The DNA fragments produced by AluI and BstNI digestion of fixed mouse chromosomes

AluI and BstNI restriction endonucleases were used to study cytological and biochemical effects on centromere DNA in fixed mouse chromosomes. These enzymes were employed, as it is known that AluI is incapable of attacking major satellite DNA, contrary to BstNI that is known to cut this DNA fraction into monomers of 234 bp. After digestion in situ, electrophoretic analysis was carried out to characterize the DNA purified (1) from the material remaining on the chromosomes and (2) from the material solubilized from chromosomes. The DNA was then transferred to a nylon filter and ³²P-labelled major satellite DNA was used as a probe for hybridization experiments. Other preparations were simply stained with Giemsa after digestion in situ with AluI and BstNI. Our results show that although restriction endonuclease cleavage primarily depends on DNA base sequence, this factor is not always sufficient to explain nuclease-induced cytological effects. In fact, the structural organization of peculiar regions such as the centromeres of mouse chromosomes might affect cleavage efficiency when restriction enzyme digestion is performed in situ.M.L. Pardue     

Restriction enzyme digestion of heterochromatin inDrosophila nasuta

In situ digestion of metaphase and polytene chromosomes and of interphase nuclei in different cell types ofDrosophila nasuta with restriction enzymes revealed that enzymes like AluI, EcoRI, HaeIII, Sau3a and SinI did not affect Giemsa-stainability of heterochromatin while that of euchromatin was significantly reduced; TaqI and SalI digested both heterochromatin and euchromatin in mitotic chromosomes. Digestion of genomic DNA with AluI, EcoRI, HaeIII, Sau3a and KpnI left a 23 kb DNA band undigested in agarose gels while withTaqI, no such undigested band was seen. TheAluI resistant 23 kb DNA hybridized insitu specifically with the heterochromatic chromocentre. It appears that the digestibility of heterochromatin region in genome ofDrosophila nasuta with the tested restriction enzymes is dependent on the availability of their recognition sites.     

The organization of classical satellite DNAs in human chromosomes: an approach using AluI and TaqI restriction endonucleases

Human classical satellite DNAs were used as probes to investigate the molecular mechanism(s) of AluI/TaqI attack in situ on specific centromeric areas. The biochemical results obtained show that the majority of such highly repetitive DNAs are not solubilized from chromosomes, in spite of a cleavage pattern identical to that shown in naked genomic DNA digested with the same enzymes. Moreover, when digestion in situ with restriction enzymes precedes in situ hybridization, it is possible to observe an increased signal in the centromeres of some chromosomes as compared to that shown in standard undigested chromosomes and, on the other hand, hybridization labelling in centromeres which are difficult to detect by in situ hybridization using standard undigested chromosomes. Lastly, our results show that centromeric heterochromatin is not a homogeneous class in regard to organizational structure.     

The 1360 bp long basic repeat unit of calf satellite I DNA contains GC rich nucleus of about 140 bp.

Fine melting profiles of calf satellite I DNA and its fragments obtained after digestion with endoR.EcoRI and endoR.AluI nucleases were investigated. It is shown that the 1360 bp basic repeat unit of calf satellite I DNA contains an about 140 bp long GC rich nucleus. It is localized on the 600 bp restriction fragment obtained after digestion of 1360 bp fragment with endoR.AluI nuclease. The main part of satellite I DNA melts as loops between such GC rich nuclei which strongly influence the melting properties of this satellite. There exist significant differences between the thermal stabilities of fragments containing many nuclei, one nucleus and those in which such nucleus is absent.     

Some remarks on the use of TaqI to detect highly repetitive DNA sequences in human chromosomes

In the attempt to conclude investigation of the action of restriction endonucleases on eukaryote chromosomes, we carried out a series of experiments digesting in situ human metaphase chromosomes with AluI/TaqI followed by Giemsa staining. We focused on the centromeric regions of chromosomes1, 2 and 16 and noted that those areas appeared as intensely stained blocks after AluI digestion, but were dramatically reduced in size or completely destroyed after subsequent TaqI treatment. These results permitted us to draw some conclusions on the highly repetitive DNA composition of these regions, in terms of alphoid and classical satellite DNAs.     

