Large contributions of coupled protonation equilibria to the observed enthalpy and heat capacity changes for ssDNA binding to Escherichia coli SSB protein

Many macromolecular interactions, including protein‐nucleic acid interactions, are accompanied by a substantial negative heat capacity change, the molecular origins of which have generated substantial interest. We have shown previously that temperature‐dependent unstacking of the bases within oligo(dA) upon binding to the Escherichia coli SSB tetramer dominates the binding enthalpy, ΔH_obs, and accounts for as much as a half of the observed heat capacity change, ΔC_p. However, there is still a substantial ΔC_p associated with SSB binding to ssDNA, such as oligo(dT), that does not undergo substantial base stacking. In an attempt to determine the origins of this heat capacity change, we have examined by isothermal titration calorimetry (ITC) the equilibrium binding of dT(pT)₃₄ to SSB over a broad pH range (pH 5.0–10.0) at 0.02 M, 0.2 M NaCl and 1 M NaCl (25°C), and as a function of temperature at pH 8.1. A net protonation of the SSB protein occurs upon dT(pT)₃₄ binding over this entire pH range, with contributions from at least three sets of protonation sites (pK_a1 = 5.9–6.6, pK_a2 = 8.2–8.4, and pK_a3 = 10.2–10.3) and these protonation equilibria contribute substantially to the observed ΔH and ΔC_p for the SSB‐dT(pT)₃₄ interaction. The contribution of this coupled protonation (∼ −260 to −320 cal mol⁻¹ K⁻¹) accounts for as much as half of the total ΔC_p. The values of the “intrinsic” ΔC_p,0 range from −210 ± 33 cal mol⁻¹ °K⁻¹ to −237 ± 36 cal mol⁻¹K⁻¹, independent of [NaCl]. These results indicate that the coupling of a temperature‐dependent protonation equilibria to a macromolecular interaction can result in a large negative ΔC_p, and this finding needs to be considered in interpretations of the molecular origins of heat capacity changes associated with ligand‐macromolecular interactions, as well as protein folding. Proteins 2000;Suppl 4:8–22. © 2000 Wiley‐Liss, Inc.     

Shape readout of AT‐rich DNA by carbohydrates

Gene expression can be altered by small molecules that target DNA; sequence as well as shape selectivities are both extremely important for DNA recognition by intercalating and groove‐binding ligands. We have characterized a carbohydrate scaffold (1) exhibiting DNA “shape readout” properties. Thermodynamic studies with 1 and model duplex DNAs demonstrate the molecule's high affinity and selectivity towards B* form (continuous AT‐rich) DNA. Isothermal titration calorimetry (ITC), circular dichroism (CD) titration, ultraviolet (UV) thermal denaturation, and Differential Scanning Calorimetry were used to characterize the binding of 1 with a B* form AT‐rich DNA duplex d[5′‐G₂A₆T₆C₂‐3′]. The binding constant was determined using ITC at various temperatures, salt concentrations, and pH. ITC titrations were fit using a two‐binding site model. The first binding event was shown to have a 1:1 binding stoichiometry and was predominantly entropy‐driven with a binding constant of approximately 10⁸ M^?1. ITC‐derived binding enthalpies were used to obtain the binding‐induced change in heat capacity (ΔC_p) of ?225 ± 19 cal/mol·K. The ionic strength dependence of the binding constant indicated a significant electrolytic contribution in ligand:DNA binding, with approximately four to five ion pairs involved in binding. Ligand 1 displayed a significantly higher affinity towards AT‐tract DNA over sequences containing GC inserts, and binding experiments revealed the order of binding affinity for 1 with DNA duplexes: contiguous B* form AT‐rich DNA (d[5′‐G₂A₆T₆C₂‐3′]) >B form alternate AT‐rich DNA (d[5′‐G₂(AT)₆C_2‐3′]) > A form GC‐rich DNA (d[5′‐A₂G₆C₆T₂‐3′]), demonstrating the preference of ligand 1 for B* form DNA. © 2013 Wiley Periodicals, Inc. Biopolymers 101: 720–732, 2014.     

