Sequence requirements for binding of Rep68 to the adeno-associated virus terminal repeats.

We have used reciprocal competition binding experiments with mutant substrates and chemical modification interference assays to precisely define the sequences within the adeno-associated virus (AAV) terminal repeat (TR) that are involved in site-specific binding to the AAV Rep protein. Mutagenesis experiments were done with a 43-bp oligonucleotide which contained the Rep binding element (RBE) within the A stem of the TR. Experiments in which two adjacent base pairs of the RBE were substituted simultaneously with nucleotides that produced transversions identified a 22-bp sequence (CAGTGAGCGAGCGAGCGCGCAG) in which substitutions measurably affected the binding affinity. Although the 22-bp RBE contains the GAGC motifs that have been found in all known Rep binding sites, our results suggest that the GAGC motifs alone are not the only sequences specifically recognized by Rep. The effects of substitutions within the 22-bp sequence were relatively symmetrical, with nucleotides at the periphery of the RBE having the least effect on binding affinity and those in the middle having the greatest effect. Dinucleotide mutations within 18 (GTGAGCGAGCGAGC) of the 22 bp were found to decrease the binding affinity by at least threefold. Dinucleotide mutations within a 10-bp core sequence (GCGAGCGAGC) were found to decrease binding affinity by more than 10-fold. Single-base substitutions within the 10-bp core sequence lowered the binding affinity by variable amounts (up to fivefold). The results of the mutagenesis analysis suggested that the A-stem RBE contains only a single Rep binding site rather than two or more independent sites. To confirm the results of the mutant analysis and to determine the relative contribution of each base to binding, chemical modification experiments using dimethyl sulfate and hydrazine were performed on both the linear A-stem sequence and the entire AAV TR in both the flip and flop hairpinned configurations. Interference assays on the linear A stem identified the 18-bp sequence described above as essential for binding. G, C, and T residues on both strands contributed to binding, and the interference pattern correlated well with the results of the mutagenesis experiments. Interference assays with complete hairpinned TR substrates also identified the 18-bp sequence as important for binding. However, the interference patterns on the two strands within the RBE and the relative contributions of the individual bases to binding were clearly different between the hairpinned substrates and the linear A-stem binding element. Interference assays also allowed us to search for residues within the small internal palindromes of the TR (B and C) that contribute to binding. The largest effect was seen by modification of two T residues within the sequence CTTTG. This sequence was present in the same position relative to the terminal resolution site (trs) in both the flip and flop orientations of the TR. In addition, the interference pattern suggested that the remaining bases within the CTTTG motif as well as other bases within the B and C palindromes make contacts with the Rep protein, albeit with lower affinities. Regardless of whether the TR was in the flip or flop orientation, most of the contact points were clustered in the small internal palindrome furthest away from the trs. We also determined the relative binding affinity of linear substrates containing a complete RBE with hairpinned substrates and found that linear substrates bound Rep less efficiently. Our results were consistent with our previous model that there are three distinct elements within the hairpinned AAV TR that contribute to binding affinity or to efficient nicking at the trs: the A-stem RBE, the secondary structure element which consists of the B and C palindromes, and the trs.     

Interaction of wild-type and mutant adeno-associated virus (AAV) Rep proteins on AAV hairpin DNA.

Both the Rep68 and Rep78 proteins of adeno-associated virus type 2 (AAV) bind to AAV terminal repeat hairpin DNA and can mediate site-specific nicking in vitro at the terminal resolution site (trs) within the terminal repeats. To define the regions of the Rep proteins required for these functions, a series of truncated Rep78 derivatives was created. Wild-type and mutant proteins were synthesized by in vitro translation and analyzed for AAV hairpin DNA binding, trs endonuclease activity, and interaction on hairpin DNA. Amino-terminal deletion mutants which lacked the first 29 or 79 amino acid residues of Rep78 did not bind hairpin DNA, which is consistent with our previous identification of a DNA-binding domain in this region. Progressive truncation of the carboxyl-terminal region of Rep78 did not eliminate hairpin DNA binding until the deletion reached amino acid 443. The electrophoretic mobility of the Rep-specific protein-DNA complexes was inversely related to the molecular weight of the Rep derivative. Analysis of the C-terminal deletion mutants by the trs endonuclease assay identified a region (amino acids 467 to 476) that is essential for nicking but is not necessary for DNA binding. When endonuclease-positive, truncated Rep proteins that bound hairpin DNA were mixed with full-length Rep78 or Rep68 protein in electrophoretic mobility shift assays, a smear of protein-DNA complexes was observed. This smear migrated at an intermediate position with respect to the bands generated by the proteins individually. An antibody recognizing only the full-length protein produced a novel supershift band when included in a mixed binding assay containing Rep68 and a truncated Rep mutant. These experiments suggest that the Rep proteins can form hetero-oligomers on the AAV hairpin DNA.     

