Binding of IKe gene 5 protein to polynucleotides. Fluorescence binding experiments of IKe gene 5 protein and mutual cooperativity of IKe and M13 gene 5 proteins

Fluorescence studies of the binding of IKe gene 5 protein to various polynucleotides were performed to obtain insight into the question as to what extent the binding characteristics of the gene 5 proteins of the IKe and M13 phages resemble and/or differ from each other. The fluorescence of IKe gene 5 protein is quenched 60% upon binding to most polynucleotides. At moderate salt concentrations, i.e., below 1 M salt, the binding stoichiometry is 4.0 +/- 0.5 nucleotides per IKe gene 5 protein monomer. The affinity of the protein for homopolynucleotides depends strongly on sugar and base type; in order of increasing affinities we find poly(rC) less than poly(dA) less than poly(rA) less than poly(dI) less than poly(rU) less than poly(dU) less than poly(dT). For most polynucleotides studied, the affinity depends linearly on the salt concentration: [d log (Kint omega)]/(d log [M+]) = -3. The binding is highly cooperative. The cooperativity parameter omega, as deduced from protein titration curves, is 300 +/- 150 and appears independent of the type of polynucleotide studied. Estimation of this binding parameter from salt titrations of gene 5 protein-polynucleotide complexes results in systematically higher values. A comparison of the binding data of the IKe and M13 gene 5 proteins shows that the fluorescence quenching, stoichiometry, order of binding affinities, and cooperativity in the binding are similar for both proteins. From this it is concluded that at least the DNA binding grooves of both proteins must show a close resemblance.(ABSTRACT TRUNCATED AT 250 WORDS)     

Looped oligonucleotides form stable hybrid complexes with a single-stranded DNA.

Several new branched (1, 2), circular (9) and looped oligonucleotides (14-17) were synthesized. 3'-Deoxypsicothymidine was employed to create the site of branching when required. The circular and looped structures were obtained by oxidative disulfide bond formation between mercaptoalkyl tether groups. All the oligonucleotides prepared contained two T11 sequences, and the branched and looped oligomers an additional alternating CT sequence. The melting experiments revealed that the branched oligonucleotides form relatively weak hybrid (double/triple helix) complexes with the single-stranded oligodeoxyribonucleotide, showing a considerable destabilizing effect produced by the structure at the point of branching. The data obtained with looped oligonucleotides demonstrated considerable stabilization of the hybrid (double/triple helix) complexes with the complement. The data reported may be useful in attempting to design new antisense or antigene oligonucleotides capable of forming selective and stable bimolecular hybrid complexes with nucleic acids.     

CD measurements show that fd and IKe gene 5 proteins undergo minimal conformational changes upon binding to poly(rA)

Circular dichroism (CD) measurements were made on both fd and IKe gene 5 proteins in solution. The difference between the CD spectra of these two proteins was interpreted as being the result of an enhanced tyrosine contribution in the IKe gene 5 protein spectrum. There was no spectral evidence for significant alpha-helical structures in either of the two gene 5 proteins. CD measurements were also made on complexes of the two gene 5 proteins with poly(rA). The long-wavelength region (300-250 nm) of the CD spectra of both complexes was essentially like that of free poly(rA) at a high temperature. With the assumption that the poly(rA) components of the complexes had the same CD at all wavelengths as did free poly(rA) at a high temperature, it was possible to separate the CD spectra of the complexes into protein and nucleic acid components. Except for the tyrosine CD band at 229 nm, there were no significant changes in the CD bands of either protein upon binding to poly(rA). Thus, each protein appeared to maintain essentially the same overall secondary conformation when complexed with poly(rA) as when in its free state.     

Ff gene 5 single-stranded DNA-binding protein assembles on nucleotides constrained by a DNA hairpin

The gene 5 protein (g5p) encoded by filamentous Ff phages is an ssDNA-binding protein, which binds to and sequesters the nascent ssDNA phage genome in the process of phage morphogenesis. The g5p also binds with high affinity to DNA and RNA sequences that form G-quadruplex structures. However, sequences that would form G-quadruplexes are absent in single copies of the phage genome. Using SELEX (systematic evolution of ligands by exponential enrichment), we have now identified a family of DNA hairpin structures to which g5p binds with high affinity. After eight rounds of selection from a library of 58-mers, 26 of 35 sequences of this family contained two regions of complete or partial complementarity. This family of DNA hairpins is represented by the sequence: 5'-d(CGGGATCCAACGTTTTCACCAGATCTACCTCCTCGGGATCCCAAGAGGCAGAATTCGC)-3' (named U-4), where complementary regions are italicized or underlined. Diethyl pyrocarbonate modification, UV-melting profiles, and BamH I digestion experiments revealed that the italicized sequences form an intramolecular hairpin, and the underlined sequences form intermolecular base pairs so that a dimer exists at higher oligomer concentrations. Gel shift assays and end boundary experiments demonstrated that g5p assembles on the hairpin of U-4 to give a discrete, intermediate complex prior to saturation of the oligomer at high g5p concentrations. Thus, biologically relevant sequences at which g5p initiates assembly might be typified better by DNA hairpins than by G-quadruplexes. Moreover, the finding that hairpins of U-4 can dimerize emphasizes the unexpected nature of sequence-dependent structures that can be recognized by the g5p ssDNA-binding protein.     

