Electrochemical aptasensor for tetracycline detection

An electrochemical aptasensor was developed for the detection of tetracycline using ssDNA aptamer that selectively binds to tetracycline as recognition element. The aptamer was highly selective for tetracycline which distinguishes minor structural changes on other tetracycline derivatives. The biotinylated ssDNA aptamer was immobilized on a streptavidin-modified screen-printed gold electrode, and the binding of tetracycline to aptamer was analyzed by cyclic voltammetry and square wave voltammetry. Our results showed that the minimum detection limit of this sensor was 10 nM to micromolar range. The aptasensor showed high selectivity for tetracycline over the other structurally related tetracycline derivatives (oxytetracycline and doxycycline) in a mixture. The aptasensor developed in this study can potentially be used for detection of tetracycline in pharmaceutical preparations, contaminated food products, and drinking water.     

Carbon nanoparticle for highly sensitive and selective fluorescent detection of mercury(II) ion in aqueous solution

In this article, carbon nanoparticles (CNPs) were used as a novel fluorescent sensing platform for highly sensitive and selective Hg(2+) detection. To the best of our knowledge, this is the first example of CNPs obtained from candle soot used in this type of sensor. The general concept used in this approach is based on that adsorption of the fluorescently labeled single-stranded DNA (ssDNA) probe by CNP via π-π stacking interactions between DNA bases and CNP leads to substantial dye fluorescence quenching; however, in the presence of Hg(2+), T-Hg(2+)-T induced hairpin structure does not adsorb on CNP and thus retains the dye fluorescence. A detection limit as low as 10nM was achieved. The present CNP-based biosensor for Hg(2+) detection exhibits remarkable specificity against other possible metal ions. Furthermore, superior selectivity performance was observed when Hg(2+) detection was carried out in the presence of a large amount of other interference ions. Finally, in order to evaluate its potential practical application, Hg(2+) detection was conducted with the use of lake water other than pure buffer and it is believed that it holds great promise for real sample analysis upon further development.     

Highly sensitive oligonucleotide-based fluorometric detection of mercury(II) in aqueous media

This paper describes a highly sensitive and selective Hg(2+) sensor using a label free Hg(2+) specific probe (5'-18T-3') and an intercalation dye SYBR Green I (SG). The Hg(2+) specific probe is composed of thymines (T) and readily forms T-Hg(2+)-T complexes in the presence of Hg(2+). This specific T-Hg(2+)-T formation affects the hybridization of the Hg(2+) specific probe and the intercalation of SG. Upon treatment of 1 nM 5'-18T-3' with different amount of Hg(2+) (0.1-10nM), which is followed by hybridization with 1 nM 5'-18T-3' and incubation with 1 microL of SG, the solution fluorescence gave a linear response (R=0.996) to the concentration of Hg(2+). The detection limit for Hg(2+) was 0.5 nM (0.1 ppb). The overall test only takes few minutes and very little interference is observed from non-specific metal ions. This approach may find potential applications in monitoring the Hg(2+) concentration in drinking water.     

Gold nanoparticle-based colorimetric detection of kanamycin using a DNA aptamer

A selective kanamycin-binding single-strand DNA (ssDNA) aptamer (TGGGGGTTGAGGCTAAGCCGA) was discovered through in vitro selection using affinity chromatography with kanamycin-immobilized sepharose beads. The selected aptamer has a high affinity for kanamycin and also for kanamycin derivatives such as kanamycin B and tobramycin. The dissociation constants (K_d [kanamycin] = 78.8 nM, K_d [kanamycin B] = 84.5 nM, and K_d [tobramycin] = 103 nM) of the new aptamer were determined by fluorescence intensity analysis using 5′-fluorescein amidite (FAM) modification. Using this aptamer, kanamycin was detected down to 25 nM by the gold nanoparticle-based colorimetric method. Because the designed colorimetric method is simple, easy, and visible to the naked eye, it has advantages that make it useful for the detection of kanamycin. Furthermore, the selected new aptamer has many potential applications as a bioprobe for the detection of kanamycin, kanamycin B, and tobramycin in pharmaceutical preparations and food products.     