Features of the adeno-associated virus origin involved in substrate recognition by the viral Rep protein.

We previously demonstrated that the adeno-associated virus (AAV) Rep68 and Rep78 proteins are able to nick the AAV origin of DNA replication at the terminal resolution site (trs) in an ATP-dependent manner. Using four types of modified or mutant substrates, we now have investigated the substrate requirements of Rep68 in the trs endonuclease reaction. In the first kind of substrate, portions of the hairpinned AAV terminal repeat were deleted. Only deletions that retained virtually all of the small internal palindromes of the AAV terminal repeat were active in the endonuclease reaction. This result confirmed previous genetic and biochemical evidence that the secondary structure of the terminal repeat was an important feature for substrate recognition. In the second type of substrate, the trs was moved eight bases further away from the end of the genome. The mutant was nicked at a 50-fold-lower frequency relative to a wild-type origin, and the nick occurred at the correct trs sequence despite its new position. This finding indicated that the endonuclease reaction required a specific sequence at the trs in addition to the correct secondary structure. It also suggested that the minimum trs recognition sequence extended three bases from the cut site in the 3' direction. The third type of substrate harbored mismatched base pairs at the trs. The mismatch substrates contained a wild-type sequence on the strand normally cut but an incorrect sequence on the complementary strand. All of the mismatch mutants were capable of being nicked in the presence of ATP. However, there was substantial variation in the level of activity, suggesting that the sequence on the opposite strand may also be recognized during nicking. Analysis of the mismatch mutants also suggested that a single-stranded trs was a viable substrate for the enzyme. This interpretation was confirmed by analysis of the fourth type of substrate tested, which contained a single-stranded trs. This substrate was also cleaved efficiently by the enzyme provided that the correct strand was present in the substrate. In addition, the single-stranded substrate no longer required ATP as a cofactor for nicking. Finally, all of the substrates with mutant trss bound the Rep protein as efficiently as the wild-type did. This finding indicated that the sequence at the cut site was not involved in recognition of the terminal repeat for specific binding by the enzyme. We concluded that substrate recognition by the AAV Rep protein involves at least two and possibly as many as four features of the AAV terminal repeat.(ABSTRACT TRUNCATED AT 400 WORDS)     

Rep-Mediated Nicking of the Adeno-Associated Virus Origin Requires Two Biochemical Activities, DNA Helicase Activity and Transesterification

The single-stranded adeno-associated virus (AAV) genome is flanked by terminal hairpinned origins of DNA replication (terminal repeats [TRs]) that are nicked at the terminal resolution site (trs) by the AAV Rep protein in an ATP-dependent, site-specific manner. Here we determine the minimal trs sequence necessary for Rep cleavage, 3'-CCGGT/TG-5', and show that this 7-base core sequence is required only on the nicked strand. We also identify a potential stem-loop structure at the trs. Interestingly, Rep nicking on a TR substrate that fixes this trs stem-loop in the extruded form no longer requires ATP. This suggests that ATP-dependent Rep helicase activity is necessary to unwind the duplex trs and extrude the stem-loop structure, prior to the ATP-independent Rep transesterification reaction. The extrusion of origin stem-loop structures prior to nicking appears to be a general mechanism shared by plant and animal viruses and bacterial plasmids. In the case of AAV, this mechanism of TR nicking would provide a possible regulatory function.     