Flexibility of A.T pairs in left-handed DNA helices

We have analysed by various approaches the structure of cloned synthetic sequences in supercoiled plasmids. Individual inserts were formed by d(C-G)n blocks interrupted by the presence of A.T pairs positioned either in phase or out of phase of pur-pyr alternation. Based on the thermodynamic analysis we obtained results confirming that A.T pairs are easily incorporated into left-handed helices without significant energetic penalty. Sequences GTAC which are known to form cruciform structures in multiple repetition underwent a B-Z transition. In the case of plasmids containing AA/TT code words and substantial discontinuities in purine-pyrimidine alternation our analysis indicates that Z-Z junctions formed by A.T pairs contributed little to the overall energetic demands of the B-Z transition probably thanks to their high conformational flexibility.     

The process of displacing the single-stranded DNA-binding protein from single-stranded DNA by RecO and RecR proteins

The regions of single-stranded (ss) DNA that result from DNA damage are immediately coated by the ssDNA-binding protein (SSB). RecF pathway proteins facilitate the displacement of SSB from ssDNA, allowing the RecA protein to form protein filaments on the ssDNA region, which facilitates the process of recombinational DNA repair. In this study, we examined the mechanism of SSB displacement from ssDNA using purified Thermus thermophilus RecF pathway proteins. To date, RecO and RecR are thought to act as the RecOR complex. However, our results indicate that RecO and RecR have distinct functions. We found that RecR binds both RecF and RecO, and that RecO binds RecR, SSB and ssDNA. The electron microscopic studies indicated that SSB is displaced from ssDNA by RecO. In addition, pull-down assays indicated that the displaced SSB still remains indirectly attached to ssDNA through its interaction with RecO in the RecO-ssDNA complex. In the presence of both SSB and RecO, the ssDNA-dependent ATPase activity of RecA was inhibited, but was restored by the addition of RecR. Interestingly, the interaction of RecR with RecO affected the ssDNA-binding properties of RecO. These results suggest a model of SSB displacement from the ssDNA by RecF pathway proteins.     

Two-dimensional 1H nuclear magnetic resonance studies on the gene V-encoded single-stranded DNA-binding protein of the filamentous bacteriophage IKe. I. Structure elucidation of the DNA-binding wing

Two-dimensional nuclear magnetic resonance techniques were used to obtain residue- and sequence-specific assignments in the 1H spectrum of the single-stranded DNA-binding protein encoded by gene V of the filamentous phage IKe (IKe GVP). The residue-specific assignments are based on the analysis of J-correlated spectra, i.e. correlated spectroscopy and homonuclear-Hartmann-Hahn total correlated spectroscopy. Complete assignments of side-chain spin systems, e.g. long side-chains, were, to a major part, derived from two-dimensional spectra obtained by means of the latter technique. Sequence-specific residue assignments were obtained for the two neighbouring residues V41 and Y42, and the amino acid sequence segment encompassing residues S17 through I29. The structure of this segment, a beta-loop, was deduced from the interresidue nuclear Overhauser effect pattern. Residues S17 through V19 and P26 through I29 form an anti-parallel beta-ladder segment, whereas residues Q21 to K25 constitute the loop region. The beta-loop is expected to project into the solution and is intimately involved in binding to single-stranded DNA; it is therefore designated the "DNA-binding wing". By analogy with the structure of the DNA-binding wing deduced from IKe GVP, a similar structure is proposed for the corresponding domain of the gene V protein encoded by the filamentous phage Ff for which, from X-ray diffraction studies, a three-dimensional structure has been deduced. Essential differences appear to exist between the DNA-binding domain in the X-ray structure and that proposed in this paper. Possible reasons for these differences are discussed.     

