Cloning of the vaccinia virus telomere in a yeast plasmid vector

The vaccinia virus DNA telomere, which contains a covalently closed hairpin structure, has been cloned in a yeast plasmid vector. Restriction mapping indicates that the cloned vaccinia telomere is maintained in yeast not in its native hairpin configuration but as an inverted repeat structure, within a circular plasmid, with the sequences of the viral hairpin now at the axis of symmetry of an imperfect palindrome. As such, the cloned telomere resembles the telomeric replicative intermediate observed during vaccinia virus DNA replication. Small deletions and duplications in the viral inverted repeats of different clones suggest a model in which the observed circular plasmids were generated in yeast by the replication of hybrid linear DNA molecules consisting of the linearized yeast vector flanked by two hairpin-containing vaccinia termini.     

Nucleotide sequence required for resolution of the concatemer junction of vaccinia virus DNA.

The mature form of the vaccinia virus genome consists of a linear, 185,000-base-pair (bp) DNA molecule with a 10,000-bp inverted terminal repetition and incompletely base-paired 104-nucleotide hairpin loops connecting the two strands at each end. In concatemeric forms of intracellular vaccinia virus DNA, the inverted terminal repetitions of adjacent genomes form an imperfect palindrome. The apex of this palindrome corresponds in sequence to the double-stranded form of the hairpin loop. Circular plasmids containing palindromic concatemer junction fragments of 250 bp or longer are converted into linear minichromosomes with hairpin ends when they are transfected into vaccinia virus-infected cells, providing a model system with which to study the resolution process. To distinguish between sequence-specific and structural requirements for resolution, plasmids with symmetrical insertions, deletions, and oligonucleotide-directed mutations within the concatemer junction were constructed. A sequence (ATTTAGTGTCTAGAAAAAAA) located on both sides of the apex segment was found to be critical for resolution. Resolution was more efficient when additional nucleotides, TGTG, followed the run of A residues. Both the location and sequence of the proposed resolution signal are highly conserved among poxviruses.     

Molecular cloning and sequence of the concatemer junction from vaccinia virus replicative DNA. Viral nuclease cleavage sites in cruciform structures

The concatemer junction from replicative forms of vaccinia virus DNA was cloned into plasmid vectors and shown to be a precise duplex copy of the viral terminal hairpin structure, with each strand corresponding to one of the alternative sequence isomers. The plasmids were relaxed circles with extruded cruciforms representing two copies of the vaccinia telomere hairpin structure. Head-to-head dimers containing two copies of the vaccinia virus concatemer junction were observed to contain only one set of stem-loop structures per molecule, suggesting that the initial formation of a small cruciform, and not branch migration, was the rate-limiting step in cruciform formation. The plasmids containing the concatemer junction were converted into nicked circular, linear and cross-linked linear molecules by a nuclease isolated from vaccinia virions. The region-specific cleavage near the border of the hairpin loop and the formation of DNA cross-links in some of the molecules is consistent with the nuclease acting as a nicking-closing enzyme that participates in the resolution of mature termini from replicative concatemer intermediates.     

Replication and resolution of cloned poxvirus telomeres in vivo generates linear minichromosomes with intact viral hairpin termini.

The covalently closed terminal hairpins of the linear duplex-DNA genomes of the orthopoxvirus vaccinia and the leporipoxvirus Shope fibroma virus (SFV) have been cloned as imperfect palindromes within circular plasmids in yeast cells and recombination-deficient Escherichia coli. The viral telomeres inserted within these recombinant plasmids are equivalent to the inverted-repeat structures detected as telomeric replicative intermediates during poxvirus replication in vivo. Although the telomeres of vaccinia and SFV show little sequence homology, the termini from both viral genomes exist as AT-rich terminal hairpins with extrahelical bases and alternate "flip-flop" configurations. Using an in vivo replication assay in which circular plasmid DNA was transfected into poxvirus-infected cells, we demonstrated the efficient replication and resolution of the cloned imperfect palindromes to bona fide hairpin termini. The resulting linear minichromosomes, which were readily purified from transfected cells, were shown by restriction enzyme mapping and by electron microscopy to have intact covalently closed hairpin termini at both ends. In addition, staggered unidirectional deletion derivatives of both the cloned vaccinia and SFV telomeric palindromes localized an approximately 200-base-pair DNA region in which the sequence organization was highly conserved and which was necessary for the resolution event. These data suggest a conserved mechanism of the resolution of poxvirus telomeres.     

