Multiple methylated cap sequences in adenovirus type 2 early mRNA.

The methylated constituents of early adenovirus 2 mRNA were studied. RNA was isolated from polyribosomes of cells double labeled with [methyl-3H]methionine and 32PO4 from 2 to 7 g postinfection in the presence of cycloheximide. Cycloheximide ensures that methylation and processing are performed by preexisting host cell enzymes. RNA was fractionated into polyadenylic [poly(A)]+ and poly(A)- molecules using poly(U)-Sepharose, and undergraded virus-specific RNA was isolated by hybridization to viral DNA in 50% formamide at 37 degrees C. Viral mRNA was digested with RNase T2 and chromatographed on DEAE-Sephadex in 7 M urea. Two 3H-labeled RNase T2-resistant oligonucleotide fractions with charges between -5 and -6 were obtained, consistent with two classes of 5' terminal methyl "cap" structures, m7G(5')ppp(5')NmpNp (cap 1) and m7G(5')ppp(5')NmNmpNp (cap 2) (Nm is a ribose 2'-O-methylation). The putative cap 1 contains all the methylated constituents of cap 1 plus Cm. The molar ratios of m7G to 2'-O-methylnucleosides is about 1.0 for cap 1 and 0.5 for cap 2, consistent with the proposed cap structures. Most significant, compositional analysis indicates four different cap 1 structures and at least three different cap 2 structures. Thus there is a minimum of seven early viral mRNA species with different cap structures, unless each type of mRNA can have more than one 5' terminus. In addition to methylated caps, early mRNA contains internal base methylations, exclusively as m6A, as shown by analyses of the mononucleotide (-2 charge) fraction. m6A was present in the ratio of 1 mol of m6Ap per 450 nucleotides. Thus viral mRNA molecules contain two to three internal m6A residues per methyl cap, since there is on the average 1 cap per 1,250 nucleotides.     

Methylated nucleotides block 5' terminus of HeLa cell messenger RNA.

Polyadenylylated [poly(A)+] mRNA from HeLa cells that were labeled with [3H-methyl]-methionine and 14C-uridine was isolated by poly(U)-Sepharose chromatography. The presence of approximately two methyl groups per 1000 nucleotides of poly(A)+ RNA was calculated from the 3H/14C ratios and known degrees of methylation of 18S and 28S ribosomal RNAs. All four 2'-O-methylribonucleosides, but only two base-methylated derivatives, 7-methylguanosine (7MeG) and 6-methyladenosine (6MeA), were identified. 6MeA was the major component accounting for approximately 50% of the total methyl-labeled ribonucleosides. 7MeG, comprising about 10% of the total, was present exclusively at the 5' terminus of the poly(A)+ RNA and could be removed by periodate oxidation and beta elimination. Evidence for a 5' to 5' linkage of 7MeG to adjacent 2'-O-methylribonucleosides through at least two and probably three phosphates to give structures of the type 7MeG5'ppp5pNMep- and 7MeG5'ppp5'NMepNmep- was presented. The previous finding of similar sequences of methylated nucleotides in mRNA synthesized in vitro by enzymes associated with virus cores indicates that blocked 5' termini may be a characteristic feature of mRNAs that function in eucaryotic cells.     

Sequence of methylated nucleotides at the 5''-terminus of adenovirus-specific RNA.

RNA labeled with [methyl-3H] methionine and [14C]uridine was isolated from the cytoplasm of adenovirus-infected cells and purified by poly(U)-Sepharose chromatography and hybridization to filters containing immobilized adeovirus DNA. Analysis by dimethyl sulfoxide-sucrose gradient sedimentation suggested that the major mRNA species were methylated. 7-Methylguanosine was identified at the 5'-terminus of the advenovirus-specific RNA and could be removed by periodate oxidation and beta-elimination. Structures of the type m7G(5')ppp(5')Nm containing the unusual nucleoside N6, O2'-dimethyladenosine, and smaller amounts of 2'-O-methyladenosine were isolated by DEAE-cellulose chromatography after P1 nuclease digestion of the RNA. Evidence for some 5'-terminal sequences, m7G(5')ppp(5')m6AmpNm, with additional 2'-O-methylribonucleosides was also obtained. A base-methylated nucleoside, N6-methyladenosine, is located within the RNA chain and is released as a mononucleotide by alkali hydrolysis.     