Silica nanoparticles based label-free aptamer hybridization for ATP detection using hoechst33258 as the signal reporter

In this work, we have developed a simple and sensitive method for ATP detection using silica nanoparticles (NPs) as the platform and hoechst33258 as the signal reporter. The ATP-binding aptamers hybridize with the probe DNA (DNA(p)) immobilized NPs to form the aptamer/DNA(p) duplex on the NPs surface. The conformational change of the aptamer leads to the decrease of the aptamer/DNA(p) duplex on the NPs due to the ATP-binding aptamer switches its structure from the aptamer/DNA(p) duplex to the aptamer/target complex in the presence of ATP. ATP detection can be easily realized by separating the silica nanoparticles and adding the hoechst33258 of intercalating to aptamer/DNA(p) (dsDNA). Good selectivity between ATP and CTP, GTP or UTP has been demonstrated, which is due to the specific recognition between ATP aptamer and ATP. The K(d) was estimated to be ～1mM from 0 to 4mM and a liner response was observed from 0 to 0.2mM with a detection limit of ～20μM. Compared with other methods, the carboxyl-modified silica nanoparticles (～60nm) prepared by the reverse microemulsion method can serve as a stable and sensitive sensor platform because of their smaller size and facile conjugation with amine-containing molecules. In addition, the high sensitivity and selectivity of hoechst33258 was employed for the ssDNA and dsDNA determination, which takes advantage of the label-free aptamer and lower cost.     

Design and characterization of electrochemical dopamine–aptamer as convenient and integrated sensing platform

Here, an ultrasensitive label-free electrochemical aptasensor was developed for dopamine (DA) detection. Construction of the aptasensor was carried out by electrodeposition of gold–platinum nanoparticles (Au–PtNPs) on glassy carbon (GC) electrode modified with acid-oxidized carbon nanotubes (CNTs–COOH). A designed complementary amine-capped capture probe (ssDNA1) was immobilized at the surface of PtNPs/CNTs–COOH/GC electrode through the covalent amide bonds formed by the carboxyl groups on the nanotubes and the amino groups on the oligonucleotides. DA-specific aptamer was attached onto the electrode surface through hybridization with the ssDNA1. Methylene blue (MB) was used as an electrochemical indicator that was intercalated into the aptamer through the specific interaction with its guanine bases. In the presence of DA, the interaction between aptamer and DA displaced the MB from the electrode surface, rendering a lowered electrochemical signal attributed to a decreased amount of adsorbed MB. This phenomenon can be applied for DA detection. The peak current of probe (MB) linearly decreased over a DA concentration range of 1–30 nM with a detection limit of 0.22 nM.     

Isolation of a new ssDNA aptamer against staphylococcal enterotoxin B based on CNBr‐activated sepharose‐4B affinity chromatography

Staphylococcus aureus are potent human pathogens possessing arsenal of virulence factors. Staphylococcal food poisoning (SFP) and respiratory infections mediated by staphylococcal enterotoxin B (SEB) are common clinical manifestations. Many diagnostic techniques are based on serological detection and quantification of SEB in different food and clinical samples. Aptamers are known as new therapeutic and detection tools which are available in different ssDNA, dsDNA and protein structures. In this study, we used a new set of ssDNA aptamers against SEB. The methods used included preparation of a dsDNA library using standard SEB protein as the target analyte, affinity chromatography matrix in microfuge tubes, SELEX procedures to isolate specific ssDNA‐aptamer as an affinity ligand, aptamer purification using ethanol precipitation method, affinity binding assay using ELISA, aptamer cloning and specificity test. Among 12 readable sequences, three of them were selected as the most appropriate aptamer because of their affinity and specificity to SEB. This study presents a new set of ssDNA aptamer with favorable selectivity to SEB through 12 rounds of SELEX. Selected aptamers were used to detect SEB in infected serum samples. Results showed that SEB c1 aptamer (2 µg SEB/100 nM aptamer) had favorable specificity to SEB (k_d = 2.3 × 10^?11). In conclusion, aptamers can be considered as useful tools for detecting and evaluating SEB. The results showed that affinity chromatography was an affordable assay with acceptable accuracy to isolate sensitive and selective novel aptamers. Copyright © 2016 John Wiley & Sons, Ltd.     