Resolution of linear minichromosomes with hairpin ends from circular plasmids containing vaccinia virus concatemer junctions

The junctions, separating unit-length genomes in intracellular concatemeric forms of vaccinia virus DNA, are duplex copies of the hairpin loops that form the ends of mature DNA molecules present in infectious virus particles. Circular E. coli plasmids with palindromic junction fragments were replicated in vaccinia virus-infected cells and resolved into linear minichromosomes with vector DNA in the center and vaccinia virus DNA hairpins at the two ends. Resolution did not occur when the concatemer joint was less than 250 bp or when plasmids were transfected into uninfected cells, indicating requirements for a specific DNA structure and viral trans-acting factors. These studies indicate that concatemers can serve as replicative intermediates and account for the generation of flip-flop sequence variation of the hairpins at the ends of the mature vaccinia virus genome.     

Asymmetric resolution of a parvovirus palindrome in vitro.

Cell extracts from murine A9 or human HeLa cells containing wild-type copies the NS1 polypeptide of minute virus of mice (MVM), produced from a recombinant vaccinia virus, can support the resolution of viral 3' termini from palindromic junction fragments of dimeric, replicative-form MVM DNA. Resolution resulted in the generation of two new viral termini, one associated with each arm of the junction palindrome. Telomeres were created in two configurations, "extended" forms, which were covalently associated with NS1 molecules, and smaller "turn-around" forms in which a single arm of the palindrome terminated at the axis of dyad symmetry in a covalent bond which cross-linked the two strands. The in vitro resolution reaction was asymmetric, generating predominantly extended-form termini from one arm of the palindrome but predominantly turn-around forms from the other. This asymmetry was independent of the type of cell used to prepare the in vitro extract or the orientation of the palindrome in the plasmid and was obtained for all cloned junction sequences of 156 bp or more. Two modified forms of the duplex junction fragment, which appeared to be intermediates in the resolution process since they were nicked, covalently linked to NS1, and associated with newly synthesized DNA, were identified. The structures of these intermediates suggest that resolution is initiated by preferential nicking at one of the two candidate resolution sites. The asymmetric nature of this resolution reaction is discussed in terms of current models of MVM DNA replication.     

A vaccinia virus DNase preparation which cross-links superhelical DNA.

Multiple DNA-dependent enzyme activities have been detected in highly purified preparations of a single-strand-specific nuclease from vaccinia virus. These enzyme preparations were extensively purified and characterized by using superhelical DNAs as substrates. In particular, the nuclease activity was monitored by the extent of conversion of supercoiled closed duplex DNA (DNA I) to nicked circular DNA (DNA II), which could subsequently be converted to duplex linear DNA (DNA III) by prolonged incubation with the enzyme. DNA species which were not substrates for the enzyme included relaxed closed duplex DNA, DNA II which had been prepared by nuclease S1 treatment or by photochemical nicking of DNA I, and DNA III. With plasmid pSM1 DNA as substrate, the extent of cleavage of DNA I to DNA II was found to increase with superhelix density above a threshold value of about -0.06. The linear reaction products were examined by gel electrophoresis after restriction enzyme digestion of the DNAs from plasmids pSM1 and pBR322 and of the viral DNAs from bacteriophage phi X174 (replicative form) and simian virus 40, and the map coordinate locations of the scissions were determined. These products were further examined by electron microscopy and by gel electrophoresis under denaturing conditions. Electron micrographs taken under partially denaturing conditions revealed molecules with terminal loops or hairpins such as would result from the introduction of cross-links at the cutting sites. These species exhibited snapback renaturation. The denaturing gel electrophoresis experiments revealed the appearance of new bands at locations consistent with terminal cross-linking. With pSM1 and pBR322 DNAs, this band was shown to contain DNA that was approximately twice the length of a linear single strand. The terminal regions of the cross-linked linear duplex reaction products were sensitive to nuclease S1 but insensitive to proteinase K, suggesting that the structure is a hairpin loop not maintained by a protein linker. A similar structure is found in mature vaccinia virus DNA.     