Morphological and biochemical effects of endonucleases on isolated mammalian chromosomes in vitro

Endonuclease digestion of isolated and unfixed mammalian metaphase chromosomes in vitro was examined as a means to study the higher-order regional organization of chromosomes related to banding patterns and the mechanisms of endonuclease-induced banding. Isolated mouse LM cell chromosomes, digested with the restriction enzymes AluI, HaeIII, EcoRI, BstNI, AvaII, or Sau96I, demonstrated reproducible G- and/or C-banding at the cytological level depending on the enzyme and digestion conditions. At the molecular level, specific DNA alterations were induced that correlated with the banding patterns produced. The results indicate that: (1) chromatin extraction is intimately involved in the mechanism of endonuclease induced chromosome banding. (2) The extracted DNA fragments are variable in size, ranging from 200 bp to more than 4 kb in length. (3) For HaeIII, there appears to be variation in the rate of restriction site cleavage in G- and R-bands; HaeIII sites appear to be more rapidly cleaved in R-bands than in G-bands. (4) AluI and HaeIII ultimately produce banding patterns that reflect regional differences in the distribution of restriction sites along the chromosome. (5) BstNI restriction sites in the satellite DNA of constitutive heterochromatin are not cleaved intrachromosomally, probably reflecting an inaccessibility of the BstNI sites to enzyme due to the condensed nature of this chromatin or specific DNA-protein interactions. This implies that some enzymes may induce banding related to regional differences in the accessibility of restriction sites along the chromosome. (6) Several specific nonhistone protein differences were noted in the extracted and residual chromatin following an AluI digestion. Of these, some nonhistones were primarily detected in the extracted chromatin while others were apparently resistant to extraction and located principally in the residual chromatin. (7) The chromatin in constitutive heterochromatin is transiently resistant to cleavage by micrococcal nuclease.     

Restriction endonuclease banding of rainbow trout chromosomes

Rainbow trout chromosomes were treated with nine restriction endonucleases, stained with Giemsa, and examined for banding patterns. The enzymes AluI, MboI, HaeIII, HinfI (recognizing four base sequences), and PvuII (recognizing a six base sequence) revealed banding patterns similar to the C-bands produced by treatment with barium hydroxide. The PvuII recognition sequence contains an internal sequence of 4 bp identical to the recognition sequence of AluI. Both enzymes produced centromeric and telomeric banding patterns but the interstitial regions stained less intensely after AluI treatment. After digestion with AluI, silver grains were distributed on chromosomes labeled with [³H]thymidine in a pattern like that seen after AluI-digested chromosomes are stained with Giemsa. Similarly, acridine orange (a dye specific for DNA) stained chromosomes digested with AluI or PvuII in patterns resembling those produced with Giemsa stain. These results support the theory that restriction endonucleases produce bands by cutting the DNA at specific base pairs and the subsequent removal of the fragments results in diminished staining by Giemsa. This technique is simple, reproducible, and in rainbow trout produces a more distinct pattern than that obtained with conventional C-banding methods.     

An analysis of the action of nonspecific and restriction nucleases on metaphase chromosomes in situ

Patterns of differential staining of Drosophila, mouse, rat, cattle and pig chromosomes were examined after the treatment with nucleases (DNAase I, DNAase II) and restriction enzymes (AluI, HpaII, MspI, BpE, EcoRI). The above effects depend on the species used, on the enzymes and substitution of thymine for bromodeoxyuridine in the chromosomal DNA. It is supposed that such a phenomenon may not only result from the irregular distribution of specific restriction sites along chromosomes but also depend on the specificity of supramolecular organization of the chromosomal DNA.     

Chromosome-specific organization of human alpha satellite DNA

Restriction endonuclease analysis of human genomic DNA has previously revealed several prominent repeated DNA families defined by regularly spaced enzyme recognition sites. One of these families, termed alpha satellite DNA, was originally identified as tandemly repeated 340- or 680-base pair (bp) EcoRI fragments that hybridize to the centromeric regions of human chromosomes. We have investigated the molecular organization of alpha satellite DNA on individual human chromosomes by filter hybridization and in situ hybridization analysis of human DNA and DNA from rodent/human somatic cell hybrids, each containing only a single human chromosome. We used as probes a cloned 340-bp EcoRI alpha satellite fragment and a cloned alpha satellite-containing 2.0-kilobase pair (kbp) BamHI fragment from the pericentromeric region of the human X chromosome. In each somatic cell hybrid DNA, the two probes hybridized to a distinct subset of DNA fragments detected in total human genomic DNA. Thus, alpha satellite DNA on each of the human chromosomes examined--the X and Y chromosomes and autosomes 3, 4, and 21--is organized in a specific and limited number of molecular domains. The data indicate that subsets of alpha satellite DNA on individual chromosomes differ from one another, both with respect to restriction enzyme periodicities and with respect to their degree of sequence relatedness. The results suggest that some, and perhaps many, human chromosomes are characterized by a specific organization of alpha satellite DNA at their centromeres and that, under appropriate experimental conditions, cloned representatives of alpha satellite subfamilies may serve as a new class of chromosome-specific DNA markers.     

