Mitochondrial single-stranded DNA-binding protein is required for mitochondrial DNA replication and development in Drosophila melanogaster

The discovery that several inherited human diseases are caused by mtDNA depletion has led to an increased interest in the replication and maintenance of mtDNA. We have isolated a new mutant in the lopo (low power) gene from Drosophila melanogaster affecting the mitochondrial single-stranded DNA-binding protein (mtSSB), which is one of the key components in mtDNA replication and maintenance. lopo(1) mutants die late in the third instar before completion of metamorphosis because of a failure in cell proliferation. Molecular, histochemical, and physiological experiments show a drastic decrease in mtDNA content that is coupled with the loss of respiration in these mutants. However, the number and morphology of mitochondria are not greatly affected. Immunocytochemical analysis shows that mtSSB is expressed in all tissues but is highly enriched in proliferating tissues and in the developing oocyte. lopo(1) is the first mtSSB mutant in higher eukaryotes, and its analysis demonstrates the essential function of this gene in development, providing an excellent model to study mitochondrial biogenesis in animals.     

Physiological and biochemical defects in functional interactions of mitochondrial DNA polymerase and DNA-binding mutants of single-stranded DNA-binding protein

Functional interactions between mitochondrial DNA polymerase (pol gamma) and mitochondrial single-stranded DNA-binding protein (mtSSB) from Drosophila embryos greatly enhance the overall activity of pol gamma by increasing primer recognition and binding and stimulating the rate of initiation of DNA strands (Farr, C. L., Wang, Y., and Kaguni, L. S. (1999) J. Biol. Chem. 274, 14779-14785). We show here that DNA-binding mutants of mtSSB are defective in stimulation of DNA synthesis by pol gamma. RNAi knock-down of mtSSB reduces expression to <5% of its normal level in Schneider cells, resulting in growth defects and in the depletion of mitochondrial DNA (mtDNA). Overexpression of mtSSB restores cell growth rate and the copy number of mtDNA, whereas overexpression of a DNA-binding and functionally impaired form of mtSSB neither rescues the cell growth defect nor the mtDNA depletion phenotype. Further development of Drosophila animal models, in which induced mtDNA depletion is manipulated by controlling exogenous expression of wild-type or mutant forms, will offer new insight into the mechanism and progression of human mtDNA depletion syndromes and possible intervention schemes.     

Regulation of coliphage f1 single-stranded DNA synthesis by a DNA-binding protein

Control of single-strand DNA synthesis in coliphage f1 was studied with the use of mutants which are temperature sensitive in gene 2, a gene essential for phage DNA replication. Cells were infected at a restrictive temperature with such a mutant, and the DNA synthesized after a shift to permissive temperature was examined. When cells were held at 42 °C for ten or more minutes after infection, only single-stranded DNA was synthesized immediately after the shift to permissive temperature. This indicated that the accumulation of a pool of double-stranded, replicative form DNA molecules is not an absolute requirement for the synthesis of single-stranded DNA, although replicative form DNA accumulation precedes single-strand synthesis in cells infected with wild-type phage. Cells infected at restrictive temperature with the mutant phage do not replicate the infecting DNA, but do accumulate a substantial amount of gene 5 protein, a DNA-binding protein essential for single-strand synthesis. It is proposed that this accumulated gene 5 protein, by binding to the limited number of replicating DNA molecules formed following the shift to the permissive temperature, acts to prevent the synthesis of double-stranded replicative form DNA, thus causing the predominant appearance of single strands. This explanation implies an intermediate common to both single and double-stranded DNA synthesis. The kinetics of gene 5 protein synthesis indicates that it is the ratio of the gene 5 protein to replicating DNA molecules which determines whether an intermediate will synthesize double or single-stranded DNA.     

Mechanism of stimulation of DNA replication by bacteriophage phi 29 single-stranded DNA-binding protein p5

Protein p5 is a Bacillus subtilis phage phi 29-encoded protein required for phi 29 DNA replication in vivo. Protein p5 has single-stranded DNA binding (SSB) capacity and stimulates in vitro DNA replication severalfold when phi 29 DNA polymerase is used to replicate either the natural phi 29 DNA template or primed M13 single-stranded DNA (ssDNA). Furthermore, other SSB proteins, including Escherichia coli SSB, T4 gp32, adenovirus DNA-binding protein, and human replication factor A, can functionally substitute for protein p5. The stimulatory effect of phi 29 protein p5 is not due to an increase of the DNA replication rate. When both phi 29 DNA template and M13 competitor ssDNA are added simultaneously to the replication reaction, phi 29 DNA replication is strongly inhibited. This inhibition is fully overcome by adding protein p5, suggesting that protein p5-coated M13 ssDNA is no longer able to compete for replication factors, probably phi 29 DNA polymerase, which has a strong affinity for ssDNA. Electron microscopy demonstrates that protein p5 binds to M13 ssDNA forming saturated complexes with a smoothly contoured appearance and producing a 2-fold reduction of the DNA length. Protein p5 also binds to ssDNA in the phi 29 replicative intermediates produced in vitro, which are similar in structure to those observed in vivo. Our results strongly suggest that phi 29 protein p5 is the phi 29 SSB protein active during phi 29 DNA replication.     