Characterization and localization of the naturally occurring cross-links in vaccinia virus DNA

The vaccinia virus genome is a single, linear, duplex DNA molecule whose complementary strands are naturally cross-linked. The molecular weight has been determined by contour length measurements from electron micrographs to be 122 ± 2.2 × 10⁶. Denaturation mapping techniques indicate that the nucleotide sequence arrangement of the DNA is unique. Two forms of cross-linked vaccinia DNA were observed in alkaline sucrose gradients. The relative S-values of the two cross-linked species were appropriate for a single-stranded circle and a linear single strand, each with a molecular weight twice that expected for an intact, linear, complementary strand of vaccinia DNA. The fraction of sheared vaccinia DNA able to “snap back” after denaturation suggested a minimum of two crosslinks per molecule. Full-length single-stranded circles were observed in the electron microscope after denaturation of vaccinia DNA. Partial denaturation produced single-stranded loops at the ends of all full-length molecules. Exposure of native vaccinia DNA to a single strand-specific endonuclease isolated from vaccinia virions caused disruption of the cross-links, as assayed by alkaline sedimentation, and produced free single-strand ends when partially denatured DNA was observed in the electron microscope. We conclude that vaccinia DNA contains two cross-links, one at or near (within 50 nucleotides) each end in a region of single-stranded DNA. Two models for the cross-links are presented.     

PY54, a linear plasmid prophage of Yersinia enterocolitica with covalently closed ends

PY54 is a temperate phage isolated from Yersinia enterocolitica. Lysogenic Yersinia strains harbour the PY54 prophage as a plasmid (pY54). The plasmid has the same size (46 kb) as the PY54 genome isolated from phage particles. By electron microscopy, restriction analysis and DNA sequencing, it was demonstrated that the phage and the plasmid DNAs are linear, circularly permuted molecules. Unusually for phages of Gram-negative bacteria, the phage genome has 3'-protruding ends. The linear plasmid pY54 has covalently closed ends forming telomere-like hairpins. The equivalent DNA sequence of the phage genome is a 42 bp perfect palindrome. Downstream from the palindrome, an open reading frame (ORF) was identified that revealed strong DNA homology to the telN gene of Escherichia coli phage N15 encoding a protelomerase. Similar to PY54, the N15 prophage is a linear plasmid with telomeres. The N15 protelomerase has cleaving/joining activity generating the telomeres by processing a 56 bp palindrome (telomere resolution site tel RL). To study the activity of the PY54 protein, the telN-like gene was cloned and expressed in E. coli. A 77 kDa protein was obtained and partially purified. The protein was found to process recombinant plasmids containing the 42 bp palindrome. Telomere resolution of plasmids under in vivo conditions was also investigated in Yersinia infected with PY54. Processing required a plasmid containing the palindrome as well as adjacent DNA sequences from the phage including an additional inverted repeat. Regions on the phage genome important for plasmid maintenance were defined by the construction of linear and circular miniplasmid derivatives of pY54, of which the smallest miniplasmid comprises a 4.5 kb DNA fragment of the plasmid prophage.     

Construction of an infectious molecular clone of the autonomous parvovirus minute virus of mice.

The linear single-stranded DNA genome of minute virus of mice, an autonomous parvovirus, was cloned in duplex form into the bacterial plasmid pBR322. The recombinant clones of minute virus of mice were infectious when transfected into monolayers of human 324K cells and produced virus plaques with an efficiency of about 6% that obtained with duplex replicative-form DNA purified from cells infected with minute virus of mice. Southern blot analysis of transfected cells indicated that the cloned minute virus of mice genome requires both termini to be intact for excision and replication as a linear duplex molecule.     