Distribution of satellite DNA fractions within major heterochromatic regions of human chromosomes as revealed by PleI and TfiI digestion.

Banding patterns induced by selective DNA extraction with the restriction endonucleases PleI and TfiI reveal the distribution of human satellite DNAs within the major heterochromatic blocks on human metaphase chromosomes. PleI and TfiI are able to discriminate HinfI target sites, depending on the nature of the central base. PleI digestion specifically reveals regions, within major C-bands, that include the major sites of satellite II DNA and permits more precise localization of satellite II domains than does radioactive in situ hybridization. The close correspondence between the cytogenetic results presented here and previously reported molecular data seems to support the idea that the frequency of enzyme target sequences is the main factor in determining the action produced by restriction endonucleases on fixed human chromosomes and that chromatin conformation is not an important factor in limiting enzyme accessibility.     

Localization and characterization of recombinant DNA clones derived from the highly repetitive DNA sequences in the Indian muntjac cells: their presence in the Chinese muntjac

A total of seven, highly repeated, DNA recombinant M13 mp8 clones derived from a Hpa II digest of cultured cells of the Indian muntjac (Muntiacus muntjac vaginalis) were analyzed by restriction enzymes, in situ hybridization, and DNA sequencing. Two of the clones, B1 and B8, contain satellite DNA inserts which are 80% homologous in their DNA sequences. B1 contains 781 nucleotides and consist of tandem repetition of a 31 bp consensus sequence. This consensus sequence, TCCCTGACGCAACTCGAGAGGAATCCTGAGT, has only 3 bp changes, at positions 7, 24, and 27, from the consensus sequence of the 31 bp subrepeats of the bovine 1.715 satellite DNA. The satellite DNA inserts in B1 and B8 hybridize primarily but not specifically to chromosome X, and secondarily to other sites such as the centromeric regions of chromosomes 1 and 2. Under less stringent hybridization conditions, both of them hybridize to the interior of the neck region and all other chromosomes (including chromosomes 3 and Y). The other five DNA clones contain highly repetitive, interdispersed DNA inserts and are distributed throughout the genome except for the neck region of the compound chromosome X+3. Blot hybridization results demonstrate that the satellite DNA component is also present in Chinese muntjac DNA (Muntiacus reevesi) in spite of the very different karyotypes of the Chinese and Indian muntjacs.     

Longitudinal differentiation of metaphase chromosomes of Indian muntjac as studied by restriction enzyme digestion,in situ hybridization with cloned DNA probes and distamycin A plus DAPI fluorescence staining

The longitudinal differentiation of metaphase chromosomes of the Indian muntjac was studied by digestion with restriction enzymes, in situ hybridization with cloned DNA probes and distamycin A plus DAPI (4-6-diamidino-2-phenylindole) fluorescence staining. The centromeric regions of chromosomes 3 and 3 + X of a male Indian muntjac cell line were distinct from each other and different from those of other chromosomes. Digestion with a combination of EcoRI^* and Sau3A revealed a pattern corresponding to that of C-banding. Digestion with AluI, EcoRII or RsaI yielded a band specific to the centromeric region only in chromosomes 3 and 3 + X. Furthermore, HinfI digestion yielded only a band at the centromeric region of chromosome 3, whereas DA-DAPI staining revealed a single band limited to the extreme end of the C-band heterochromatin of the short arm of 3 + X. These results suggest that centromeres of Indian muntjac chromosomes contain at least four different types of repetitive DNA. Such diversity in heterochromatin was also confirmed by in situ hybridization using specific DNA probes isolated and cloned from highly repetitive DNA families. Heterozygosity between chromosome homologs was revealed by restriction enzyme banding. Evidence is presented for the presence of nucleolus organizer regions (NORs) on the long arm of chromosome 1 as well as on the secondary constrictions of 3 and 3 + X.Abbreviations DA distamycin A - DAPI 4-6-diamidino-2-phenylindole - NOR(s) nucleolus organizer region(s) - PBS phosphate-buffered saline - PI propidium iodide     

Cleavage of DNA.RNA hybrids by type II restriction enzymes.