Direct Measurement of the Thermodynamics of Chiral Recognition in Bile Salt Micelles

Isothermal titration calorimetry (ITC) is shown to be a sensitive reporter of bile salt micellization and chiral recognition. Detailed ITC characterization of bile micelle formation as well as the chiral recognition capabilities of sodium cholate (NaC), deoxycholate (NaDC), and taurodeoxycholate (NaTDC) micelle systems are reported. The ΔH_demic of these bile salt micelle systems is directly observable and is strongly temperature‐dependent, allowing also for the determination of ΔCp_demic. Using the pseudo‐phase separation model, ΔG_demic and TΔS_demic were also calculated. Chirally selective guest–host binding of model racemic compounds 1,1’‐bi‐2‐napthol (BN) and 1,1’‐binaphthyl‐2,2’‐diylhydrogenphosphate (BNDHP) to bile salt micelles was then investigated. The S‐isomer was shown to bind more tightly to the bile salt micelles in all cases. A model was developed that allows for the quantitative determination of the enthalpic difference in binding affinity that corresponds to chiral selectivity, which is on the order of 1 kJ mol^‐1. Chirality 28:290–298, 2016. © 2016 Wiley Periodicals, Inc.     

Salt bridge exchange binding mechanism between streptavidin and its DNA aptamer – thermodynamics and spectroscopic evidences

Protein‐nucleic acids binding driven by electrostatic interactions typically are characterized by the release of counter ions, and the salt‐inhibited binding association constant (K_a) and the magnitude of exothermic binding enthalpy (ΔH). Here, we report a non‐classical thermodynamics of streptavidin (SA)–aptamer binding in NaCl (140–350 mM) solutions near room temperatures (23–27 °C). By using isothermal titration calorimetry (ITC) and circular dichroism (CD)/fluorescence spectroscopy, we found that the binding was enthalpy driven with a large entropy cost (ΔH ?20.58 kcal mol^?1, TΔS ?10.99 kcal mol^?1, and K_a 1.08 × 10⁷ M^?1 at 140 mM NaCl 25 °C). With the raise of salt concentrations, the ΔH became more exothermic, yet the K_a was almost unchanged (ΔH ?26.29 kcal mol^?1 and K_a 1.50 × 10⁷ M^?1 at 350 mM NaCl 25 °C). The data suggest that no counter Na⁺ was released in the binding. Spectroscopy data suggest that the binding, with a stoichiometry of 2, was accompanied with substantial conformational changes on SA, and the changes were insensitive to the variation of salt concentrations. To account for the non‐classical results, we propose a salt bridge exchange model. The intramolecular binding‐site salt bridge(s) of the free SA and the charged phosphate group of aptamers re‐organize to form the binding complex by forming a new intermolecular salt bridge(s). The salt bridge exchange binding process requires minimum amount of counter ions releasing but dehydration of the contacting surface of SA and the aptamer. The energy required for dehydration is reduced in the case of binding solution with higher salt concentration and account for the higher binding exothermic mainly. Copyright © 2013 John Wiley & Sons, Ltd.     

An insight to the binding of ellagic acid with human serum albumin using spectroscopic and isothermal calorimetry studies

Ellagic acid (EA), a natural polyphenol evidence several pharmacological benefits. The binding profile of EA with human serum albumin (HSA) has been explored and investigated by Isothermal titration calorimetry (ITC), circular dichroism (CD) spectroscopy, time-correlated single-photon counting (TCSPC), absorbance spectroscopy, steady-state fluorescence spectroscopy, and modelling studies. The ITC data analysis revealed the binding Constant (K_a), ΔH, ΔS and ΔG values to be 15.5×10⁴M^?1, ?116.2±18.1 Kcal mol^?1, ?366 cal mol^?1K^?1 and ?7.13 Kcal mol^?1 respectively with a unique binding site at HSA. EA effectively quenched the intrinsic fluorescence of HSA by static quenching, whereas TCSPC data also revealed association of dynamic quenching also. Thermodynamic analysis confirmed that hydrophobic and mainly hydrogen bonding interaction played important role in stabilizing the HSA-EA complex. It further dictates the binding reaction to be enthalpy driven. The secondary structure of HSA was altered upon binding with EA. CD spectroscopic data indicated the fraction of alpha helicity to be decreased from 52% to 40% upon binding to EA. This study will provide an insight on evaluation of this bioactive interaction during transport and releasing efficiency at the target site in human physiological system since HSA is the most important carrier protein in blood serum.     