Different approaches for the detection of thrombin by an electrochemical aptamer-based assay coupled to magnetic beads

Different assay formats based on the coupling of magnetic beads with electrochemical transduction were compared here for the detection of thrombin by using a thrombin specific aptamer. By using the thrombin-binding aptamer, a direct and an indirect competitive assay for thrombin have been developed by immobilising the aptamer or the protein, respectively. Moreover, another strategy was based on the direct measurement of the enzymatic product of thrombin captured by the immobilised aptamer. All the assays were developed by coupling the electrochemical transduction with the innovative and advantageous use of magnetic beads.

The assays based on the immobilisation of the protein were not successful since no binding was recorded between thrombin and its aptamer. With the direct competitive assay, when the aptamer was immobilised onto the magnetic beads, a detection limit of 430 nM for thrombin was achieved. A lower detection limit for the protein (175 nM) was instead obtained by detecting the product of the enzymatic reaction catalysed by thrombin. All these assays were finally compared with a sandwich assay which reached a detection limit of 0.45 nM of thrombin demonstrating the best analytical performances.

With this comparison the importance of a deep study on the different analytical approaches for thrombin detection to reach the performances of the best assay configuration has been demonstrated.     

Fluorescence detection of adenosine triphosphate through an aptamer-molecular beacon multiple probe

An aptamer-molecular beacon (MB) multiple fluorescent probe for adenosine triphosphate (ATP) assay is proposed in this article. The ATP aptamer was used as a molecular recognition part, and an oligonucleotide (short strand, SS) partially complementary with the aptamer and an MB was used as the other part. In the presence of ATP, the aptamer bound with it, accompanied by the hybridization of MB and SS and the fluorescence recovering. Wherever there is only very weak fluorescence can be measured in the absence of ATP. Based on the relationship of recovering fluorescence and the concentration of ATP, a method for quantifying ATP has been developed. The fluorescence intensity was proportional to the concentration of ATP in the range of 10 to 500 nM with a detection limit of 0.1 nM. Moreover, this method was able to detect ATP with high selectivity in the presence of guanosine triphosphate (GTP), cytidine triphosphate (CTP), and uridine triphosphate (UTP). This method is proved to be simple with high sensitivity, selectivity, and specificity.     

Time-resolved fluorescence biosensor for adenosine detection based on home-made europium complexes

In this protocol, the authors report a time-resolved fluorescence biosensor based on home-made europium complexes for highly sensitive detection of small molecules using adenosine as a model analyte. The fluorophore that used is europium complexes. Its signal can be measured in a time-resolved manner that eliminates most of the unspecific fluorescent background. The amino modified aptamer probe, which is designed to specifically recognize adenosine, is combined to the aldehyde-group modified glass slide by covalent bond. Europium complex-labeled a short ssDNA, designed to segment hybridize with aptamer probe is immobilized on the glass slide by hybridization reaction. In the presence of adenosine, the aptamer part is more inclined to bounds with adenosine and triggers structure-switching of the aptamer from aptamer/ssDNA duplex to aptamer/target complex. As a result, europium complexes-labeled ssDNA is forced to dissociate from the sensor interface, resulting in time-resolved fluorescence intensity decrease. The decrement intensity is proportional to the amount of adenosine. Under optimized assay conditions, a linear range (1.0×10(-8)M to 1.0×10(-7)M) is got with low detection limit of 5.61nM. The biosensor exhibits excellent selectivity and can provide a promising potential for aptamer-based adenosine detection.     

Oligonucleotide probes applied for sensitive enzyme-amplified electrochemical assay of mercury(II) ions

We developed a novel electrochemical sensor for Hg(2+) detection using two mercury-specific oligonucleotide probes and streptavidin-horseradish peroxidase (HRP) enzymatic signal amplification. The two mercury-specific oligonucleotide probes comprised a thiolated capture probe and a biotinated signal probe. The thiolated capture probe was immobilized on a gold electrode. In the presence of Hg(2+), the thymine-Hg(2+)-thymine (T-Hg(2+)-T) interaction between the mismatched T-T base pairs directed the biotinated signal probe hybridizing to the capture probe and yielded a biotin-functioned electrode surface. HRP was then immobilized on the biotin-modified substrate via biotin-streptavidin interaction. The immobilized HRP catalyzed the oxidation of hydroquinone (H(2)Q) to benzoquinone (BQ) by hydrogen peroxide (H(2)O(2)) and the generated BQ was further electrochemically reduced at the modified gold electrode, producing a readout signal for quantitative detection of Hg(2+). The results showed that the enzyme-amplified electrochemical sensor system was highly sensitive to Hg(2+) in the concentration of 0.5 nM to 1 μM with a detection limit of 0.3 nM, and it also demonstrated excellent selectivity against other interferential metal ions.     