Vaccinia virus telomeres: interaction with the viral I1, I6, and K4 proteins

The 192-kb linear DNA genome of vaccinia virus has covalently closed hairpin termini that are extremely AT rich and contain 12 extrahelical bases. Vaccinia virus telomeres have previously been implicated in the initiation of viral genome replication; therefore, we sought to determine whether the telomeres form specific protein-DNA complexes. Using an electrophoretic mobility shift assay, we found that extracts prepared from virions and from the cytoplasm of infected cells contain telomere binding activity. Four shifted complexes were detected using hairpin probes representing the viral termini, two of which represent an interaction with the "flip" isoform and two with the "flop" isoform. All of the specificity for protein binding lies within the terminal 65-bp hairpin sequence. Viral hairpins lacking extrahelical bases cannot form the shifted complexes, suggesting that DNA structure is crucial for complex formation. Using an affinity purification protocol, we purified the proteins responsible for hairpin-protein complex formation. The vaccinia virus I1 protein was identified as being necessary and sufficient for the formation of the upper doublet of shifted complexes, and the vaccinia virus I6 protein was shown to form the lower doublet of shifted complexes. Competition and challenge experiments confirmed that the previously uncharacterized I6 protein binds tightly and with great specificity to the hairpin form of the viral telomeric sequence. Incubation of viral hairpins with extracts from infected cells also generates a smaller DNA fragment that is likely to reflect specific nicking at the apex of the hairpin; we show that the vaccinia virus K4 protein is necessary and sufficient for this reaction. We hypothesize that these telomere binding proteins may play a role in the initiation of vaccinia virus genome replication and/or genome encapsidation.     

A novel deletion found during cloning of a synthetic palindromic DNA

A 212-bp palindromic DNA comprising two copies of the left end of bacteriophage Mu was assembled from chemically synthesized oligonucleotides and inserted into plasmid pUC9. When cloned and propagated in Escherichia coli, the palindrome was found to be unstable and was generally lost. However, in a few cases, a precise, asymmetric deletion of one half of the insert was observed. This pattern of deletion suggests that the symmetry axis region of the palindrome was involved as recognition site in the deletion process.     

Extrusion of an imperfect palindrome to a cruciform in superhelical DNA: complete determination of energetics using a statistical mechanical model

We present a detailed study of the extrusion of an imperfect palindrome, derived from the terminal regions of vaccinia virus DNA and contained in a superhelical plasmid, into a cruciform containing bulged bases. We monitor the course of extrusion by two-dimensional gel electrophoresis experiments as a function of temperature and linking number. We find that extrusion pauses at partially extruded states as negative superhelicity increases. To understand the course of extrusion with changes in linking number, DeltaLk, we present a rigorous semiempirical statistical mechanical analysis that includes complete coupling between DeltaLk, cruciform extrusion, formation of extrahelical bases, and temperature-dependent denaturation. The imperfections in the palindrome are sequentially incorporated into the cruciform arms as hairpin loops, single unpaired bases, and complex local regions containing several unpaired bases. We analyze the results to determine the free energies, enthalpies and entropies of formation of all local structures involved in extrusion. We find that, for each unpaired structure, the DeltaG, DeltaH and DeltaS of formation are all approximately proportional to the number of unpaired bases contained therein. This surprising result holds regardless of the arrangement or composition of unpaired bases within a particular structure. Imperfections have major effects on the overall energetics of cruciform extrusion and on the course of this transition. In particular, the extent of the DeltaLk change necessary to extrude an imperfect palindrome is considerably greater than that required for extrusion of the underlying perfect palindrome. Our analysis also suggests that, at higher temperatures, significant denaturation at the base of an imperfect cruciform can successfully compete with extension of the cruciform arms.     

Expression of an enhancer-binding protein in insect cells transfected with the Autographa californica nuclear polyhedrosis virus IE1 gene.

