequence of this repeat, which often is similar to the sequence of minisatellites widely occurring in the human genome. A model of hierarchic origination of minisatellites in the human genome is suggested.     

Analysis of separate isolates of Bordetella pertussis repeated DNA sequences

Two independent isolates of a Bordetella pertussis repeated DNA unit were sequenced and shown to be an insertion sequence element with five nucleotide differences between the two copies. The sequences were 1053 bp in length with near-perfect terminal inverted repeats of 28 bp, had three open reading frames, and were each flanked by short direct repeats. The two insertion sequences showed considerable homology to two other B. pertussis repeated DNA sequences reported recently: IS481 and a 530 bp repeated DNA unit. The B. pertussis insertion sequence would appear to comprise a group of closely related sequences differing mainly in flanking direct repeats and the terminal inverted repeats. The two isolates reported here, which were from the adenylate cyclase and agglutinogen 2 regions of the genome, were numbered IS48lvl and IS48lv2 respectively.     

Protein-primed DNA replication: role of inverted terminal repeats in the Escherichia coli bacteriophage PRD1 life cycle.

Escherichia coli bacteriophage PRD1 and its relatives contain linear double-stranded DNA genomes, the replication of which proceeds via a protein-primed mechanism. Characteristically, these molecules contain 5'-covalently bound terminal proteins and inverted terminal nucleotide sequences (inverted terminal repeats [ITRs]). The ITRs of each PRD1 phage species have evolved in parallel, suggesting communication between the molecule ends during the life cycle of these viruses. This process was studied by constructing chimeric PRD1 phage DNA molecules with dissimilar end sequences. These molecules were created by combining two closely related phage genomes (i) in vivo by homologous recombination and (ii) in vitro by ligation of appropriate DNA restriction fragments. The fate of the ITRs after propagation of single genomes was monitored by DNA sequence analysis. Recombinants created in vivo showed that phages with nonidentical genome termini are viable and relatively stable, and hybrid phages made in vitro verified this observation. However, genomes in which the dissimilar DNA termini had regained identical sequences were also detected. These observations are explained by a DNA replication model involving two not mutually exclusive pathways. The generality of this model in protein-primed DNA replication is discussed.     

Linear mitochondrial DNAs from yeasts: telomeres with large tandem repetitions

The terminal structure of the linear mitochondrial DNA (mtDNA) from the yeast Candida parapsilosis was investigated. This mtDNA, 30 kb long, has symmetrical ends forming inverted terminal repeats. These repeats are made up of a variable number of tandemly repeating units of 738 by each; the terminal nucleotide corresponds to a precise position within the last repeat unit sequence. The ends had an open structure accessible to enzymes, with a 5 single-stranded extension of about 110 nucleotides. No circular forms were detected in the DNA preparations. Two other unrelated species, Pichia philodendra and Candida salmanticensis also appear to have a linear mtDNA of similar organization. These linear DNAs (which we name Type 2 linear mtDNAs) are distinct from the previously described linear mtDNAs of yeasts whose termini are formed by a closed hairpin loop (Type 1 linear mtDNA). The terminal structure of C. parapsilosis mtDNA is reminiscent of the linear mitochondrial genomes of the ciliate Tetrahymena although, in the latter, the telomeric tandem repeat unit is considerably shorter.     

Deletions of muscle mitochondrial DNA in mitochondrial myopathies: sequence analysis and possible mechanisms.

Forty per cent of patients with mitochondrial myopathies, a diverse group of multisystem diseases predominantly affecting skeletal muscle and the brain, have large deletions of a proportion of muscle mitochondrial DNA (mt DNA). These appeared to be identical in 13 of 28 cases, contained within the region 8286-13595 bp. Analysis of the deletion junction in two cases showed a 13 nucleotide sequence which occurred in the normal genome as a direct repeat flanking the region deleted in the mutant mt DNAs. Mt DNA deletions may arise from recombination or slippage between short sequence repeats during replication.     