Aptamer-mediated inhibition of Mycobacterium tuberculosis polyphosphate kinase 2

Inorganic polyphosphate (polyP) plays a number of critical roles in bacterial persistence, stress, and virulence. PolyP intracellular metabolism is regulated by the polyphosphate kinase (PPK) protein families, and inhibition of PPK activity is a potential approach to disrupting polyP-dependent processes in pathogenic organisms. Here, we biochemically characterized Mycobacterium tuberculosis (MTB) PPK2 and developed DNA-based aptamers that inhibit the enzyme's catalytic activities. MTB PPK2 catalyzed polyP-dependent phosphorylation of ADP to ATP at a rate 838 times higher than the rate of polyP synthesis. Gel filtration chromatography suggested MTB PPK2 to be an octamer. DNA aptamers were isolated against MTB PPK2. Circular dichroism revealed that aptamers grouped into two distinct classes of secondary structure; G-quadruplex and non-G-quadruplex. A selected G-quadruplex aptamer was highly selective for binding to MTB PPK2 with a dissociation constant of 870 nM as determined by isothermal titration calorimetry. The binding between MTB PPK2 and the aptamer was exothermic yet primarily driven by entropy. This G-quadruplex aptamer inhibited MTB PPK2 with an IC(50) of 40 nM and exhibited noncompetitive inhibition kinetics. Mutational mechanistic analysis revealed an aptamer G-quadruplex motif is critical for enzyme inhibition. The aptamer was also tested against Vibrio cholerae PPK2, where it showed an IC(50) of 105 nM and insignificant inhibition against more distantly related Laribacter hongkongensis PPK2.     

Fluorescence protection assay: a novel homogeneous assay platform toward development of aptamer sensors for protein detection

Development of novel aptamer sensor strategies for rapid and selective assays of protein biomarkers plays crucial roles in proteomics and clinical diagnostics. Herein, we have developed a novel aptamer sensor strategy for homogeneous detection of protein targets based on fluorescence protection assay. This strategy is based on our reasoning that interaction of aptamer with its protein target may dramatically increase steric hindrance, which protects the fluorophore, fluorescein isothiocyannate (FITC), labeled at the binding pocket from accessing and quenching by the FITC antibody. The aptamer sensor strategy is demonstrated using a model protein target of immunoglobulin E (IgE), a known biomarker associated with atopic allergic diseases. The results reveal that the aptamer sensor shows substantial (>6-fold) fluorescence enhancement in response to the protein target, thereby verifying the mechanism of fluorescence protection. Moreover, the aptamer sensor displays improved specificity to other co-existing proteins and a desirable dynamic range within the IgE concentration from 0.1 to 50 nM with a readily achieved detection limit of 0.1 nM. Because of great robustness, easy operation and scalability for parallel assays, the developed homogeneous fluorescence protection assay strategy might create a new methodology for developing aptamer sensors in sensitive, selective detection of proteins.     

Ultrasensitive and dual functional colorimetric sensors for mercury (II) ions and hydrogen peroxide based on catalytic reduction property of silver nanoparticles

The method provides an innovative dual functional sensors for mercury (II) ions and hydrogen peroxide. The addition of H(2)O(2) to the mixture of silver nanoparticles (AgNPs) and Hg(2+) induced color changes of the solution within several seconds even at 2.0 nM Hg(2+). Other metallic ions could not induce color change even at 10 μM. Of importance, this probe was not only successfully applied to detect Hg(2+), but also it could be used to sense H(2)O(2) at a concentration as low as 50 nM (by naked-eye). The outstanding sensitivity and selectivity property for Hg(2+) and H(2)O(2) resulted from the AgNPs mediated reduction of Hg(2+) to elementary Hg in the presence of H(2)O(2), causing the aggregation and colorimetric response of AgNPs. This sensitive and selective colorimetric assay opens up a fresh insight of development facile and fast detection methods for metal ions and biomolecules using the special catalytic reactivity of AgNPs.     