The action of a number of restriction enzymes on DNA.RNA hybrids has been examined using hybrids synthesised with RNAs of cucumber mosaic virus as templates. The enzymes EcoRI, HindII, SalI, MspI, HhaI, AluI, TaqI and HaeIII cleaved the DNA strand of the hybrids (and possible also the RNA strand) into specific fragments. For four of these enzymes, HhaI, AluI, TaqI and HaeIII, comparison of the restriction fragments produced with the known sequences of the viral RNAs confirmed that they were recognising and cleaving the DNA strand of the hybrids at their correct recognition sequences. It is likely that the ability to utilise DNA.RNA hybrids as substrates is a general property of Type II restriction enzymes.     

The effect of restriction enzyme digestion of human metaphase chromosomes on C-band variants of chromosomes 1 and 9

Human metaphase chromosomes, fixed on slides, have beent treated with 8 different restriction endonucleases and 29 combinations of 2 restriction enzymes prior to staining with Giemsa. The endonucleases AluI and DdeI and the combinations AluI + DdeI, AluI + HaeIII, AluI + HinfI, and AluI + MboI have then been used to digest metaphase chromosomes of nine individuals with C-band variants of chromosomes 1 or 9, obtained by the CBG technique. The restriction enzyme resistant chromatin of the paracentromeric regions of chromosomes 1 and 9 has been measured and compared with the corresponding CBG-bands. The size of the enzyme resistant chromatin regions depend upon the type of enzyme(s) used. Treatment with AluI + MboI was the only digestion that acted differently on different chromosome pairs. However, within one pair of homologous chromosomes, all digestions revealed the same variations as conventional C-banding.     

Isolation of a variant family of mouse minor satellite DNA that hybridizes preferentially to chromosome 4

Two cosmids (HRS-1 and HRS-2) containing mouse minor satellite DNA sequences have been isolated from a mouse genomic library. In situ hybridization under moderate stringency conditions to metaphase chromosomes from RCS-5, a tumor cell line derived from the SJL strain, mapped both HRS-1 and HRS-2 to the centromeric region of chromosome 4. Sequence data indicate that these cloned minor satellite DNA sequences have a basic higher order repeat of 180 bp, composed of three diverged 60-bp monomers. Digestion of mouse genomic DNA with several restriction enzymes produces a ladder of minor satellite fragments based on a 120-bp repeat. The restriction enzyme NlaIII (CATG) digests all the minor satellite DNA into three prominent bands of 120, 240, and 360 bp and a weak band of 180 bp. Thus, the majority of minor satellite sequences in the genome are arranged in repeats based on a 120-bp dimer, while the family of minor satellite sequences described here represents a rare variant of these sequences. Our results raise the possibility that there may be other variant families of minor satellites analogous to those of alphoid DNA present in humans.     

Restriction endonuclease/nick translation of fixed mouse chromosomes: A study of factors affecting digestion of chromosomal DNA in situ

We used a restriction endonuclease/nick translation procedure to study the ability of certain enzymes, known to cleave mouse satellite DNA in solution, to attack satellite DNA in fixed mouse chromosomes. Although AvaII and Sau96I readily attack the mouse major satellite in fixed chromosomes, BstNI and EcoRII do not normally do so, although if the heterochromatin is uncondensed as a result of culture in the presence of 5-azacytidine, BstNI can attack it. No clear evidence was obtained for digestion in situ of the minor satellite of mouse chromosomes by MspI, the only enzyme reported to cleave this satellite. Our results show that the DNA of mouse heterochromatin is not merely not extracted by certain restriction enzymes, but is actually not cleaved by them. Chromatin conformation is therefore shown to be an important factor in determining patterns of digestion of chromosomes by restriction endonucleases.by D. Schweizer     

A comparative study of the heterochromatin of Apodemus sylvaticus and Apodemus flavicollis

The two closely related species Apodemus sylvaticus and Apodemus flavicollis (Muridae) differ in the distribution of their heterochromatin. Two major repetitive sequences known to occur in both species were isolated from A. flavicollis after digestion of total nuclear DNA with the restriction enzymes HindIII and EcoRI respectively and characterized in both species by filter hybridisation and in situ hybridisation to metaphase chromosomes. The EcoRI clone detects a dispersed repetitive sequence family in the genome of both species. Southern blot hybridisation with the HindIII satellite DNA probe reveals major similarities and minor differences in the two species. In situ hybridisation with the HindIII probe labels all chromosomes of A. flavicollis exclusively in the centromeric heterochromatin, whereas in A. sylvaticus several autosomes are also labelled distally. The labelling patterns correspond to the distribution of heterochromatin in the two species. It is concluded that the additional distal heterochromatin of A. sylvaticus contains similar sequences to those of the centromeric heterochromatin of both species. The distal heterochromatin in A. sylvaticus most likely evolved by transposition and amplification of centromeric satellite DNA elements, after the separation of the two species.     

