Rubella vaccine-induced cellular immunity: evidence of associations with polymorphisms in the Toll-like, vitamin A and D receptors, and innate immune response genes

Toll-like, vitamin A and D receptors and other innate proteins participate in various immune functions. We determined whether innate gene-sequence variations are associated with rubella vaccine-induced cytokine immune responses. We genotyped 714 healthy children (11–19 years of age) after two doses of rubella-containing vaccine for 148 candidate SNP markers. Rubella virus-induced cytokines were measured by ELISA. Twenty-two significant associations (range of P values 0.002–0.048) were found between SNPs in the vitamin A receptor family (RARA, RARB, TOP2B and RARG), vitamin D receptor and downstream mediator of vitamin D signaling (RXRA) genes and rubella virus-specific (IFN-γ, IL-2, IL-10, TNF-α, and GM-CSF) cytokine immune responses. A TLR3 gene promoter region SNP (rs5743305, −8441A > T) was associated with rubella-specific GM-CSF secretion. Importantly, SNPs in the TRIM5 gene coding regions, rs3740996 (His43Tyr) and rs10838525 (Gln136Arg), were associated with an allele dose-related secretion of rubella virus-specific TNF-α and IL-2/GM-CSF, respectively, and have been previously shown to have functional consequences regarding the antiviral activity and susceptibility to HIV-1 infection. We identified associations between individual SNPs and haplotypes in, or involving, the RIG-I (DDX58) gene and rubella-specific TNF-α secretion. This is the first paper to present evidence that polymorphisms in the TLR, vitamin A, vitamin D receptor, and innate immunity genes can influence adaptive cytokine responses to rubella vaccination.     

The role of polymorphisms in Toll-like receptors and their associated intracellular signaling genes in measles vaccine immunity

Toll-like receptors (TLRs) and their intracellular signaling molecules play an important role in innate immunity. In this study, we examined associations between polymorphisms in TLR family genes and measles vaccine-specific immune responses. We genotyped 764 subjects (11-22 years old) after two doses of measles vaccine for TLR signaling SNP markers (n = 454). The major alleles of coding SNPs in the TLR2 (rs3804100) and TLR4 (rs5030710) genes were associated with a dose-related increase (660 vs. 892 mIU/ml, p = 0.002) and a dose-related decrease (2,209 vs. 830 mIU/ml, p = 0.001) in measles-specific antibodies, respectively. A significant association was found between lower measles antibody levels and the haplotype ACGGCGAGAAAAGAGAAGAGAGAGAA (p = 0.01) in the MAP3K7 gene. Furthermore, the minor allele of a SNP (rs702966) of the KIAA1542 (IRF7) gene was associated with a dose-related decrease in IFN-γ Elispot responses (38 vs. 26 spot-forming cells per 2 × 10(5) PBMCs, p = 0.00002). We observed an additional 12 associations (p < 0.01) between coding (nonsynonymous and synonymous) polymorphisms within the TLRs (TLR2, 7, and 8), IKBKE, TICAM1, NFKBIA, IRAK2, and KIAA1542 genes and variations in measles-specific IL-2, IL-6, IFN-α, IFN-γ, IFNλ-1, and TNF-α secretion levels. Our data demonstrate that polymorphisms in TLR and other related immune response signaling molecules have significant effects on measles vaccine-associated immune responses. These data help to establish the genetic foundation for immune response variation in response to measles immunization and provide important insights for the rational development of new measles vaccines.     

Cytokine gene polymorphism and asthma susceptibility, progress and control level

Asthma is a multifactor inflammatory disorder, and its management requires understanding of its various pathogenesis and control mechanisms. Cytokines and other inflammatory mediators are important factors in asthma pathophysiology. In this study, we evaluated the role of cytokine polymorphisms in the asthma susceptibility, progress, control, and lung functions. IL-4-C590T polymorphism by PCR-RFLP method, IFN-γ T+874A, TNF-α-A308G, IL-6 G−174C and TGF-β T+869C variants by ARMS-PCR method and IgE serum level by ELISA technique were determined in 81 asthmatic patients and 124 normal subjects. Asthma diagnosis, treatment and control levels were considered using standard schemes and criteria. TNF-α−308GA genotype was more frequent in asthmatics (P = 0.025, OR 3.352), and polymorphisms between different asthma control levels (P > 0.05) were not different. IFN-γ+874AT genotype had a positive correlation with the familial history of asthma (P = 0.034, OR 2.688). IL-6−174C allele (P = 0.045), TNF-α−308GG genotype (P = 0.002) and TNF-α−308G allele (P = 0.004) showed reduced values, and TNF-α−308GA genotype (P = 0.002) increased FEF25-75 value in asthmatics. IFN-γ+874AA genotype caused a decrease in FVC factor (P = 0.045). This study showed that TNF-α−308GA is a risk factor for asthma, but cytokine gene variants do not affect asthma control and IgE serum levels. Variants producing lower levels of IL-6, TNF-α and IFN-γ are associated with reduced pulmonary capacities. To achieve an appropriate schema for asthma management, further studies with consideration of different aspects in a larger group of patients would be more elucidative.     