Highly sensitive and selective photoelectrochemical DNA sensor for the detection of Hg²⁺ in aqueous solutions

A "turn-on" photoelectrochemical sensor for Hg(2+) detection based on thymine-Hg(2+)-thymine interaction is presented by using a thymine-rich oligonucleotide film and a double-strand DNA intercalator, Ru(bpy)(2)(dppz)(2+) (bpy=2,2'-bipyridine, dppz=dipyrido[3,2-a:2',3'-c]phenazine) as the photocurrent signal reporter. The presence of Hg(2+) induces the formation of a double helical DNA structure which provides binding sites for Ru(bpy)(2)(dppz)(2+). The double helical structure was confirmed by circular dichroism and fluorescence measurements. Under the optimized conditions, a linear relationship between photocurrent and Hg(2+) concentration was obtained over the range of 0.1 nM to 10 nM Hg(2+), with a detection limit of 20 pM. Interference by 10 other metal ions was negligible. Analytical results of Hg(2+) spiked into tap water and lake water by the sensor were in good agreement with mass spectrometry data. With the advantages of high sensitivity and selectivity, simple sensor construction, low instrument cost and low sample volume, this method is potentially suitable for the on-site monitoring of Hg(2+) contamination.     

A versatile graphene-based fluorescence "on/off" switch for multiplex detection of various targets

We have designed a versatile molecular beacon (MB)-like probe for the multiplex sensing of targets such as sequence-specific DNA, protein, metal ions and small molecule compounds based on the self-assembled ssDNA-graphene oxide (ssDNA-GO) architecture. The probe employs fluorescence "on/off" switching strategy in a single step in homogeneous solution. Compared to traditional molecular beacons, the proposed design is simple to prepare and manipulate and has little background interference, but still gives superior sensitivity and rapid response. More importantly, this ssDNA-GO architecture can serve as a universal beacon platform by simply changing the types of ssDNA sequences for the different targets. In this work, the ssDNA-GO architecture probe has been successfully applied in the multiplex detection of sequence-specific DNA, thrombin, Ag(+), Hg(2+) and cysteine, and the limit of detection was 1 nM, 5 nM, 20 nM, 5.7 nM and 60 nM, respectively. The results demonstrate that the ssDNA-GO architecture can be an excellent and versatile platform for sensing multiplex analytes, easily replacing the universal molecular beacon.     

Ultrasensitive and selective detection of copper (II) and mercury (II) ions by dye-coded silver nanoparticle-based SERS probes

A simple and distinctive method for the ultrasensitive detection of Cu(2+) and Hg(2+) based on surface-enhanced Raman scattering (SERS) using cysteine-functionalized silver nanoparticles (AgNPs) attached with Raman-labeling molecules was developed. The glycine residue in a silver nanoparticle-bound cysteine can selectively bind with Cu(2+) and Hg(2+) and form a stable inner complex. Silver nanoparticles co-functionalized with cysteine and 3,5-Dimethoxy-4-(6'-azobenzotriazolyl)phenol (AgNP conjugates) can be used to detect Cu(2+) and Hg(2+) based on aggregation-induced SERS of the Raman tags. The addition of SCN(-) to the analyte can successfully mask Hg(2+) and allow for the selective detection of Cu(2+). This SERS-based assay showed an unprecedented limit of detection (LOD) of 10pM for Cu(2+) and 1pM for Hg(2+); these LODs are a few orders of magnitude more sensitive than the typical colorimetric approach based on the aggregation of noble nanoparticles. The analysis of real water samples diluted with pure water was performed and verified this conclusion. We envisage that this SERS-based assay may provide a general and simple approach for the detection of other metal ions of interest, which can be adopted from their corresponding colorimetric assays that have already been developed with significantly improved sensitivity and thus have wide-range applications in many areas.     