Refined structure of the gene 5 DNA binding protein from bacteriophage fd

The three-dimensional structure of the gene 5 DNA binding protein (G5BP) from bacteriophage fd has been determined from a combination of multiple isomorphous replacement techniques, partial refinements and deleted fragment difference Fourier syntheses. The structure was refined using restrained parameter least-squares and difference Fourier methods to a final residual of R = 0.217 for the 3528 statistically significant reflections present to 2.3 A resolution. In addition to the 682 atoms of the protein, 12 solvent molecules were included. We describe here the dispositions and orientations of the amino acid side-chains and their interactions as visualized in the G5BP structure. The G5BP monomer of 87 peptide units is almost entirely in the beta-conformation, organized as a three-stranded sheet, a two-stranded beta-ribbon and a broad connecting loop. There is no alpha-helix present in the molecule. Two G5BP monomers are tightly interlocked about an intermolecular dyad axis to form a compact dimer unit of about 55 A X 45 A X 36 A. The dimer is characterized by two symmetry-related antiparallel clefts that traverse the monomer surfaces essentially perpendicular to the dyad axis. From the three-stranded antiparallel beta-sheet, formed from the first two-thirds of the sequence, extend three tyrosine residues (26, 34, 41), a lysine (46) and two arginine residues (16, 21) that, as indicated by other physical and chemical experiments, are directly involved in DNA binding. Other residues likely to share binding responsibility are arginine 80 extending from the beta-ribbon and phenylalanine 73 from the tip of this loop, but as provided, however, by the opposite monomer within each G5BP dimer pair. Thus, both symmetry-related DNA binding sites have a composite nature and include contributions from both elements of the dimer. The gene 5 dimer is clearly the active binding species, and the two monomers within the dyad-related pair are so structurally contiguous that one cannot be certain whether the isolated monomer would maintain its observed crystal structure. This linkage is manifested primarily as a skeletal core of hydrophobic residues that extends from the center of each monomer continuously through an intermolecular beta-barrel that joins the pair. Protruding from the major area of density of each monomer is an elongated wing of tenuous structure comprising residues 15 through 32, which is, we believe, intimately involved in DNA binding. This wing appears to be dynamic and mobile, even in the crystal and, therefore, is likely to undergo conformational change in the presence of the ligand.     

The Ff gene 5 single-stranded DNA-binding protein binds to the transiently folded form of an intramolecular G-quadruplex

The Ff gene 5 protein (g5p) is classified as a single-stranded DNA-binding protein. However, we previously showed that g5p binds with high affinity to a SELEX-selected G-rich 58-mer DNA oligomer, I-3, that forms an intramolecular G-quadruplex [Wen, J.-D., Gray, C. W., and Gray, D. M. (2001) Biochemistry 40, 9300-9310]. In 200 mM NaCl at 37 degrees C, g5p binds to I-3 in two stages, the first stage being the formation of a discrete intermediate complex that appears to be a precursor to a saturated g5p x I-3 complex. For the present paper, CD spectroscopy and DMS methylation techniques were used to investigate the binding of g5p to the I-3 oligomer and to the truncated 26-nucleotide core of the I-3 oligomer. The core sequence, called I-3c26, was d(GGGGTCAGGCTGGGGTTGTGCAGGTC). Results were the following: (1) The g5p binds in one stage to I-3c26 in 200 mM NaCl at 37 degrees C. (2) The intermediate complex of g5p.I-3 is formed by the binding of g5p to the core sequence. (3) G-quadruplex structures are maintained in both the g5p x I-3 and g5p x I-3c26 complexes, but the bound G-quadruplex structures are altered from their respective steady-state folded forms in 200 mM NaCl. (4) CD kinetics measurements showed that the I-3c26 quadruplex folds in two stages and that a transiently folded form is apparently the same as the altered structure to which g5p binds. (5) DMS methylation protection and interference experiments identified two guanines that are differentially involved in the steady-state folded and g5p-bound G-quadruplex structures. A model for a possible I-3c26 G-quadruplex structure is described.     

Triplet state properties of tryptophan residues in complexes of mutated Escherichia coli single-stranded DNA binding proteins with single-stranded polynucleotides.