The baculovirus Autographa californica nuclear polyhedrosis virus contains an element known as homologous region 5 (hr5) which is an enhancer of delayed-early viral gene expression. To begin to identify proteins that interact with hr5, DNA-protein interactions were analyzed by using extracts from Spodoptera frugiperda cells and a fragment of DNA containing the left half of the hr5 enhancer. This 252-bp DNA fragment contains two copies of a 30-bp direct repeat (DR30) and two copies of a 24-bp imperfect palindrome contained within a 60-bp direct repeat (DR60). Extracts prepared from normal S. frugiperda cells and cells transfected with pUC8 lacked enhancer-binding proteins. However, when gel shift assays were performed with extracts from cells transfected with a plasmid containing the viral trans-activator IE1 gene, two DNA-protein complexes were formed. Both DNA-protein complexes were specifically inhibited by competition with a 60-bp oligonucleotide corresponding to DR60 but not by competition with a different oligonucleotide corresponding to DR30. Formation of the two complexes did not appear to involve cooperative interactions between binding proteins. When DR60 was used as a probe, a single complex was formed. To measure the enhancer activity of DR60, a reporter plasmid was constructed that contained DR60 cloned upstream of the reporter chloramphenicol acetyltransferase gene under the control of the delayed-early 39K promoter. Transient expression analysis indicated that the oligonucleotide increased expression of this gene 300-fold over the level obtained in the absence of any enhancer sequences.     

The mismatched nucleotides encoded in vaccinia virus flip-and-flop hairpin telomeres serve an essential role in virion maturation

Poxvirus genomes consist of a linear duplex DNA that ends in short inverted and complementary hairpin structures. These elements also encode loops and mismatches that likely serve a role in genome packaging and perhaps replication. We constructed mutant vaccinia viruses (VACV) where the native hairpins were replaced by altered forms and tested effects on replication, assembly, and virulence. Our studies showed that structure, not sequence, likely determines function as one can replace an Orthopoxvirus (VACV) hairpin with one copied from a Leporipoxvirus with no effect on growth. Some loops can be deleted from VACV hairpins with little effect, but VACV bearing too few mismatches grew poorly and we couldn’t recover viruses lacking all mismatches. Further studies were conducted using a mutant bearing only one of six mismatches found in wild-type hairpins (SΔ1Δ3–6). This virus grew to ~20-fold lower titers, but neither DNA synthesis nor telomere resolution was affected. However, the mutant exhibited a particle-to-PFU ratio 10-20-fold higher than wild-type viruses and p4b/4b core protein processing was compromised, indicating an assembly defect. Electron microscopy showed that SΔ1Δ3–6 mutant development was blocked at the immature virus (IV) stage, which phenocopies known effects of I1L mutants. Competitive DNA binding assays showed that recombinant I1 protein had less affinity for the SΔ1Δ3–6 hairpin than the wild-type hairpin. The SΔ1Δ3–6 mutant was also attenuated when administered to SCID-NCR mice by tail scarification. Mice inoculated with viruses bearing wild-type hairpins exhibited a median survival of 30–37 days, while mice infected with SΔ1Δ3–6 virus survived >70 days. Persistent infections favor genetic reversion and genome sequencing detected one example where a small duplication near the hairpin tip likely created a new loop. These observations show that mismatches serve a critical role in genome packaging and provide new insights into how VACV “flip and flop” telomeres are arranged.     

A 67-base-pair segment from the Ori-S region of herpes simplex virus type 1 encodes origin function.

The Ori-S segment of herpes simplex virus type 1 contains a 45-base-pair-long imperfect palindrome with an AT segment at its center. We cloned Ori-S into a poisonless plasmid to investigate the role of the palindromic components in DNA replication. Neither a large insertion within the AT segment nor a deletion of the right side of the palindrome significantly inhibited DNA replication under our conditions of analysis. These findings argue against the necessity for a specific cruciform structure in the initiation of replication. We scanned the entire AT segment with triple tandem-base-pair substitutions to pinpoint essential functional sequences. Only the first 3 base pairs at the left end of the segment are absolutely essential for replication in the presence of the remaining AT sequences.     