Replication of Measles Virus: Continued Synthesis of Nucleocapsid RNA and Increased Synthesis of mRNA in the Presence of Cycloheximide

The effect of cycloheximide on virus specific RNA synthesis in Vero cells infected with either wild-strain (Edmonston) or subacute sclerosing panencephalitis strain measles virus was investigated. At 3 days postinfection, cells treated with cycloheximide (2.6 x 10(-4) M) and then exposed to [(3)H]uridine showed a marked increase in labeled virus-specific RNA. A major portion of this incremental labeled RNA was putative viral mRNA which sedimented at 16, 22, and 30S. Five distinct classes of polyribosomes, which were not evident in untreated cells, were found in cycloheximide-treated cells and each contained similar species of virus-specific RNA. Viral nucleocapsid RNA, 50 and 18S, was synthesized and encapsidated in the presence of cycloheximide. The latter observation is in apparent contrast to reports that cycloheximide inhibits replication of RNA of classical paramyxoviruses, and may indicate that mechanisms for replicating RNA of measles virus are different from those for replicating RNA of paramyxoviruses.     

Methylated and blocked 5' termini in vesicular stomatitis virus in vivo mRNAs.

Methyl groups derived from 3H-methyl methionine were incorporated into vesicular stomatitis virus (VSV) MRNAs isolated from infected cells. Sequential degradation of the 12-18S viral mRNA species with ribonuclease T2, penicillium nuclease, and alkaline phosphatase yielded a single 3H-labeled dinucleotide. A similar resistant 32P-labeled fragment was obtained by digesting VSV mRNA uniformly labeled with 32P. This methylated and blocked oligomer was further cleaved with nucleotide pyrophosphatase, yielding two methylated 5' nucleotides. We postulate that the 5' terminal structure of the vivo 12-18S VSV mRNA contains 7-methylguanosine linked by a 5'-5' pyrophosphate bond to a methylated derivative of adenosine. In contrast to the mRNAs (+ strand), the VSV genome RNA ( MINUS STRAND) IS NOT BLOCKED.     

Viral genome RNA serves as messenger early in the infectious cycle of murine leukemia virus.

When NIH/3T3 mouse fibroblasts were infected with the Moloney strain of murine leukemia virus, part of the viral genome RNA molecules were detected in polyribosomes of the infected cells early in the infectious cycle. The binding appears to be specific, since we could demonstrate the release of viral RNA from polyribosomes with EDTA. Moreover, when infection occurred in the presence of cycloheximide, most viral RNA molecules were detected in the free cytoplasm. Size analysis on polyribosomal viral RNA molecules indicated that two size class molecules, 38S and 23S, are present in polyribosomes at 3 h after infection. Analysis of the polyriboadenylate [poly(rA)] content of viral RNA extracted from infected polyribosomes demonstrated that such molecules bind with greatest abundance at 3 h after infection, as has been detected with total viral RNA. No molecules lacking poly(rA) stretches could be detected in polyribosomes. Furthermore, when a similar analysis was performed on unbound molecules present in the free cytoplasm, identical results were obtained. We conclude that no selection towards poly(rA)-containing viral molecules is evident on binding to polyribosomes. These findings suggest that the incoming viral genome of the Moloney strain of murine leukemia virus may serve as a messenger for the synthesis of one or more virus-specific proteins early after infection of mouse fibroblasts.     

Anatomy of herpes simplex virus DNA VII. alpha-RNA is homologous to noncontiguous sites in both the L and S components of viral DNA.