Binding of netropsin and 4,6-diamidino-2-phenylindole to an A2T2 DNA hairpin: a comparison of biophysical techniques

Isothermal titration calorimetry (ITC), differential scanning calorimetry (DSC), and biosensor-surface plasmon resonance (SPR) are evaluated for their accuracy in determining equilibrium constants, ease of use, and range of application. Systems chosen for comparison of the three techniques were the formation of complexes between two minor groove binding compounds, netropsin and 4,6-diamidino-2-phenylindole (DAPI), and a DNA hairpin having the sequence 5'-d(CGAATTCGTCTCCGAATTCG)-3'. These systems were chosen for their structural differences, simplicity (1:1 binding), and binding affinity in the range of interest (K approximately 10(8) M(-1)). The binding affinities determined from all three techniques were in excellent agreement; for example, netropsin/DNA formation constants were determined to be K = 1.7x10(8) M(-1) (ITC), K = 2.4x10(8) M(-1) (DSC), and K = 2.9x10(8) M(-1) (SPR). DSC and SPR techniques have an advantage over ITC in studies of ligands that bind with affinities greater than 10(8) M(-1). The ITC technique has the advantage of determining a full set of thermodynamic parameters, including deltaH, TdeltaS, and deltaC(p) in addition to deltaG (or K). The ITC data revealed complex binding behavior in these minor groove binding systems not detected in the other methods. All three techniques provide accurate estimates of binding affinity, and each has unique benefits for drug binding studies.     

Evaluation of Staphylococcus aureus DNA aptamer by enzyme‐linked aptamer assay and isothermal titration calorimetry

To monitor the specificity of Staphylococcus aureus aptamer (SA‐31) against its target cell, we used enzyme‐linked aptamer assay. In the presence of target cell, horseradish peroxidase–conjugated streptavidin bound to biotin‐labeled SA‐31 showed specific binding to S   aureus among 3 different bacteria with limit of detection of 10³ colony‐forming unit per milliliter. The apparent K _a was 1.39 μM⁻¹ ± 0.3 μM⁻¹. The binding of SA‐31 to membrane proteins extracted from cell surface was characterized using isothermal titration calorimetry, and the effect of changes in binding temperature and salt concentrations of binding buffer was evaluated based on thermodynamic parameters (K _a, ΔH , and ΔG ). Since binding of aptamer to its targets solely depends on its 3‐dimensional structure under experimental conditions used in selection process, the change in temperature and ion concentration changed the affinity of SA‐31 to its target on surface of bacteria. At 4°C, SA‐31 did not show an affinity to its target with poor heat change upon injection of membrane fraction to aptamer solution. However, the apparent association constants of SA‐31 slightly varied from K _a = 1.56 μM⁻¹ ± 0.69 μM⁻¹ at 25°C to K _a = 1.03 μM⁻¹ ± 0.9 μM⁻¹ at 37°C. At spontaneously occurring exothermic binding reactions, affinities of S  aureus aptamer to its target were also 9.44 μM⁻¹ ± 0.38 μM⁻¹ at 50mM, 1.60 μM⁻¹ ± 0.11 μM⁻¹ at 137mM, and 3.28 μM⁻¹ ± 0.46 μM⁻¹ at 200 mM of salt concentration. In this study, it was demonstrated that enzyme‐linked aptamer assay and isothermal titration calorimetry were useful tools for studying the fundamental binding mechanism between a DNA aptamer and its target on the outer surface of S  aureus .     