Restriction endonuclease digestion patterns of harvest mice (Reithrodontomys) chromosomes: a comparison to G-bands, C-bands, and in situ hybridization.

Constitutive heterochromatin of a karyotypically conserved species of harvest mouse was compared to that of three karyotypically derived species of harvest mice by examining banding patterns produced on metaphase patterns produced by two of these restriction endonucleases (EcoRI and MboI) were compared to published G- and C-banded karyotypes and in situ hybridization of a satellite DNA repeat for these taxa. The third restriction endonuclease (PstI) did not produce a detectable pattern of digestion. For the most part, patterns produced by EcoRI and MboI can be related to C-banded chromosomes and in situ hybridization of satellite DNA sequences. Moreover, digestion with EcoRI reveals bands not apparent with these other techniques, suggesting that restriction endonuclease digestion of metaphase chromosomes may provide additional insight into the structure and organization of metaphase chromosomes. The patterns produced by restriction endonuclease digestion are compatible with the chromosomal evolution of these taxa, documenting that in the highly derived taxa not only are the chromosomes rearranged but the abundance of certain sequences is highly variable. However, technical variation and difficulty in producing consistent results even on a single slide with some restriction endonucleases documents the problems associated with this method.     

Restriction endonuclease cleavage of satellite DNA in intact bovine nuclei

We have analyzed the efficiency with which specific nucleotide sequences within nucleosomes are recognized and cleaved by DNA restriction endonucleases. A system amenable to this sort of analysis is the cleavage of the bovine genome with the restriction endonuclease EcoRI. Bovine satellite I comprises 7% of the genome and is tandemly repetitious with an EcoRI site at 1400 base pair (bp) intervals within this sequence. The ease with which this restriction fragment can be measured permits an analysis of the accessibility of this sequence when organized in a nucleosomal array.Initial studies indicated that satellite I sequences are organized in a nucleosomal structure in a manner analogous to that observed for total genomic DNA. We then examined the accessibility of the EcoRI cleavage sites in satellite to endonucleolytic cleavage in intact nuclei. We find that whereas virtually all the satellite I sequences from naked DNA are cleaved into discrete 1400 bp fragments, only 33% of the satellite I DNA is liberated as this fragment from intact nuclei. These data indicate that 57% of the EcoRI sites in nuclei are accessible to cleavage and that cleavage can occur within the core of at least half the nucleosomal subunits. Analysis of the products of digestion suggests a random distribution of nucleosomes about the EcoRI sites of satellite I DNA.Finally, the observation that satellite sequences can be cleaved from nuclei to 1400 bp length fragments with their associated proteins provides a method for the isolation of specific sequences as chromatin. Using sucrose gradient velocity centrifugation, we have isolated a 70% pure fraction of satellite I chromatin. Nuclease digestion of this chromatin fraction reveals the presence of nucleosomal subunits and indicates that specific sequences can be isolated in this manner without gross disorganization of their subunit structure.     

Satellite DNA derived from 5S rDNA in Physalaemus cuvieri (Anura, Leiuperidae)

In the present study, we describe for the first time a family of 190-bp satellite DNA related to 5S rDNA in anurans and the existence of 2 forms of 5S rDNA, type I (201 bp) and type II (690 bp). The sequences were obtained from genomic DNA of Physalaemus cuvieri from Palmeiras, State of Bahia, Brazil. Analysis of the nucleotide sequence revealed that the satellite DNA obtained by digestion with EcoRI, called PcP190EcoRI, is 70% similar to the coding region of type I 5S rDNA and 66% similar to the coding region of type II 5S rDNA. Membrane hybridization and PCR amplification of the sequence showed that PcP190EcoRI is tandemly repeated. The satellite DNA as well as type I and type II 5S rDNA were localized in P. cuvieri chromosomes by fluorescent in situ hybridization. The PcP190EcoRI sequence was found in the centromeres of chromosomes 1-5 and in the pericentromeric region of chromosome 3. Type I 5S rDNA was detected in chromosome 3, coincident with the site of PcP190EcoRI. Type II 5S rDNA was located interstitially in the long arm of chromosome 5. None of these sequences co-localized with nucleolar organizer regions. Our data suggests that this satellite DNA originates from the 5S ribosomal multigene family, probably by gene duplication, nucleotide divergence and sequence dispersion in the genome.