Previous reports from this laboratory (Honess and Roizman, 1974) have operationally defined alpha polypeptides as the viral proteins that are synthesized first in HEp-2 cells treated with cycloheximide from the time of infection with herpes simplex virus type 1 until the withdrawal of the drug 12 to 15 h after infection. It has also been shown that the viral RNA (designated alpha RNA) that accumulates in the cytoplasm during cycloheximide treatment and on polyribosomes immediately upon withdrawal of the drug is homologous to 10 to 12% of viral DNA, whereas the viral RNA accumulating in the cytoplasm of untreated cells at 8 to 14 h after infection is homologous to 43% of viral DNA (Kozak and Roizman, 1974). In the present study, alpha RNA and cytoplasmic RNA extracted from untreated cells 8 h after infection were each hybridized in liquid to in vitro labeled restriction endonuclease fragments generated by cleavage of herpes simplex virus type 1 DNA with Hsu I, with Bgl II, and with both enzymes simultaneously. The data show that only a subset of the fragments hybridized to alpha RNA, and these are scattered within both the L and S components of the DNA. There are at least five noncontiguous regions in the DNA homologous to alpha RNA; two of these are located partially within the reiterated sequences in the S component. All fragments tested hybridized more extensively with 8-h cytoplasmic RNA than with alpha RNA. Four adjacent fragments, corresponding to 30% of the DNA and mapping within the L component, hybridized exclusively with the cytoplasmic RNA extracted from cells 8 h after infection.     

The complete sequence of a unique RNA species synthesized by a DI particle of VSV.

The 2S RNA synthesized in vitro by the RNA polymerase of a defective interfering (DI) particle of vesicular stomatitis virus was labeled at its 3' terminus with 32P-cytidine 3', 5' bisphosphate and RNA ligase. Analysis of the labeled RNA showed that it was a family of RNAs of different length but all sharing the same 5' terminal sequence. The largest labeled RNA was purified by gel electrophoresis, and the sequence of 41 of its 46 nucleotides was determined by rapid RNA sequencing methods. The assignment of the remaining 5 nucleotides was made on the basis of an analysis of one of the smaller RNAs and published data. A new approach in RNA sequencing based on the identification of 3' terminal nucleotides of rna fragments originally present in the DI product or generated during the ligation reaction confirmed most of the sequence. The complete sequence of this 46 nucleotide long plus-sense RNA is: ppACGAAGACCACAAAACCAGAUAAAAAA UAAAAACCACAAGAGGGUC-OH. This RNA anneals to the RNA of the DI particle from which it was synthesized, indicating that its synthesis is template-specified. At least the first 17 and possibly all of the nucleotides are also complementary to sequences at the 3' end of two other VSV DI particles which were derived independently and whose genomes differ significantly in length. These data suggest a common 3' terminal sequence among all VSV DI particles which contain part of the Lgene region of the parental genome.     

Specific binding of host cellular proteins to multiple sites within the 3' end of mouse hepatitis virus genomic RNA.

The initial step in mouse hepatitis virus (MHV) RNA replication is the synthesis of negative-strand RNA from a positive-strand genomic RNA template. Our approach to begin studying MHV RNA replication is to identify the cis-acting signals for RNA synthesis and the proteins which recognize these signals at the 3' end of genomic RNA of MHV. To determine whether host cellular and/or viral proteins interact with the 3' end of the coronavirus genome, an RNase T1 protection/gel mobility shift electrophoresis assay was used to examine cytoplasmic extracts from mock- and MHV-JHM-infected 17Cl-1 murine cells for the ability to form complexes with defined regions of the genomic RNA. We demonstrated the specific binding of host cell proteins to multiple sites within the 3' end of MHV-JHM genomic RNA. By using a set of RNA probes with deletions at either the 5' or 3' end or both ends, two distinct binding sites were located. The first protein-binding element was mapped in the 3'-most 42 nucleotides of the genomic RNA [3' (+42) RNA], and the second element was mapped within an 86-nucleotide sequence encompassing nucleotides 171 to 85 from the 3' end of the genome (171-85 RNA). A single potential stem-loop structure is predicted for the 3' (+)42 RNA, and two stem-loop structures are predicted for the 171-85 RNA. Proteins interacting with these two elements were identified by UV-induced covalent cross-linking to labeled RNAs followed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis analysis. The RNA-protein complex formed with the 3'-most 42 nucleotides contains approximately five host polypeptides, a highly labeled protein of 120 kDa and four minor species with sizes of 103, 81, 70, and 55 kDa. The second protein-binding element, contained within a probe representing nucleotides 487 to 85 from the 3' end of the genome, also appears to bind five host polypeptides, 142, 120, 100, 55, and 33 kDa in size, with the 120-kDa protein being the most abundant. The RNA-protein complexes observed with MHV-infected cells in both RNase protection/gel mobility shift and UV cross-linking assays were identical to those observed with uninfected cells. The possible involvement of the interaction of host proteins with the viral genome during MHV replication is discussed.     