Nucleotide sequence of the maize transposable element Mul

A cloned DNA fragment from the maize allele Adhl-S3034 contains all of Mul, an insertion element involved in Robertson's Mutator activity. The element is 1367 base pairs (bp) long and is flanked by nine bp direct repeats of insertion site DNA. It has inverted terminal repeats of 215 and 213 bp showing 95% homology. Within the element are two direct repeats of 104 bp showing 96% homology. Four open reading frames (ORFs) were found, two in each DNA strand. Mul can be divided into two halves, each containing one terminal inverted repeat, an internal direct repeat, and two overlapping ORFs. The GC content of each half is high (70%), while that of a central 60 base portion of the element is low (26%). The central region contains the only sequence resembling the TAATA Goldberg and Hogness eukaryotic promoter signal. Multiple copies of DNA sequences related to Mul found in Mutator maize plants are generally similar in organization to the cloned element. A larger version containing a discrete 300 to 400 base pair insertion was found in some Mutator lines.     

Analysis of an origin of DNA replication located at the L terminus of the genome of pseudorabies virus.

We have localized an origin of DNA replication at the L terminus of the pseudorabies virus genome. This origin differs in location as well as in general structure from the origins of replication of other herpesviruses that have been identified. The 600 leftmost nucleotides of the genome that were found to include origin function have been analyzed. This sequence is composed of an 82-bp palindrome whose center of symmetry is separated by 352 unique bp (UL2). Within the UL2, a sequence that fits the consensus sequence of the NF1 binding site, as well as one that has partial homology to the binding site of UL9 of herpes simplex virus, is present. Using truncated fragments of DNA, sequences essential for minimal origin function were delimited to within a fragment that includes the terminal 104 bp of the left end of the genome. Within these 104 bp, two elements essential to origin function have been identified. One of these elements is present within the terminal 64 bp of the L component (within one of the palindromic arms). The other is present within the 22 bp of the UL2 adjacent to this palindromic arm. Other auxiliary elements, although not essential for origin function, contribute to more efficient replication. The NF1 and UL9 binding site homologies were found to be nonessential to origin function.     

Telomere terminal transferase activity in the hypotrichous ciliate Oxytricha nova and a model for replication of the ends of linear DNA molecules.

We have found abundant telomere-specific terminal transferase activity in crude macronuclear extracts from vegetatively growing cells of the hypotrichous ciliate Oxytricha nova. This activity adds two to seven tandem repeats of the sequence GGGGTTTT (the Oxytricha telomeric repeat) to the 3' end of oligonucleotide primers ending in repeats of G4T4 and always adds the repeats in the proper phase. The activity requires the presence of micromolar amounts of dGTP and dTTP as well as single-stranded oligomer primers ending 3' with repeats of the Oxytricha telomeric sequence. A nuclease activity is present in the extracts which is closely balanced with telomere terminal transferase activity. We propose a simple model for replication of the ends of linear DNA molecules based on the telomere terminal transferase.     

Adeno-associated virus type 2 DNA replication in vivo: mutation analyses of the D sequence in viral inverted terminal repeats.

The adeno-associated virus type 2 (AAV) genome contains inverted terminal repeats (ITRs) of 145 nucleotides. The terminal 125 nucleotides of each ITR form palindromic hairpin (HP) structures that serve as primers for AAV DNA replication. These HP structures also play an important role in integration as well as rescue of the proviral genome from latently infected cells or from recombinant AAV plasmids. Each ITR also contains a stretch of 20 nucleotides, designated the D sequence, that is not involved in HP structure formation. We have recently shown that the D sequence plays a crucial role in high-efficiency rescue, selective replication, and encapsidation of the AAV genome and that a host cell protein, designated the D sequence-binding protein (D-BP), specifically interacts with this sequence (X.-S. Wang, S. Ponnazhagan, and A. Srivastava, J. Virol. 70:1668-1677, 1996). We have now performed mutational analyses of the D sequences to evaluate their precise role in viral DNA rescue, replication, and packaging. We report here that 10 nucleotides proximal to the HP structure in each of the D sequences are necessary and sufficient to mediate high-efficiency rescue, replication, and encapsidation of the viral genome in vivo. In in vitro studies, the same 10 nucleotides were found to be required for specific interaction with D-BP, but viral Rep protein-mediated cleavage at the functional terminal resolution site is independent of these sequences. These data suggest that AAV replication and terminal resolution functions can be uncoupled and that the lack of efficient replication of AAV DNA may not be a consequence of impaired resolution of the viral ITRs. These studies further illustrate that the D sequence-D-BP interaction plays an important role in the AAV life cycle and indicate that it may be possible to develop the next generation of AAV vectors capable of encapsidating larger pieces of DNA.