Regulation of mitochondrial morphology and cell survival by Mitogenin I and mitochondrial single-stranded DNA binding protein

We found that a mouse homolog of human DNA polymerase delta interacting protein 38, referred to as Mitogenin I in this paper, and mitochondrial single-stranded DNA-binding protein (mtSSB), identified as upregulated genes in the heart of mice with juvenile visceral steatosis, play a role in the regulation of mitochondrial morphology. We demonstrated that overexpression of Mitogenin I or mtSSB increased elongated or fragmented mitochondria in mouse C2C12 myoblast cells, respectively. On the other hand, the silencing of Mitogenin I or mtSSB by RNA interference led to an increase in fragmented or elongated mitochondria in the cells, respectively, suggesting that Mitogenin I and mtSSB are involved in the processes of mitochondrial fusion and fission, respectively. In addition, we showed that the silencing of Mitogenin I resulted in an increase in the number of trypan blue-positive cells and the silencing of mtSSB resulted in an enhancement of the sensitivity of the cells to apoptotic stimulation by etoposide. The present results demonstrated that these proteins play a role in cell survival.     

Mechanisms of single-stranded DNA-binding protein functioning in cellular DNA metabolism

This review deals with analysis of mechanisms involved in coordination of DNA replication and repair by SSB proteins; characteristics of eukaryotic, prokaryotic, and archaeal SSB proteins are considered, which made it possible to distinguish general mechanisms specific for functioning of proteins from organisms of different life domains. Mechanisms of SSB protein interactions with DNA during metabolism of the latter are studied; structural organization of the SSB protein complexes with DNA, as well as structural and functional peculiarities of different SSB proteins are analyzed.     

Dual functions of single-stranded DNA-binding protein in helicase loading at the bacteriophage T4 DNA replication fork

Semi-conservative DNA synthesis reactions catalyzed by the bacteriophage T4 DNA polymerase holoenzyme are initiated by a strand displacement mechanism requiring gp32, the T4 single-stranded DNA (ssDNA)-binding protein, to sequester the displaced strand. After initiation, DNA helicase acquisition by the nascent replication fork leads to a dramatic increase in the rate and processivity of leading strand DNA synthesis. In vitro studies have established that either of two T4-encoded DNA helicases, gp41 or dda, is capable of stimulating strand displacement synthesis. The acquisition of either helicase by the nascent replication fork is modulated by other protein components of the fork including gp32 and, in the case of the gp41 helicase, its mediator/loading protein gp59. Here, we examine the relationships between gp32 and the gp41/gp59 and dda helicase systems, respectively, during T4 replication using altered forms of gp32 defective in either protein-protein or protein-ssDNA interactions. We show that optimal stimulation of DNA synthesis by gp41/gp59 helicase requires gp32-gp59 interactions and is strongly dependent on the stability of ssDNA binding by gp32. Fluorescence assays demonstrate that gp59 binds stoichiometrically to forked DNA molecules; however, gp59-forked DNA complexes are destabilized via protein-protein interactions with the C-terminal "A-domain" fragment of gp32. These and previously published results suggest a model in which a mobile gp59-gp32 cluster bound to lagging strand ssDNA is the target for gp41 helicase assembly. In contrast, stimulation of DNA synthesis by dda helicase requires direct gp32-dda protein-protein interactions and is relatively unaffected by mutations in gp32 that destabilize its ssDNA binding activity. The latter data support a model in which protein-protein interactions with gp32 maintain dda in a proper active state for translocation at the replication fork. The relationship between dda and gp32 proteins in T4 replication appears similar to the relationship observed between the UL9 helicase and ICP8 ssDNA-binding protein in herpesvirus replication.     

Effects of the Xenopus laevis mitochondrial single-stranded DNA-binding protein on the activity of DNA polymerase gamma

The single-stranded DNA-binding protein from Xenopus laevis oocyte mitochondria, which has been found associated with the D loop, binds to ssDNA in stoichiometric amounts and can under certain conditions stimulate the activity of the DNA polymerase gamma. Its properties suggest that it is involved in strand displacement during the replication of the mitochondrial genome.     