Structure-function analysis of the 3' stem-loop of hepatitis C virus genomic RNA and its role in viral RNA replication

Previous studies indicate that the 3' terminal 46 nt of the RNA genome of hepatitis C virus (HCV) are highly conserved among different viral strains and essential for RNA replication. Here, we describe a mutational analysis of the 3' terminal hairpin (stem-loop I) that is putatively formed by this sequence and demonstrate its role in replication of the viral RNA. We show that single base substitutions within the 6-nt loop at positions adjacent to the stem abrogate replication of a subgenomic RNA, whereas substitutions in the three apical nucleotides were well tolerated without loss of replication competence. Single point mutations were also well tolerated within the middle section of the duplex, but not at the penultimate nucleotide positions near either end of the stem. However, complementary substitutions at the -19 and -28 positions (from the 3' end) restored replication competence, providing strong evidence for the existence of the structure and its involvement in RNA replication. This was confirmed by rescue of replicating RNAs from mutants containing complementary 10-nt block substitutions at the base of the stem. Each of these RNAs contained an additional U at the 3' terminus. Further experiments indicated a strong preference for U at the 3' terminal position (followed in order by C, A, and G), and a G at the -2 position. These features of stem-loop I are likely to facilitate recognition of the 3' end of the viral RNA by the viral RNA replicase.     

A unique RNA species involved in initiation of vesicular stomatitis virus RNA transcription in vitro.

Purified virions of vesicular stomatitis virus (VSV) are capable of synthesizing two distinct types of virus-specific RNA in vitro. The first consists of several viral mRNAs which have been previously shown to contain the blocked 5' terminal sequence GpppApApCpApGp and 3' terminal poly(A). The second type of RNA has an unblocked 5' terminus and does not contain poly(A) stretches long enough to bind to oligo (dT)-cellulose columns. It migrates in 20% polyacrylamide gels as a single homogeneous peak with an estimated chain length of 68 nucleotides. Base analysis demonstrated that this small RNA molecule is composed of 48% AMP, 20% CMP, 11% GMP, and 21% UMP. The 5' terminal sequence of the small RNA is ppApCpGp, which appears to be complementary to the 3' terminal sequence of the VSV genome RNA (...PypGpU). These results indicate that this small RNA molecule probably represents the intitiated lead-in RNA segment which is removed during formation of VSV mRNAs by a possible processing mechanism.     

Terminal nucleotidyl transferase activity of recombinant Flaviviridae RNA-dependent RNA polymerases: implication for viral RNA synthesis

Recombinant hepatitis C virus (HCV) RNA-dependent RNA polymerase (RdRp) was reported to possess terminal transferase (TNTase) activity, the ability to add nontemplated nucleotides to the 3' end of viral RNAs. However, this TNTase was later purported to be a cellular enzyme copurifying with the HCV RdRp. In this report, we present evidence that TNTase activity is an inherent function of HCV and bovine viral diarrhea virus RdRps highly purified from both prokaryotic and eukaryotic cells. A change of the highly conserved GDD catalytic motif in the HCV RdRp to GAA abolished both RNA synthesis and TNTase activity. Furthermore, the nucleotides added via this TNTase activity are strongly influenced by the sequence near the 3' terminus of the viral template RNA, perhaps accounting for the previous discrepant observations between RdRp preparations. Last, the RdRp TNTase activity was shown to restore the ability to direct initiation of RNA synthesis in vitro on an initiation-defective RNA substrate, thereby implicating this activity in maintaining the integrity of the viral genome termini.     

HCV RNA-dependent RNA polymerase replicates in vitro the 3' terminal region of the minus-strand viral RNA more efficiently than the 3' terminal region of the plus RNA.