Mechanism of Rep-mediated adeno-associated virus origin nicking

The single-stranded adeno-associated virus type 2 (AAV) genome is flanked by terminal repeats (TRs) that fold back on themselves to form hairpinned structures. During AAV DNA replication, the TRs are nicked by the virus-encoded Rep proteins at the terminal resolution site (trs). This origin function apparently requires three sequence elements, the Rep binding element (RBE), a small palindrome that comprises a single tip of an internal hairpin within the TR (RBE'), and the trs. Previously, we determined the sequences at the trs required for Rep-mediated cleavage and demonstrated that the trs endonuclease reaction occurs in two discrete steps. In the first step, the Rep DNA helicase activity unwinds the TR, thereby extruding a stem-loop structure at the trs. In the second step, Rep transesterification activity cleaves the trs. Here we investigate the contribution of the RBE and RBE' during this process. Our data indicate that Rep is tethered to the RBE in a specific orientation during trs nicking. This orientation appears to align Rep on the AAV TR, allowing specific nucleotide contacts with the RBE' and directing nicking to the trs. Accordingly, alterations in the polarity or position of the RBE relative to the trs greatly inhibit Rep nicking. Substitutions within the RBE' also reduce Rep specific activity, but to a lesser extent. Interestingly, Rep interactions with the RBE and RBE' during nicking seem to be functionally distinct. Rep contacts with the RBE appear necessary for both the DNA helicase and trs cleavage steps of the endonuclease reaction. On the other hand, RBE' contacts seem to be required primarily for TR unwinding and formation of the trs stem-loop structure, not cleavage. Together, these results suggest a model of Rep interaction with the AAV TR during origin nicking through a tripartite cleavage signal comprised of the RBE, the RBE', and the trs.     

Selective cleavage of AAVS1 substrates by the adeno-associated virus type 2 rep68 protein is dependent on topological and sequence constraints

The adeno-associated virus type 2 (AAV-2) Rep78 and Rep68 proteins are required for replication of the virus as well as its site-specific integration into a unique site, called AAVS1, of human chromosome 19. Rep78 and Rep68 initiate replication by binding to a Rep binding site (RBS) contained in the AAV-2 inverted terminal repeats (ITRs) and then specifically nicking at a nearby site called the terminal resolution site (trs). Similarly, Rep78 and Rep68 are postulated to trigger the integration process by binding and nicking RBS and trs homologues present in AAVS1. However, Rep78 and Rep68 cleave in vitro AAVS1 duplex-linear substrates much less efficiently than hairpinned ITRs. In this study, we show that the AAV-2 Rep68 endonuclease activity is affected by the topology of the substrates in that it efficiently cleaves in vitro in a site- and strand-specific manner the AAVS1 trs only if this sequence is in a supercoiled (SC) conformation. DNA sequence mutagenesis in the context of SC templates allowed us to elucidate for the first time the AAVS1 trs sequence and position requirements for Rep68-mediated cleavage. Interestingly, Rep68 did not cleave SC templates containing RBS from other sites of the human genome. These findings have intriguing implications for AAV-2 site-specific integration in vivo.     

Escherichia coli Rep protein and helicase IV. Distributive single-stranded DNA-dependent ATPases that catalyze a limited unwinding reaction in vitro.

Rep protein and helicase IV, two DNA-dependent adenosine 5'-triphosphatases with helicase activity, have been purified from Escherichia coli and characterized. Both enzymes exhibit a distributive interaction with single-stranded DNA as DNA-dependent ATPases in a reaction that is relatively resistant to increasing NaCl concentration and sensitive to the addition of E. coli single-stranded DNA binding protein (SSB). The helicase reaction catalyzed by each protein has been characterized using a direct unwinding assay and partial duplex DNA substrates. Both Rep protein and helicase IV catalyzed the unwinding of a duplex region 71 bp in length. However, unwinding of a 119-bp or 343-bp duplex region was substantially reduced compared to unwinding of the 71-bp substrate. At each concentration of protein examined, the number of base pairs unwound was greatest using the 71-bp substrate, intermediate with the 119-bp substrate and lowest using the 343-bp substrate. The addition of E. coli SSB did not increase the fraction of the 343-nucleotide fragment unwound by Rep protein. However, the addition of SSB did stimulate the unwinding reaction catalyzed by helicase IV approximately twofold. In addition, ionic strength conditions which stabilize duplex DNA (i.e. addition of MgCl2 or NaCl), markedly inhibited the helicase reaction catalyzed by either Rep protein or helicase IV while having little effect on the ATPase reaction. Thus, these two enzymes appear to share a common biochemical mechanism for unwinding duplex DNA which can be described as limited unwinding of duplex DNA. Taken together these data suggest that, in vitro, and in the absence of additional proteins, neither Rep protein nor helicase IV catalyzes a processive unwinding reaction.     