Simultaneous determination of thermodynamic and kinetic parameters of aminopolycarbonate complexes of cobalt(II) and nickel(II) based on isothermal titration calorimetry data

The influence of the different side chain residues on the thermodynamic and kinetic parameters for complexation reactions of the Co²⁺ and Ni²⁺ ions has been investigated by using the isothermal titration calorimetry (ITC) technique supported by potentiometric titration data. The study was concerned with the 2 common tripodal aminocarboxylate ligands, namely, nitrilotriacetic acid and N‐(2‐hydroxyethyl) iminodiacetic acid. Calorimetric measurements (ITC) were run in the 2‐(N‐morpholino)ethanesulfonic acid hydrate (2‐(N‐morpholino) ethanesulfonic acid), piperazine‐N ,N ′‐bis(2‐ethanesulfonic acid), and dimethylarsenic acid buffers (0.1 mol L⁻¹, pH 6) at 298.15 K. The quantification of the metal‐buffer interactions and their incorporation into the ITC data analysis enabled to obtain the pH‐independent and buffer‐independent thermodynamic parameters (K , ΔG , ΔH , and ΔS ) for the reactions under study. Furthermore, the kinITC method was applied to obtain kinetic information on complexation reactions from the ITC data. Correlations, based on kinetic and thermodynamic data, between the kinetics of formation of Co²⁺ and Ni²⁺ complexes and their thermodynamic stabilities are discussed.     

An insight into the thermodynamic characteristics of human thrombopoietin complexation with TN1 antibody

Human thrombopoietin (hTPO) primarily stimulates megakaryocytopoiesis and platelet production and is neutralized by the mouse TN1 antibody. The thermodynamic characteristics of TN1 antibody–hTPO complexation were analyzed by isothermal titration calorimetry (ITC) using an antigen‐binding fragment (Fab) derived from the TN1 antibody (TN1‐Fab). To clarify the mechanism by which hTPO is recognized by TN1‐Fab the conformation of free TN1‐Fab was determined to a resolution of 2.0 Å using X‐ray crystallography and compared with the hTPO‐bound form of TN1‐Fab determined by a previous study. This structural comparison revealed that the conformation of TN1‐Fab does not substantially change after hTPO binding and a set of 15 water molecules is released from the antigen‐binding site (paratope) of TN1‐Fab upon hTPO complexation. Interestingly, the heat capacity change (ΔCp) measured by ITC (?1.52 ± 0.05 kJ mol^?1 K^?1) differed significantly from calculations based upon the X‐ray structure data of the hTPO‐bound and unbound forms of TN1‐Fab (?1.02 ～ 0.25 kJ mol^?1 K^?1) suggesting that hTPO undergoes an induced‐fit conformational change combined with significant desolvation upon TN1‐Fab binding. The results shed light on the structural biology associated with neutralizing antibody recognition.     

Thermodynamic characterization of the multivalent binding of chartreusin to DNA

Characterization of the thermodynamics of DNA– drug interactions is a very useful part in rational drug design. Isothermal titration calorimetry (ITC), differential scanning calorimetry (DSC) and UV melting experiments have been used to analyze the multivalent (intercalation plus minor groove) binding of the antitumor antibiotic chartreusin to DNA. Using DNA UV melting studies in the presence of the ligand and the binding enthalpy determined by ITC, we determined that the binding constant for the interaction was 3.6 × 10⁵ M^–1 at 20°C, in a solution containing 18 mM Na⁺. The DNA–drug interaction was enthalpy driven, with a ΔH_b of –7.07 kcal/mol at 20°C. Binding enthalpies were determined by ITC in the 20–35°C range and used to calculate a binding-induced change in heat capacity (ΔCp) of –391 cal/mol K. We have obtained a detailed thermodynamic profile for the interaction of this multivalent drug, which makes possible a dissection of ΔG_obs into the component free energy terms. The hydrophobic transfer of the chartreusin chromophore from the solution to the DNA intercalating site is the main contributor to the free energy of binding.     

The energetics of HMG box interactions with DNA: thermodynamics of the DNA binding of the HMG box from mouse sox-5