Shope fibroma virus DNA topoisomerase catalyses holliday junction resolution and hairpin formation in vitro

The telomeres of poxviral chromosomes comprise covalently closed hairpin structures bearing mismatched bases. These hairpins are formed as concatemeric replication intermediates and are processed into mature, unit-length genomes. The structural transitions and enzymes involved in telomere resolution are poorly understood. Here we show that the type I topoisomerase of Shope fibroma virus (SFV) can promote a recombination reaction which converts cloned SFV replication intermediates into hairpin-ended molecules resembling mature poxviral telomeres. Recombinant SFV topoisomerase linearised a palindromic plasmid bearing 1.5 kb of DNA encoding the SFV concatemer junction, at a site near the centre of inverted-repeat symmetry. Most of these linear reaction products bore hairpin tips as judged by denaturing gel electrophoresis. The resolution reaction required palindromic SFV DNA sequences and was inhibited by compounds which block branch migration (MgCl2) or poxviral topoisomerases. The resolution reaction was also slow, needed substantial quantities of topoisomerase, and required that the palindrome be extruded in a cruciform configuration. DNA cleavage experiments identified a pair of suitably oriented topoisomerase recognition sites, 90 bases from the centre of the cloned SFV terminal inverted repeat, which may mark the resolution site. These data suggest a resolution scheme in which branch migration of a Holliday junction through a site occupied by covalently bound topoisomerase molecules, could lead to telomere resolution.     

Incompletely base-paired flip-flop terminal loops link the two DNA strands of the vaccinia virus genome into one uninterrupted polynucleotide chain

The nature of the ends of the vaccinia virus genome was determined by nucleotide sequencing. Our finding of terminal hairpins indicated that the linear double-stranded DNA molecule consists of a single continuous polynucleotide chain. The 104 nucleotide apex of the hairpin contains predominantly A and T residues and is incompletely base-paired. These loops exist in two forms, which when inverted with respect to each other are complementary in sequence. Both forms of the 104 nucleotide loop are present in nearly equimolar amounts at each end of the genome. A set of 13 tandem 70 bp repeats begins 87 bp from the proximal segment of the terminal loop, followed by a unique sequence of 325 bp, and then by a second set of 18 tandem 70 bp repeats. The sequence of the 70 bp repeats reveals a 13 bp internal redundancy. Self-priming and de novo start replication models, which involve a site-specific nick in one DNA strand proximal to the 104 nucleotide loop, account for the observed sequence inversions and incomplete base-pairing. Similar mechanisms may be involved in replication of the ends of the eucaryotic chromosome.     

Two spatially distinct genetic elements constitute a bipartite DNA replication origin in the minute virus of mice genome.

Mutations were introduced into plasmid pMM984, a full-length infectious clone of the fibrotropic strain of minute virus of mice, to identify cis-acting genetic elements required for the excision and replication of the viral genome. The replicative capacity of these mutants was measured directly, using an in vivo transient DNA replication assay following transfection of plasmids into murine A9 cells and primate COS-7 cells. Experiments with subgenomic constructs indicated that both viral termini must be present on the same DNA molecule for replication to occur and that the viral nonstructural protein NS-1 must be provided in trans. The necessary sequences were located within 1,084 and 807 nucleotides of the 3' and 5' ends of the minute virus of mice genome, respectively. The inhibitory effect of deletions within the 206-bp 5'-terminal palindrome demonstrated that these sequences comprise a cis-acting genetic element that is absolutely essential for the excision and replication of viral DNA. The results further indicated a requirement for a stem-plus-arms T structure as well as for the formation of a simple hairpin. In addition, the removal of one copy of a tandemly arranged 65-bp repeat found 94 nucleotides inboard of the 5'-terminal palindrome inhibited viral DNA replication in cis by 10- and just greater than 100-fold in A9 and COS-7 cells, respectively. The latter results define a novel genetic element within the 65-bp repeated sequence, distinct from the terminal palindrome, that is capable of regulating minute virus of mice DNA replication in a species-specific manner.