A signal-on electrochemiluminescence aptamer biosensor for the detection of ultratrace thrombin based on junction-probe

A novel signal-on junction-probe electrogenerated chemiluminescence (ECL) aptamer biosensor has been developed for the detection of ultratrace thrombin based on a structure-switching ECL-quenching mechanism. The ECL aptamer biosensor comprises two main parts: an ECL substrate and an ECL intensity switch. The ECL substrate was made by modifying the complex of Au nanoparticle and ruthenium (II) tris-bipyridine (Ru(bpy)(3)(2+)-AuNPs) on the surface of gold electrode (GE), and the ECL intensity switch contains three probes designed according to the "junction-probe" strategy. The first probe is capture probe (Cp) which was functionalized with a thiol group at one end and covalently attached to Ru(bpy)(3)(2+)-AuNPs modified GE through S-Au bonding. The second probe is aptamer probe (Ap), which containing 15-base anti-thrombin DNA aptamer. The third one is ferrocene-labeled probe (Fp), which was functionalized with ferrocene tag at one end. We demonstrated that, in the absence of thrombin, Cp, Ap and Fp will hybridize to form a ternary "Y" junction structure and resulted in a quenching of ECL of Ru(bpy)(3)(2+). Whereas, in the presence of thrombin, the Ap prefers to form the G-quadruplex aptamer-thrombin complex and lead to an obvious recovery of ECL of Ru(bpy)(3)(2+), which provided a sensing platform for the detection of thrombin. Using this reusable sensing platform, a simple, rapid and selective signal-on ECL aptamer biosensor for the detection of thrombin with a detection limit of 8.0×10(-15) M has been developed. The success in the present biosensor served as a significant step towards the development of monitoring ultratrace thrombin in clinical detection.     

Target-induced structure-switching DNA hairpins for sensitive electrochemical monitoring of mercury (II)

A simple, sensitive and reusable electrochemical sensor was designed for determination of mercury (II) (Hg(2+)) by coupling target-induced conformational switch of DNA hairpins with thymine-Hg(2+)-thymine (T-Hg(2+)-T) coordination chemistry. The hairpin probe consisted of a stem of 6 base pairs enclosing a 14 nucleotide (nt) loop and an additional 12 nt sticky end at the 3' end. Each hairpin was labeled with ferrocene (Fc) redox tag in the middle of the loop, which was immobilized on the electrode via self-assembly of the terminal thiol moiety at the 5' end. In the presence of target analyte, Hg(2+)-mediated base pairs induced the conformational change from the sticky end to open the hairpins, resulting in the ferrocene tags close to the electrode for the increasing redox current. The strong coordination reaction of T-Hg(2+)-T resulted in a good repeatability and intermediate precision down to 10%. The dynamic concentration range spanned from 5.0nM to 1.0μM Hg(2+) with a detection limit of 2.5nM at the 3s(blank) level. The strategy afforded exquisite selectivity for Hg(2+) against other environmentally related metal ions. Inspiringly, the developed sensor could be reused by introduction of iodide (I(-)).     

A highly sensitive and selective optical sensor for Pb(2+) by using conjugated polymers and label-free oligonucleotides

The detection of Pb(2+) with DNA-based biosensor is usually susceptible to severe interference from Hg(2+) because of the T-Hg(2+)-T interaction between Hg(2+) and T residues. In this study, we developed a rapid, sensitive, selective and label-free sensor for the detection of Pb(2+) in the presence of Hg(2+) based on the Pb(2+)-induced G-quadruplex formation with cationic water-soluble conjugated polymer (PMNT) as a "polymeric stain" to transduce optical signal. We selected a specific sequence oligonucleotide, TBAA (5'-GGAAGGTGTGGAAGG-3'), which can form a G-quadruplex structure upon the addition of Pb(2+). This strategy provided a promising alternative to Pb(2+) determination in the presence of Hg(2+) instead of the universal masking agents of Hg(2+) (such as CN(-), SCN(-)). Based on this observation, a simple "mix-and-detect" optical sensor for the detection of Pb(2+) was proposed due to the distinguishable optical properties of PMNT-ssDNA and PMNT-(G-quadruplex) complexes. By this method, we could identify micromolar Pb(2+) concentrations within 5min even with the naked eye. Furthermore, the detection limit was improved to the nanomolar range by the fluorometric method. We also successfully utilized this biosensor for the determination of Pb(2+) in tap water samples.