Activation of the ATPase activity of adeno-associated virus Rep68 and Rep78

Rep68 and Rep78 DNA helicases, encoded by adeno-associated virus 2 (AAV2), are required for replication of AAV viral DNA in infected cells. They bind to imperfect palindromic elements in the inverted terminal repeat structures at the 3'- and 5'-ends of virion DNA. The ATPase activity of Rep68 and Rep78 is stimulated up to 10-fold by DNA containing the target sequence derived from the inverted terminal repeat; nontarget DNA stimulates ATPase activity at 50-fold higher concentrations. Activation of ATPase activity of Rep68 by DNA is cooperative with a Hill coefficient of 1.8 +/- 0.2. When examined by gel filtration at 0.5 M NaCl in the absence of DNA, Rep68 self-associates in a concentration-dependent manner. In the presence of DNA containing the binding element, Rep68 (and Rep78) forms protein-DNA complexes that exhibit concentration-dependent self-association in gel filtration analysis. The ATPase activity of the isolated Rep68-DNA and Rep78-DNA complexes is not activated by additional target DNA. Results of sedimentation velocity experiments in the presence of saturating target DNA are consistent with Rep68 forming a hexamer of the protein with two copies of the DNA element. Activation of the ATPase activity of Rep68 is associated with the formation of a protein-DNA oligomer.     

Interaction of Rep and DnaB on DNA

Genome duplication requires not only unwinding of the template but also the displacement of proteins bound to the template, a function performed by replicative helicases located at the fork. However, accessory helicases are also needed since the replicative helicase stalls occasionally at nucleoprotein complexes. In Escherichia coli, the primary and accessory helicases DnaB and Rep translocate along the lagging and leading strand templates, respectively, interact physically and also display cooperativity in the unwinding of model forked DNA substrates. We demonstrate here that this cooperativity is displayed only by Rep and not by other tested helicases. ssDNA must be exposed on the leading strand template to elicit this cooperativity, indicating that forks blocked at protein-DNA complexes contain ssDNA ahead of the leading strand polymerase. However, stable Rep-DnaB complexes can form on linear as well as branched DNA, indicating that Rep has the capacity to interact with ssDNA on either the leading or the lagging strand template at forks. Inhibition of Rep binding to the lagging strand template by competition with SSB might therefore be critical in targeting accessory helicases to the leading strand template, indicating an important role for replisome architecture in promoting accessory helicase function at blocked replisomes.     

Tethered-Hopping Model for Protein-DNA Binding and Unbinding Based on Sox2-Oct1-Hoxb1 Ternary Complex Simulations

The sliding and hopping models encapsulate the essential protein-DNA binding process for binary complex formation and dissociation. However, the effects of a cofactor protein on the protein-DNA binding process that leads to the formation of a ternary complex remain largely unknown. Here we investigate the effect of the cofactor Sox2 on the binding and unbinding of Oct1 with the Hoxb1 control element. We simulate the association of Oct1 with Sox2-Hoxb1 using molecular dynamics simulations, and the dissociation of Oct1 from Sox2-Hoxb1 using steered molecular dynamics simulations, in analogy to a hopping event of Oct1. We compare the kinetic and thermodynamic properties of three model complexes (the wild-type and two mutants) in which the Oct1-DNA base-specific interactions or the Sox2-Oct1 protein-protein interactions are largely abolished. We find that Oct1-DNA base-specific interactions contribute significantly to the total interaction energy of the ternary complex, and that nonspecific Oct1-DNA interactions are sufficient for driving the formation of the protein-DNA interface. The Sox2-Oct1 protein-protein binding interface is largely hydrophobic, with remarkable shape complementarity. This interface promotes the formation of the ternary complex and slows the dissociation of Oct1 from its DNA-binding site. We propose a simple two-step reaction model of protein-DNA binding, called the tethered-hopping model, that explains the importance of the cofactor Sox2 and may apply to similar ternary protein-DNA complexes.     