The energetics of the Sox-5 HMG box interaction with DNA duplexes, containing the recognition sequence AACAAT, were studied by fluorescence spectroscopy, isothermal titration calorimetry (ITC) and differential scanning calorimetry (DSC). Fluorescence titration showed that the association constant of this HMG box with the duplexes is of the order 4x10(7) M(-1), increasing somewhat with temperature rise, i.e. the Gibbs energy is -40 kJ mol(-1) at 5 degrees C, decreasing to -48 kJ mol(-1) at 32 degrees C. ITC measurements of the enthalpy of association over this temperature range showed an endothermic effect below 17 degrees C and an exothermic effect above, suggesting a heat capacity change on binding of about -4 kJ K(-1) mol(-1), a value twice larger than expected from structural considerations. A straightforward interpretation of ITC data in heat capacity terms assumes, however, that the heat capacities of all participants in the association reaction do not change over the considered temperature range. Our previous studies showed that over the temperature range of the ITC experiments the HMG box of Sox-5 starts to unfold, absorbing heat and the heat capacities of the DNA duplexes also increase significantly. These heat capacity effects differ from that of the DNA/Sox-5 complex. Correcting the ITC measured binding enthalpies for the heat capacity changes of the components and complex yielded the net enthalpies which exhibit a temperature dependence of about -2 kJ K(-1) mol(-1), in good agreement with that predicted on the basis of dehydration of the protein-DNA interface. Using the derived heat capacity change and the enthalpy and Gibbs energy of association measured at 5 degrees C, the net enthalpy and entropy of association of the fully folded HMG box with the target DNA duplexes was determined over a broad temperature range. These functions were compared with those for other known cases of sequence specific DNA/protein association. It appears that the enthalpy and entropy of association of minor groove binding proteins are more positive than for proteins binding in the major groove. The observed thermodynamic characteristics of protein binding to the A+T-rich minor groove of DNA might result from dehydration of both polar and non-polar groups at the interface and release of counterions. The expected entropy of dehydration was calculated and found to be too large to be compensated by the negative entropy of reduction of translational/rotational freedom. This implies that DNA/HMG box association proceeds with significant decrease of conformational entropy, i.e. reduction in conformational mobility.     

A more detailed picture of the interactions between virtual screening-derived hits and the DNA G-quadruplex: NMR, molecular modelling and ITC studies

The growing amount of literature about G-quadruplex DNA clearly demonstrates that such a structure is no longer viewed as just a biophysical strangeness but it is instead being considered as an important target for the treatment of various human disorders such as cancers or venous thrombosis. In this scenario, with the aim of finding brand new molecular scaffolds able to interact with the groove of the DNA quadruplex [d(TGGGGT)]₄, we recently performed a successful structure-based virtual screening (VS) campaign. As a result, six molecules were found to be somehow groove binders. Herein, we report the results of novel NMR titration experiments of these VS-derived ligands with modified quadruplexes, namely [d(TGG^BrGGT)]₄ and [d(TGGGG^BrT)]₄. The novel NMR spectroscopy experiments combined with molecular modelling studies, allow for a more detailed picture of the interaction between each binder and the quadruplex DNA. Noteworthy, isothermal titration calorimetry (ITC) measurements on the above-mentioned compounds revealed that 2, 4, and 6 besides their relatively small dimensions bind the DNA quadruplex [d(TGGGGT)]₄ with higher affinity than distamycin A, to the best of our knowledge, the most potent groove binder identified thus far.     

Label-free detection of enhanced saccharide binding at pH 7.4 to nanoparticulate benzoboroxole based receptor units

Nanoparticles modified with either 6-amino-1-hydroxy-2,1-benzoxaborolane (3-aminobenzoboroxole) or 3-aminophenylboronic acid were prepared by nucleophilic substitution of a styrene-co-DVB-co-vinylbenzylchloride latex (25 nm). Isothermal titration calorimetry (ITC) was used as a label-free detection method for the analysis of the binding between monosaccharides and these two differently derivatized nanoparticle systems at pH 7.4. Because ITC reveals, thermodynamical parameters such as the changes in enthalpy ΔH, free energy ΔG, and entropy ΔS, possible explanations for the higher binding constants can be derived in terms of entropy and enthalpy changes. In case of the modified nanoparticles, the free energy of binding is dominated by the entropy term. This shows that interfacial effects, besides the intrinsic affinity, lead to a higher binding constant compared with the free ligand. The highest binding constant was found for fructose binding to the benzoboroxole modified nanoparticles: Its value of 1150 M(-1) is twice as high as for the free benzoboroxole and five times as high as with phenylboronic acid or 3-aminophenylboronic acid. In contrast to the binding of fructose to free boronic acids, which is an enthalpically driven process, the binding of fructose to the modified nanoparticles is dominated by the positive entropy term.     