DNA damage detection by an archaeal single-stranded DNA-binding protein

Archaeal DNA repair pathways are not well defined; in particular, there are no convincing candidate proteins for detection of DNA mismatches or the bulky lesions removed by excision repair pathways. Single-stranded DNA-binding proteins (SSBs) play a central role in DNA replication, recombination and repair. The crenarchaeal SSB is a monomer with a single oligonucleotide-binding fold for single-stranded DNA binding coupled to a flexible C-terminal tail reminiscent of bacterial SSB that mediates interactions with other proteins. We demonstrate that Sulfolobus solfataricus SSB can melt DNA containing a mismatch or DNA lesion specifically in vitro. We suggest that a potential role for SSB in archaea is the detection of DNA damage due to local destabilisation of the DNA double helix, followed by recruitment of specific repair proteins. Proteins interacting specifically with a single-stranded DNA:SSB complex include several known or putative DNA repair proteins and DNA helicases.     

Ff gene 5 single-stranded DNA-binding protein assembles on nucleotides constrained by a DNA hairpin

The gene 5 protein (g5p) encoded by filamentous Ff phages is an ssDNA-binding protein, which binds to and sequesters the nascent ssDNA phage genome in the process of phage morphogenesis. The g5p also binds with high affinity to DNA and RNA sequences that form G-quadruplex structures. However, sequences that would form G-quadruplexes are absent in single copies of the phage genome. Using SELEX (systematic evolution of ligands by exponential enrichment), we have now identified a family of DNA hairpin structures to which g5p binds with high affinity. After eight rounds of selection from a library of 58-mers, 26 of 35 sequences of this family contained two regions of complete or partial complementarity. This family of DNA hairpins is represented by the sequence: 5'-d(CGGGATCCAACGTTTTCACCAGATCTACCTCCTCGGGATCCCAAGAGGCAGAATTCGC)-3' (named U-4), where complementary regions are italicized or underlined. Diethyl pyrocarbonate modification, UV-melting profiles, and BamH I digestion experiments revealed that the italicized sequences form an intramolecular hairpin, and the underlined sequences form intermolecular base pairs so that a dimer exists at higher oligomer concentrations. Gel shift assays and end boundary experiments demonstrated that g5p assembles on the hairpin of U-4 to give a discrete, intermediate complex prior to saturation of the oligomer at high g5p concentrations. Thus, biologically relevant sequences at which g5p initiates assembly might be typified better by DNA hairpins than by G-quadruplexes. Moreover, the finding that hairpins of U-4 can dimerize emphasizes the unexpected nature of sequence-dependent structures that can be recognized by the g5p ssDNA-binding protein.     

Temperature-sensitive mutants of adenovirus single-stranded DNA-binding protein. Inability to support DNA replication is associated with an altered DNA-binding activity of the protein.

The adenovirus single-stranded DNA-binding protein (DBP) is an essential factor in viral DNA replication. Three temperature-sensitive (ts) adenoviruses (Ad2+ND1ts23, Ad2ts111A, and Ad5ts125) are known to have single amino acid substitutions in their DBPs that result in defective DNA replication at the nonpermissive temperature. To elucidate the mechanism(s) involved in the ts phenotype, we purified the three mutant DBPs and studied their DNA-binding properties and their ability to support DNA replication in an in vitro system. The results confirm that the three ts DBPs were incapable of supporting DNA replication at the nonpermissive temperature (40 degrees C). The defect was found at both the initiation and elongation steps of DNA replication. The 2-fold stimulation of pTP.dCMP formation by the DBP was lost by prior heating of the ts DBPs. The pronounced effect of the DBP on the early elongation process was severely diminished, but not abolished, by prior heating to 40 degrees C. The functional change at 40 degrees C was irreversible, as the ts DBPs preincubated at 40 degrees C were no longer active when assayed at 30 degrees C. Upon heating to 40 degrees C, all three ts DBPs lost their ability to bind to oligonucleotides, although they still retained some binding activity for large single-stranded DNAs such as M13 DNA. Thus, the inability of these three ts DBPs to support DNA replication is attributable to their altered DNA-binding properties.     

Cloning,sequencing and expression of the two genes encoding the mitochondrial single-stranded DNA-binding protein in Xenopus laevis

In Xenopus laevis the single-stranded DNA binding protein imported into the mitochondria consists of two highly related polypeptides. The establishment of the genomic nucleotide sequences reveals that they are encoded by two different genes, XLSSB1 and XLSSB2. The deduced amino acid sequence is identical to the direct amino acid sequence determined by Edman degradation of the mitochondrial polypeptides [Ghrir, R., Lecaer, J.P., Dufresne, C. and Gueride, M. (1991) Primary structure of the two variants of Xenopus laevis mtSSB, a mitochondrial DNA binding protein. Arch. Biochem. Biophys. 291, 395–400]. Both genes are organized in seven exons and six introns, the sequence of the peptide leader is interrupted by an intervening sequence (intron 2). The exon/intron junctions are in exactly conserved positions, splitting the same codon. A high level of identity is observed between corresponding introns of the two genes over part or most of their lengths. Structural features of intronic sequences reveal multiple rearrangements and exchanges during the evolution of X. laevis species. A CCAAT box and the potential regulatory elements NRF-2 and Sp 1 are observed in the 5′-flanking region of both genes. During oogenesis, XLSSB gene expression is correlated with the replicative activity of the mitochondrial DNA.     