Kinetics of DNA Unwinding by the RecD2 Helicase from Deinococcus radiodurans

RecD2 from Deinococcus radiodurans is a superfamily 1 DNA helicase that is homologous to the Escherichia coli RecD protein but functions outside the context of RecBCD enzyme. We report here on the kinetics of DNA unwinding by RecD2 under single and multiple turnover conditions. There is little unwinding of 20-bp substrates by preformed RecD2-dsDNA complexes when excess ssDNA is present to trap enzyme molecules not bound to the substrate. A shorter 12-bp substrate is unwound rapidly under single turnover conditions. The 12-bp unwinding reaction could be simulated with a mechanism in which the DNA is unwound in two kinetic steps with rate constant of k_unw = 5.5 s⁻¹ and a dissociation step from partially unwound DNA of k_off = 1.9 s⁻¹. These results indicate a kinetic step size of about 3–4 bp, unwinding rate of about 15–20 bp/s, and low processivity (p = 0.74). The reaction time courses with 20-bp substrates, determined under multiple turnover conditions, could be simulated with a four-step mechanism and rate constant values very similar to those for the 12-bp substrate. The results indicate that the faster unwinding of a DNA substrate with a forked end versus only a 5′-terminal single-stranded extension can be accounted for by a difference in the rate of enzyme binding to the DNA substrates. Analysis of reactions done with different RecD2 concentrations indicates that the enzyme forms an inactive dimer or other oligomer at high enzyme concentrations. RecD2 oligomers can be detected by glutaraldehyde cross-linking but not by size exclusion chromatography.     

The EcoRI-DNA complex as a model for investigating protein-DNA interactions by atomic force microscopy

Atomic force microscopy (AFM) is a technique widely used to image protein-DNA complexes, and its application has now been extended to the measurements of protein-DNA binding constants and specificities. However, the spreading of the protein-DNA complexes on a flat substrate, generally mica, is required prior to AFM imaging. The influence of the surface on protein-DNA interactions is therefore an issue which needs to be addressed. For that purpose, the extensively studied EcoRI-DNA complex was investigated with the aim of providing quantitative information about the surface influence. The equilibrium binding constant of the complex was determined by AFM at both low and high ionic strengths and compared to electrophoretic mobility shift assay measurements (EMSA). In addition, the effect of the DNA length on dissociation of the protein from its specific site was analyzed. It turned out that the AFM measurements are similar to those obtained by EMSA at high ionic strengths. We then advance the idea that this effect is due to the high counterion concentration near the highly negatively charged mica surface. In addition, a dissociation of the complexes once they are adsorbed onto the surface was observed, which is weakly dependent on the ionic strength contrary to what occurs in solution. Finally, a two-step mechanism, which describes the adsorption of the EcoRI-DNA complexes on the surface, is proposed. This model could also be extended to other protein-DNA complexes.     

Growth temperature regulation of some genes that define the superficial capsular carbohydrate composition of Escherichia coli K92

XerC and XerD are members of the tyrosine recombinase family and mediate site-specific recombination that contributes to the stability of circular chromosomes in bacteria by resolving plasmid multimers and chromosome dimers to monomers prior to cell division. Homologues of xerC/xerD genes have been found in many bacteria, and in the lactococci and streptococci, a single recombinase called XerS can perform the functions of XerC and XerD. The xerS gene of Streptococcus suis was cloned, overexpressed and purified as a maltose-binding protein (MBP) fusion. The purified MBP-XerS fusion showed specific DNA-binding activity to both halves of the dif site of S.?suis, and covalent protein-DNA complexes were also detected with dif site suicide substrates. These substrates were also cleaved in a specific fashion by MBP-XerS, generating cleavage products separated by an 11-bp spacer region, unlike the traditional 6-8-bp spacer observed in most tyrosine recombinases. Furthermore, xerS mutants of S.?suis showed significant growth and morphological changes.     