Non-intercalative,Deoxyribose Binding of Boric Acid to Calf Thymus DNA

The present study characterizes the effects of the boric acid binding on calf thymus DNA (ct-DNA) by spectroscopic and calorimetric methods. UV–Vis absorbance spectroscopy, circular dichroism (CD) spectroscopy, transmission electron microscopy (TEM), isothermal titration calorimetry (ITC), and Fourier transform infrared (FT-IR) spectroscopy were employed to characterize binding properties. Changes in the secondary structure of ct-DNA were determined by CD spectroscopy. Sizes and morphologies of boric acid–DNA complexes were determined by transmission electron microscopy (TEM). The kinetics of boric acid binding to calf thymus DNA (ct-DNA) was investigated by isothermal titration calorimetry (ITC). ITC results revealed that boric acid exhibits a moderate affinity to ct-DNA with a binding constant (K _a) of 9.54?×?10⁴ M^?1. FT-IR results revealed that boric acid binds to the deoxyribose sugar of DNA without disrupting the B-conformation at tested concentrations.     

NOVEL CLASS OF DNA BINDING MOTIFS BASED ON BISTETRAHYDROFURAN AND BISFURAN SKELETON WITH LONG ALKYL CHAINS

Small molecules with DNA-binding affinity within the minor groove have become of great interest. In this paper, new DNA binding molecules; diamino-bistetrahydrofuran (bisTHF) and diamino-bisfuran are reported. The bisTHF ligand with RR configuration at the amino groups and C8 alkyl chains (RR8) stabilized GC-rich duplex. In contrast, bisfuran compounds stabilized AT-rich duplex. The binding affinity of RR8 with 12 mer duplex DNA was determined by isothermal titration calorimetry to be 3.3 × 10⁸ M^?1.     

Spectroscopic and calorimetric studies on the DNA recognition of pyrrolo[2,1-c][1,4]benzodiazepine hybrids

DNA binding of two hybrid ligands composed of an alkylating pyrrolo[2,1-c][1,4]benzodiazepine (PBD) moiety tethered to either a naphthalimide or a phenyl benzimidazole chromophore was studied by DNA melting experiments, UV and fluorescence titrations, CD spectroscopy and isothermal titration calorimetry (ITC). Binding of both hybrids results in a remarkable thermal stabilization with an increase of DNA melting temperatures by up to 40 °C for duplexes that allow for a covalent attachment of the PBD moiety to guanine bases in their minor groove. CD spectroscopic measurements suggest that the naphthalimide moiety of the drug interacts through intercalation. In contrast, the PBD-benzimidazole hybrid binds in the DNA minor groove with a preference for (A,T)₄G sequences. Whereas the binding of both ligands is enthalpy-driven and associated with a negative entropy, the benzimidazole hybrid exhibits a less favourable binding enthalpy that is counterbalanced by a more favourable entropic term when compared to the naphthalimide hybrid.     

Melting studies of short DNA hairpins: Influence of loop sequence and adjoining base pair identity on hairpin thermodynamic stability

Spectroscopic and calorimetric melting studies of 28 DNA hairpins were performed. These hairpins form by intramolecular folding of 16 base self‐complementary DNA oligomer sequences. Sequence design dictated that the hairpin structures have a six base pair duplex linked by a four base loop and that the first five base pairs in the stem are the same in every molecule. Only loop sequence and identity of the duplex base pair closing the loop vary for the set of hairpins. For these DNA samples, melting studies were carried out to investigate effects of the variables on hairpin stability. Stability of the 28 oligomers was ascertained from their temperature‐induced melting transitions in buffered 115 mM Na⁺ solvent, monitored by ultraviolet absorbance and differential scanning calorimetry (DSC). Experiments revealed the melting temperatures of these molecules range from 32.4 to 60.5°C and are concentration independent over strand concentrations of 0.5 to 260 μM; thus, as expected for hairpins, the melting transitions are apparently unimolecular. Model independent thermodynamic transition parameters, ΔH_cal, ΔS_cal, and ΔG_cal, were determined from DSC measurements. Model dependent transition parameters, ΔH_vH, ΔS_vH, and ΔG_vH were estimated from a van't Hoff (two‐state) analysis of optical melting transitions. Results of these studies reveal a significant sequence dependence to DNA hairpin stability. Thermodynamic parameters evaluated by either procedure reveal the transition enthalpy, ΔH_cal (ΔH_vH) can differ by as much as 20 kcal/mol depending on sequence. Similarly, values of the transition entropy ΔS_cal (ΔS_vH) can differ by as much as 60 cal/Kmol (eu) for different molecules. Differences in free energies ΔG_cal (ΔG_vH) are as large as 4 kcal/mol for hairpins with different sequences. Comparisons between the model independent calorimetric values and the thermodynamic parameters evaluated assuming a two‐state model reveal that 10 of the 28 hairpins display non‐two‐state melting behavior. The database of sequence‐dependent melting free energies obtained for the hairpins was employed to extract a set of n‐n (nearest‐neighbor) sequence dependent loop parameters that were able to reproduce the input data within error (with only two exceptions). Surprisingly, this suggests that the thermodynamic stability of the DNA hairpins can in large part be reasonably represented in terms of sums of appropriate nearest‐neighbor loop sequence parameters. © 1999 John Wiley & Sons, Inc. Biopoly 50: 425–442, 1999     