The NS5B protein, or RNA-dependent RNA polymerase of the hepatitis virus type C, catalyzes the replication of the viral genomic RNA. Little is known about the recognition domains of the viral genome by the NS5B. To better understand the initiation of RNA synthesis on HCV genomic RNA, we used in vitro transcribed RNAs as templates for in vitro RNA synthesis catalyzed by the HCV NS5B. These RNA templates contained different regions of the 3' end of either the plus or the minus RNA strands. Large differences were obtained depending on the template. A few products shorter than the template were synthesized by using the 3' UTR of the (+) strand RNA. In contrast the 341 nucleotides at the 3' end of the HCV minus-strand RNA were efficiently copied by the purified HCV NS5B in vitro. At least three elements were found to be involved in the high efficiency of the RNA synthesis directed by the HCV NS5B with templates derived from the 3' end of the minus-strand RNA: (a) the presence of a C residue as the 3' terminal nucleotide; (b) one or two G residues at positions +2 and +3; (c) other sequences and/or structures inside the following 42-nucleotide stretch. These results indicate that the 3' end of the minus-strand RNA of HCV possesses some sequences and structure elements well recognized by the purified NS5B.     

Structural difference between the 5'' termini of viral and cellular mRNA in poliovirus-infected cells: possible basis for the inhibition of host protein synthesis.

Host protein synthesis in poliovirus-infected HeLa cells is interrupted, but the host mRNA appears to remain completely intact and unmodified. The average size and poly (A) content of host mRNA was previously known to be unchanged (Koschel, 1974; Leibowitz and Penman, 1971), and this was confirmed. In addition, the 5' terminal methylated "cap" structures remained intact, and no further base modifications at the level of 1 base in 1,000 could be detected. Poliovirus RNA from viruses was previously shown not to have "caps" (Wimmer, 1972), and in this work poliovirus RNA from polyribosomes was found to have pUp at its 5' end. Since, initiation of protein synthesis is probably the basis for the inhibition of cellular protein synthesis in infected cells, the difference in the 5' ends of the host cell and viral RNA could be the basis of selective translation of viral RNA during infection.     

Mutagenesis of the 3' nontranslated region of Sindbis virus RNA.

A cDNA clone from which infectious RNA can be transcribed was used to construct 42 site-specific mutations in the 3' nontranslated region of the Sindbis virus genome. The majority of these mutations were made in the 3'-terminal 19-nucleotide conserved sequence element and consisted of single nucleotide substitutions or of small (1 to 8) nucleotide deletions. An attempt was made to recover mutant viruses after transfection of SP6-transcribed RNA into chicken cells. In most cases, viable virus was recovered, but almost all mutants grew more poorly than wild-type virus when tested under a number of culture conditions. In the case of mutations having only a moderate effect, the virus grew as well as the wild type but was slightly delayed in growth. Mutations having a more severe effect led to lower virus yields. In many cases, virus growth was more severely impaired in mosquito cells than in chicken cells, but the opposite phenotype was also seen, in which the mutant grew as well as or better than the wild type in mosquito cells but more poorly in chicken cells. One substitution mutant, 3NT7C, was temperature sensitive for growth in chicken cells and severely crippled for growth in mosquito cells. Insertion mutations were also constructed which displaced the 19-nucleotide element by a few nucleotides relative to the poly(A) tail. These mutations had little effect on virus growth. Deletion of large regions (31 to 293 nucleotides long) of the 3' nontranslated region outside of the 19-nucleotide element resulted in viruses which were more severely crippled in mosquito cells than in chicken cells. From these results, the following principles emerge. (i) The entire 3' nontranslated region is important for efficient virus replication, although there is considerable plasticity in this region in that most nucleotide substitutions or deletions made resulted in viable virus and, in some cases, in virus that grew quite efficiently. Replication competence was particularly sensitive to changes involving the C at position 1, the A at position 7, and a stretch of 9 U residues punctuated by a G at position 14. (ii) The panel of mutants examined collectively deleted the entire 3' nontranslated region. Only mutants in which 8 nucleotides in the 3' terminal 19 nucleotides had been deleted or in which the 3' terminal C was deleted were nonviable. Although the 3' terminal C was essential for replication, it could be displaced by at least 7 nucleotides from its 3' terminal position adjacent to the poly(A) tract.(ABSTRACT TRUNCATED AT 400 WORDS)