Charge-to-Alanine Mutagenesis of the Adeno-Associated Virus Type 2 Rep78/68 Proteins Yields Temperature-Sensitive and Magnesium-Dependent Variants

The adeno-associated virus type 2 (AAV) replication (Rep) proteins Rep78 and 68 (Rep78/68) exhibit a number of biochemical activities required for AAV replication, including specific binding to a 22-bp region of the terminal repeat, site-specific endonuclease activity, and helicase activity. Individual and clusters of charged amino acids were converted to alanines in an effort to generate a collection of conditionally defective Rep78/68 proteins. Rep78 variants were expressed in human 293 cells and analyzed for their ability to mediate replication of recombinant AAV vectors at various temperatures. The biochemical activities of Rep variants were further characterized in vitro by using Rep68 His-tagged proteins purified from bacteria. The results of these analyses identified a temperature-sensitive (ts) Rep protein (D40,42,44A-78) that exhibited a delayed replication phenotype at 32 degrees C, which exceeded wild-type activity by 48 h. Replication activity was reduced by more than threefold at 37 degrees C and was undetectable at 39 degrees C. Stability of the Rep78 protein paralleled replication levels at each temperature, further supporting a ts phenotype. Replication differences resulted in a 3-log-unit difference in virus yields between the permissive and nonpermissive temperatures (2.2 x 10(6) and 3 x 10(3), respectively), demonstrating that this is a relatively tight mutant. In addition to the ts Rep mutant, we identified a nonconditional mutant with a reduced ability to support viral replication in vivo. Additional characterization of this mutant demonstrated an Mg(2+)-dependent phenotype that was specific to Rep endonuclease activity and did not affect helicase activity. The two mutants described here are unique, in that Rep ts mutants have not previously been described and the D412A Rep mutant represents the first mutant in which the helicase and endonuclease functions can be distinguished biochemically. Further understanding of these mutants should facilitate our understanding of AAV replication and integration, as well as provide novel strategies for production of viral vectors.     

E. coli Rep oligomers are required to initiate DNA unwinding in vitro.

E. coli Rep protein is a 3' to 5' SF1 superfamily DNA helicase which is monomeric in the absence of DNA, but can dimerize upon binding either single-stranded or duplex DNA. A variety of biochemical studies have led to proposals that Rep dimerization is important for its helicase activity; however, recent structural studies of Bacillus stearothermophilus PcrA have led to suggestions that SF1 helicases, such as E. coli Rep and E. coli UvrD, function as monomeric helicases. We have examined the question of whether Rep oligomerization is important for its DNA helicase activity using pre-steady state stopped-flow and chemical quenched-flow kinetic studies of Rep-catalyzed DNA unwinding. The results from four independent experiments demonstrate that Rep oligomerization is required for initiation of DNA helicase activity in vitro. No DNA unwinding is observed when only a Rep monomer is bound to the DNA substrate, even when fluorescent DNA substrates are used that can detect partial unwinding of the first few base-pairs at the ss-ds-DNA junction. In fact, under these conditions, ATP hydrolysis causes dissociation of the Rep monomer from the DNA, rather than DNA unwinding. These studies demonstrate that wild-type Rep monomers are unable to initiate DNA unwinding in vitro, and that oligomerization is required.     

Binding of aromatic donor molecules to lactoperoxidase: proton NMR and optical difference spectroscopic studies

The interaction of aromatic donor molecules with lactoperoxidase (LPO) was studied using 1H-NMR and optical difference spectroscopy techniques. pH dependence of substrate proton resonance line-widths indicated that the binding was facilitated by protonation of an amino acid residue (with pKa of 6.1) which is presumably a distal histidine. Dissociation constants evaluated from both optical difference spectroscopy and 1H-NMR relaxation measurements were found to be an order of magnitude larger than those for binding to horse radish peroxidase (HRP), indicating relatively weak binding of the donors to LPO. The dissociation constants evaluated in presence of excess of I- and SCN- showed a considerable increase in their values, indicating that the iodide and thiocyanate ions compete for binding at the same site. The dissociation constant of the substrate binding was, however, not affected by cyanide binding to the ferric centre of LPO. All these results indicate that the organic substrates bind to LPO away from the ferric center. Comparison of the dissociation constants between the different substrates suggested that hydrogen bonding of the donors with the distal histidine amino acid, and hydrophobic interaction between the donors and the active site contribute significantly towards the associating forces. Free energy, entropy and enthalpy changes associated with the LPO-substrate equilibrium have been evaluated. These thermodynamic parameters were found to be all negative and relatively low compared to those for binding to HRP. The distances of the substrate protons from the ferric center were found to be in the range 9.4-11.1 A which are 2-3 A larger than those reported for the HRP-substrate complexes. These structural informations suggest that the heme in LPO may be more deeply buried in the heme crevice than that in the HRP.     

Studies on the mode of Ku interaction with DNA.