Exploring the binding mode of donepezil with calf thymus DNA using spectroscopic and molecular docking methods

Donepezil (DNP) is one of approved drugs to treat Alzheimer's disease (AD). However, the potential effect of DNP on DNA is still unclear. Therefore, the interaction of DNP with calf thymus DNA (DNA) was studied in vitro using spectroscopic and molecular docking methods. Steady‐state and transient fluorescence experiments showed that there was a clear binding interaction between DNP and DNA, resulting from DNP fluorescence being quenched using DNA. DNP and DNA have one binding site between them, and the binding constant (K_b) was 0.78 × 10⁴ L·mol^?1 at 298 K. In this binding process, hydrophobic force was the main interaction force, because enthalpy change (ΔH) and entropy change (ΔS) of DNP–DNA were 67.92 kJ·mol^?1 and 302.96 J·mol^?1·K^?1, respectively. DNP bound to DNA in a groove‐binding mode, which was verified using a competition displacement study and other typical spectroscopic methods. Fourier transform infrared (FTIR) spectrum results showed that DNP interacted with guanine (G) and cytosine (C) bases of DNA. The molecular docking results further supported the results of spectroscopic experiments, and suggested that both Pi‐Sigma force and Pi‐Alkyl force were the major hydrophobic force functioning between DNP and DNA.     

Structural and functional studies on a variant of cystatin purified from brain of Capra hircus

Cystatins, known for their ubiquitous presence in mammalian system are thiol protease inhibitors serving important physiological functions. Here, we present a variant of cystatin isolated from brain of Capra hircus (goat) which is glycosylated but lacks disulphide bonds. Caprine brain cystatin (CBC) was isolated using alkaline treatment, ammonium sulphate fractionation (40–60%) and gel filtration chromatography on Sephacryl S-100HR column with an overall yield of 26.29% and 322-fold purification. The inhibitor gave a molecular mass of ~44 kDa as determined by SDS-PAGE and gel filtration behaviour. The Stokes radius and diffusion coefficient of CBC were 27.14 Å and 8.18 × 10^?7 cm² s^?1, respectively. Kinetic data revealed that CBC inhibited thiol proteases reversibly and competitively, with the highest inhibition towards papain (K_i = 4.10 nM) followed by ficin and bromelain. CBC possessed 34.7% α-helical content as observed by CD spectroscopy. UV, fluorescence, CD and FTIR spectroscopy revealed significant conformational change upon CBC-papain complex formation. Isothermal titration calorimetry (ITC) was used to measure the thermodynamic parameters – ΔH, ΔS, ΔG along with N (binding stoichiometry) for CBC-papain complex formation. Binding stoichiometry (N = .97 ± .07 sites) for the CBC-papain complex indicates that cystatin is surrounded by nearly one papain molecule. Negative ΔH (?5.78 kcal mol^?1) and positive ΔS (11.01 cal mol^?1 deg^?1) values suggest that the interaction between CBC and papain is enthalpically as well as entropically favoured process. The overall negative ΔG (?9.19 kcal mol^?1) value implies a spontaneous CBC-papain interaction.