Complexes of point-mutated E. coli single-stranded DNA-binding protein (Eco SSB) with homopolynucleotides have been investigated by optical detection of magnetic resonance (ODMR) of the triplet state of tryptophan (Trp) residues. Investigation of the individual sublevel kinetics of the lowest triplet state of Trp residues 40 and 54 in the poly (dT) complex of Eco SSB-W88F,W135F (a mutant protein whose Trp residues at positions 88 and 135 have been substituted by Phe) shows that Trp 54 is the most affected residue upon stacking with thymine bases, confirming previous results based on SSB mutants having single Trp----Phe substitutions. (Zang, L. H., A. H. Maki, J. B. Murphy, and J. W. Chase. 1987. Biophys. J. 52:867-872). The Tx sublevel of Trp 54 shows a fourfold increase in the decay rate constant, as well as an increase in its populating rate constant by selective spin-orbit coupling. The two nonradiative sublevels show no change in lifetime, relative to unstacked Trp. For Trp 40, a weaker perturbation of Tx by thymine results in a sublevel lifetime about one-half that of normal Trp. Trp54 displays a 2[E]transition of negative polarity in the double mutant SSB complex with Poly (dT), but gives a vanishingly weak [D] - [E] signal, thus implying that the steady-state sublevel populations of Tx and Tz are nearly equal in this residue. Poly (5-BrU) induces the largest red-shift of the Eco SSB-W88F,W135F Trp phosphorescence 0,0-band of all polynucleotides investigated. Its phosphorescence decay fits well to two exponential components of 1.02 and 0.12 s, with no contribution from long-lived Trp residues. This behavior provides convincing evidence that both Trp 40 and 54 are perturbed by stacking with brominated uridine. The observed decrease in the Trp [D] values further confirms the stacking of the Trp residues with 5-BrU. Wave-length-selected ODMR experiments conducted on the [D[ + [E] transition of Eco SSB-W88F,W135F complexed with poly(5HgU) indicate the presence of multiple heavy atom-perturbed sites. Measurements made on poly (5-HgU) which each of its 4 Trp residues has been replaced in turn by Phe demonstrate that Trp 40 and 54 are the only Trp residues undergoing stacking with nucleotide bases, as previously proposed.     

Natural DNA sequences can form left-handed helices in low salt solution under conditions of topological constraint

The conformation of DNA that originates from association of complementary single-stranded circles (form V DNA) is investigated in solution at low salt concentration. It is shown that circular dichroism extended to the far ultraviolet region (down to 165 nm) represents a powerful tool for determination of the handedness of double helical DNAs in solution. The positive intense band at 186 nm followed by a strong negative band around 170 nm is characteristic of all right-handed helical forms (B,A) of DNA, whereas the circular dichroism spectrum of the Z form of poly[d(G-C)] of opposite helical sense represents a quasi inversion of these far ultraviolet bands. Thus, form V DNA is found to represent a co-existence of left-handed Z-type and right-handed B double helical stretches in addition to negative superturns. The Raman spectrum of form V DNA provides further support for the contribution of a left-handed double helical conformation, as shown by comparison to the high resolution Raman spectra of poly[d(G-C)] in the Z and B forms.The analysis of present spectroscopic data and the analysis of occurrence of alternating [d(G-C)] purine-pyrimidine sequences in the form V DNA used strongly suggest that in DNA of natural sequence, topological constraint may generate left-handed double helices, a conformation thought so far to be limited to the alternating [d(G-C)] sequences. Such structure could play a role in recognition and regulation of gene expression.     

Two-dimensional 1H nuclear magnetic resonance studies on the gene V-encoded single-stranded DNA-binding protein of the filamentous bacteriophage IKe. II. Characterization of the DNA-binding wing with the aid of spin-labelled oligonucleotides

The DNA-binding domain of the single-stranded DNA-binding protein IKe GVP was studied by means of 1H nuclear magnetic resonance, through use of oligonucleotides of two and three adenyl residues in length, that were spin-labelled at their 3' and/or 5' termini. These spin-labelled ligands were found to cause line broadening of specific protein resonances when bound to the protein, although they were present in small quantities, i.e. of the order of 0.04 molar equivalent and less. The line broadening of protein resonances was made manifest by means of difference one and two-dimensional spectroscopy. Difference one-dimensional experiments revealed line broadening of the same protein resonances upon binding of either 3' or 5' spin-labelled oligonucleotides. Evidence in favour of the existence of a fixed 5' to 3' orientation in the binding of oligonucleotides to the protein surface was therefore not obtained from the spin-labelled oligonucleotide binding studies. Residue-specific assignments of broadened resonances could not, or could only sparsely, be derived from the difference one-dimensional spectra, because of the tremendous overlap in the aliphatic region of the spectrum. In contrast, such assignments were easily obtained from the difference two-dimensional spectra, which were recorded by means of both total correlated spectroscopy and nuclear Overhauser effect spectroscopy. Difference signals were detected for 15 spin systems; ten out of these were assigned to the residues I29, Y27, S20, G18, R16, T28, K22, Q21, V19 and S17 in the amino acid sequence of IKe GVP; the other five spin systems could be assigned to a phenylalanyl residue, an arginyl or lysyl residue, an aspartic acid or asparagyl residue, a glycyl residue and a glutamic acid or glutamyl residue. From the evaluation of the relative difference signals, it was concluded that the direct surroundings of the spin-label group of the labelled oligonucleotide in the bound state is composed of the first five residues in the former group of residues and the five residues in the latter group.(ABSTRACT TRUNCATED AT 400 WORDS)     

Relationship of single-stranded DNA-binding proteins of Ehrlich ascites tumour to cell growth phase and DNA replications.