The Ku heterodimer plays a central role in non-homologous end-joining. The binding of recombinant Ku to DNA has been investigated by dynamic light scattering, double-filter binding, fluorescence spectroscopy, and band shift assays. The hydrodynamic radius of Ku in solution is 5.2 nm and does not change when a 25-bp double-strand DNA (dsDNA) fragment (D25) is added, indicating that only one Ku molecule binds to a 25-bp fragment. The dissociation constant (k(d)) for the binding to D25 is 3.8 +/- 0.9 nm. If both ends of the substrate are closed with hairpin loops, Ku is still able to bind with little change in the k(d). The k(d) is not affected by ATP, Mg(2+), or ionic strength. However, the addition of bovine serum albumin decreases the k(d) by 2-fold. DNA substrates of 50 bp can bind two Ku molecules, whereas three molecules are bound to a 75-bp substrate. Data analysis with the Hill equation yields a value of the Hill coefficient (n) close to 1, and the k(d) values for the binding of Ku to both ends of these substrates are the same. Thus, we demonstrate that there is no cooperative interaction among the Ku heterodimers binding longer substrates.     

Magnetic resonance studies of the binding of oligonucleotide substrates to mutants of staphylococcal nuclease

By a combination of NMR docking and model building, the substrate binding site on staphylococcal nuclease was found to accommodate a trinucleotide and to consist of three subsites, each interacting with a single nucleotidyl unit of DNA. Binding of the essential Ca²⁺ activator and substrate cleavage occur between subsites 1 and 2. Hence, catalytically productive binding would span subsites 1 and 2 while nonproductive binding would span subsites 2 and 3. Lys-49 is near subsite 1, and Lys-84 and Tyr-115 interact with substrates at sub site 3 [Weber, D. J., Gittis, A. G., Mullen, G. P., Abeygunawardana, C., Lattman, E. E., Mildvan, A. S. Proteins 13:275–287, 1992]. The proposed locations of these subsites were independently tested by the effects of the K49A, K84A, and Y115A mutations of staphylococcal nuclease on the binding of Mn²⁺, Ca²⁺, and the dinucleotide and trinucleotide substrates, 5′-pdTdA, dTdA, and dTdAdG. These three mutants have previously been shown to be fully active and to have CD and 2D NMR spectra very similar to those of the wild-type enzyme (Chuang, W.-J., Weber, D. J., Gittis, A. G., Mildvan, A. S. Proteins 17:36–48, 1993). All three mutant enzymes and their pdTdA and dTdA complexes (but not their dTdAdG complex) bind Mn²⁺ and Ca²⁺ more weakly than the wild-type enzyme by factors ranging from 2 to 11. The presence of a terminal phosphate as in 5′-pdTdA raises the affinity of the substrate for staphylococcal nuclease and its three mutants by two orders of magnitude and for the corresponding enzyme–metal complexes by three to four orders of magnitude, suggesting that the terminal phosphate is coordinated by the enzyme-bound divalent cation. Such complexation would result in the nonproductive binding of 5′-pdTdA at subsites 2 and 3. Accordingly, the K84A and Y115A mutations significantly weaken the binding of 5′-pdTdA and its metal to staphylococcal nuclease by factors of 2.2 to 37.8, while the K49A mutation has much smaller or no effect. Such nonproductive binding explains the low activity of staphylococcal nuclease with small substrates, especially those With a terminal phosphate. Similarly, the K84A and Y115A mutations weaken the binding of dTdA and its metal complexes to the enzyme by factors of 3.4 to 13.1 while the K49A mutation has smaller effects indicating significant nonproductive binding of dTdA. The trinucleotide dTdAdG binds more tightly to wild-type and mutant staphylococcal nuclease and to its metal complexes than does the dinucleotide dTdA by factors of 2.4 to 12.2, reflecting the occupancy of an additional subsite. Predominantly productive binding of dTdAdG is indicated by the 1.7? to 8.3?fold lower affinities of the K49A, K84A, and Y115A mutants for the trinucleotide and its metal complexes. The largest effects on dTdAdG binding are seen with the Y115A mutation presumably reflecting the dual role of Tyr-115 both in donating a hydrogen bond to a phosphodiester oxygen between subsites 2 and 3 and in stacking onto the guanine base at subsite 3. © 1994 John Wiley & Sons, Inc.