The DNA binding domain of the gene 2.5 single-stranded DNA-binding protein of bacteriophage T7

Gene 2.5 of bacteriophage T7 encodes a single-stranded DNA-binding protein that is essential for viral survival. Its crystal structure reveals a conserved oligosaccharide/oligonucleotide binding fold predicted to interact with single-stranded DNA. However, there is no experimental evidence to support this hypothesis. Recently, we reported a genetic screen for lethal mutations in gene 2.5 that we are using to identify functional domains of the gene 2.5 protein. This screen uncovered a number of mutations that led to amino acid substitutions in the proposed DNA binding domain. Three variant proteins, gp2.5-Y158C, gp2.5-K152E, and gp2.5-Y111C/Y158C, exhibit a decrease in binding affinity for oligonucleotides. A fourth, gp2.5-K109I, exhibits an altered mode of binding single-stranded DNA. A carboxyl-terminal truncation of gene 2.5 protein, gp2.5-Delta26C, binds single-stranded DNA 10-fold more tightly than the wild-type protein. The three altered proteins defective in single-stranded DNA binding cannot mediate the annealing of homologous DNA, whereas gp2.5-Delta26C mediates the reaction more effectively than does wild-type. Gp2.5-K109I retains this annealing ability, albeit slightly less efficiently. With the exception of gp2.5-Delta26C, all variant proteins form dimers in solution and physically interact with T7 DNA polymerase.     

The lef-3 gene of Autographa californica nuclear polyhedrosis virus encodes a single-stranded DNA-binding protein.

The Autographa californica nuclear polyhedrosis virus (AcNPV) replicates in the nuclei of infected cells and encodes several proteins required for viral DNA replication. As a first step in the functional characterization of viral replication proteins, we purified a single-stranded DNA-binding protein (SSB) from AcNPV-infected insect cells. Nuclear extracts were chromatographed on single-stranded DNA agarose columns. An abundant protein with an apparent molecular weight of 43,000 was eluted from the columns at 0.9 to 1.0 M NaCl. This protein was not evident in extracts prepared from control cells, suggesting that the SSB was encoded by the virus. SSB bound to single-stranded DNA in solution, and binding was nonspecific with respect to base sequence, as single-stranded vector DNA competed as efficiently as single-stranded DNA containing the AcNPV origin of DNA replication. Competition binding experiments indicated that SSB showed a preference for single-stranded DNA over double-stranded DNA. To determine whether SSB was encoded by the lef-3 gene of AcNPV, the lef-3 open reading frame was cloned under the control of the bacteriophage T7 promoter. Immunochemical analyses indicated that LEF-3 produced in bacteria or in rabbit reticulocyte lysates specifically reacted with antiserum produced by immunization with purified SSB. Immunoblot analyses of infected cell extracts revealed that SSB/LEF-3 was detected by 4 h postinfection and accumulated through 48 h postinfection.     

Functional interactions of mitochondrial DNA polymerase and single-stranded DNA-binding protein. Template-primer DNA binding and initiation and elongation of DNA strand synthesis.

Functional interactions between mitochondrial DNA polymerase (pol gamma) and mitochondrial single-stranded DNA-binding protein (mtSSB) from Drosophila embryos have been evaluated with regard to the overall activity of pol gamma and in partial reactions involving template-primer binding and initiation and idling in DNA strand synthesis. Both the 5' --> 3' DNA polymerase and 3' --> 5' exonuclease in pol gamma are stimulated 15-20-fold on oligonucleotide-primed single-stranded DNA by native and recombinant forms of mtSSB. That the extent of stimulation is similar for both enzyme activities over a broad range of KCl concentrations suggests their functional coordination and a similar mechanism of stimulation by mtSSB. At the same time, the high mispair specificity of pol gamma in exonucleolytic hydrolysis is maintained, indicating that enhancement of pol gamma catalytic efficiency is likely not accompanied by increased nucleotide turnover. DNase I footprinting of pol gamma.DNA complexes and initial rate measurements show that mtSSB enhances primer recognition and binding and stimulates 30-fold the rate of initiation of DNA strands. Dissociation studies show that productive complexes of the native pol gamma heterodimer with template-primer DNA are formed and remain stable in the absence of replication accessory proteins.