The possible involvement of SSB-proteins in DNA replication in Ehrlich ascites tumour (EAT) has been investigated. A direct relation (the computer-generated correlation coefficient was 0.9) between the SSB-proteins content in chromatin and intensity of the replicative synthesis of DNA in various preparation of EAT in vivo and in vitro is observed. Addition of exogenous SSB-proteins to the permeable EAT cells has been found to increase the replicative synthesis. Although eukaryotic SSB-proteins are not complete analogs of the prokaryotic SSB-proteins, they evidently participate in DNA replication in eukaryotic cells and possibly are intracellular regulators of proliferation.     

Polymerase theta-helicase promotes end joining by stripping single-stranded DNA-binding proteins and bridging DNA ends

Homologous recombination-deficient cancers rely on DNA polymerase Theta (Polθ)-Mediated End Joining (TMEJ), an alternative double-strand break repair pathway. Polθ is the only vertebrate polymerase that encodes an N-terminal superfamily 2 (SF2) helicase domain, but the role of this helicase domain in TMEJ remains unclear. Using single-molecule imaging, we demonstrate that Polθ-helicase (Polθ-h) is a highly processive single-stranded DNA (ssDNA) motor protein that can efficiently strip Replication Protein A (RPA) from ssDNA. Polθ-h also has a limited capacity for disassembling RAD51 filaments but is not processive on double-stranded DNA. Polθ-h can bridge two non-complementary DNA strands in trans. PARylation of Polθ-h by PARP-1 resolves these DNA bridges. We conclude that Polθ-h removes RPA and RAD51 filaments and mediates bridging of DNA overhangs to aid in polymerization by the Polθ polymerase domain.     

High-resolution AFM imaging of single-stranded DNA-binding (SSB) protein—DNA complexes

DNA in living cells is generally processed via the generation and the protection of single-stranded DNA involving the binding of ssDNA-binding proteins (SSBs). The studies of SSB-binding mode transition and cooperativity are therefore critical to many cellular processes like DNA repair and replication. However, only a few atomic force microscopy (AFM) investigations of ssDNA nucleoprotein filaments have been conducted so far. The point is that adsorption of ssDN A–SSB complexes on mica, necessary for AFM imaging, is not an easy task. Here, we addressed this issue by using spermidine as a binding agent. This trivalent cation induces a stronger adsorption on mica than divalent cations, which are commonly used by AFM users but are ineffective in the adsorption of ssDNA–SSB complexes. At low spermidine concentration (<0.3mM), we obtained AFM images of ssDNA–SSB complexes (E. coli SSB, gp32 and yRPA) on mica at both low and high ionic strengths. In addition, partially or fully saturated nucleoprotein filaments were studied at various monovalent salt concentrations thus allowing the observation of SSB-binding mode transition. In association with conventional biochemical techniques, this work should make it possible to study the dynamics of DNA processes involving DNA–SSB complexes as intermediates by AFM.     

Energy transfer in complexes of E. coli single-stranded DNA-binding protein with single-stranded poly-(2-thiouridylic acid)

The complexes of point-mutated Escherichia coli single-stranded DNA-binding protein (Eco SSB) with poly-(2-thiouridylic acid) (poly S2U) have been studied by optical detection of magnetic resonance spectroscopy (ODMR). Previous work has determined that two of four tryptophan (Trp) residues in Eco SSB undergo stacking interactions with nucleic acid bases. Selective photoexcitation of S2U bases was performed and subsequent triplet----triplet energy transfer from S2U to nearby Trp residues in the protein took place. The zero-field splitting (ZFS) parameters and sublevel kinetics were determined for each Trp residue sensitized by S2U. The sublevel lifetimes of the two sensitized residues are similar to those of normal Trp. The ZFS parameters, on the other hand, show a dramatic reduction relative to those of the uncomplexed protein, implying a more polarizable environment for the sensitized Trp residues and/or charge transfer interactions with the S2U bases.