Observations of Forsythia koreana methanol extract on mast cell-mediated allergic reactions in experimental models

To explore effects of Forsythia koreana methanol extract (FKME) on mast cell-mediated allergic and inflammatory properties, the effect of FKME was evaluated on compound 48/80-induced systemic anaphylaxis, ear swelling, and anti-dinitrophenyl (DNP) immunoglobulin E (IgE)-induced passive cutaneous anaphylaxis (PCA). In addition, the effect of FKME was investigated on the histamine release from rat peritoneal mast cells (RPMCs) stimulated by compound 48/80, which promotes histamine release. The human mast cell line HMC-1 was stimulated by phorbol 12-myristate 13-acetate plus calcium ionophore A23187. Activated HMC-1 can produce several proinflammatory and chemotactic cytokines such as tumor necrosis factor-alpha (TNF-α), interleukin (IL)-6, and IL-8. Cytokine levels in the culture supernatant were measured by an enzyme-linked immunosorbent assay. Cytotoxicity by FKME was determined by a 3-(4,5-dimethylthiazol-2-yl)-diphenyl-tetrazolium bromide (MTT) assay. FKME inhibited compound 48/80-induced systemic anaphylactic shock and ear swelling in mice. When 1 g/kg FKME was pretreated or posttreated with mice, compound 48/80-induced mice morality was 50 and 66.7%, respectively. One gram per kilogram of FKME pretreatment inhibited ear-swelling responses derived from compound 48/80 by 29.75%. A PCA reaction was inhibited by 17.9%. In an in vitro model, FKME (1 mg/ml) inhibited histamine release from the RPMCs by 13.8% and TNF-α, IL-6, and IL-8 production from HMC-1 cells by 71.16% (P < 0.001), 86.72% (P < 0.001), and 44.6%, respectively. However, FKME had no cytotoxic effects on cell viability. In conclusion, FKME inhibited not only systemic anaphylaxis and ear swelling induced by compound 48/80 but also inhibited a PCA reaction induced by anti-DNP IgE in vivo. Treatment with FKME showed significant inhibitory effects on histamine, TNF-α, IL-6, and IL-8 release from mast cells.     

CTLA-4 and TNF-α promoter-308 A/G polymorphisms and ANCA-associated vasculitis susceptibility: a meta-analysis

The aim of this study was to explore whether the cytotoxic T lymphocyte associated antigen-4 (CTLA-4) or tumor necrosis factor-α (TNF-α) polymorphisms contribute to anti-neutrophil cytoplasmic antibody (ANCA)-associated vasculitis (AAV) susceptibility. The authors conducted a meta-analysis on associations between polymorphisms of the 3′ untranslated region (UTR) microsatellite at exon 3, exon 4 CT60 (A/G), exon 1 +49 (A/G), and promoter -318 (C/T) of CTLA-4, and TNF-α promoter-308 (A/G) and AAV susceptibility as determined using; (1) allelic contrast and (2) homozygote contrast, (3) recessive, and (4) dominant models. A total of 11 comparisons were considered in this meta-analysis. These studies encompassed 7 CTLA-4 studies and 4 TNF-α studies in 10 European populations and 1 Asian population. The (AT)_n repeat polymorphisms of CTLA-4 were found to be significantly associated with AAV in European populations (OR of 86 vs. xx allele = 0.402, 95% CI = 0.184–0.875, P = 0.022). The one study conducted on this polymorphism in Asians showed no significant association with AAV. Meta-analysis of the 86/86 (recessive effect), 86/86 and 86/xx (dominant effect), and 86/86 vs. xx/xx (homozygote contrast) of the (AT)_n repeat revealed a significant association with AAV in Europeans. Both the CTLA-4 CT60 and +49 polymorphisms were found to be significantly associated with AAV in European populations, and allele and genotype-based analyses showed a significant association between the CTLA-4 CT60 and +49 polymorphisms with AAV in Europeans (OR of the A allele of CT60 = 0.769, 95% CI = 0.619–0.017, P = 0.035; OR of the T allele of +49 = 1.382, 95% CI = 1.147–1.664, P = 0.001, respectively). Meta-analysis of the CTLA-4 -318 polymorphism failed to identify any association with AAV. Furthermore, meta-analysis of the AA genotype, the AA and AG genotypes, and the A allele of TNF-α failed to reveal any association with Wegener’s granulomatosis (WG). This meta-analysis demonstrates that the CTLA-4 polymorphisms confer susceptibility to AAV in Europeans. In contrast, no association was found between the TNF-α-308 polymorphism and susceptibility to WG in Europeans.     

Roles of TLR7 in Activation of NF-κB Signaling of Keratinocytes by Imiquimod

Imiquimod is known to exert its effects through Toll-like receptor 7 (TLR7) and/or TLR8, resulting in expression of proinflammatory cytokines and chemokines. Keratinocytes have not been reported to constitutively express TLR7 and TLR8, and the action of imiquimod is thought to be mediated by the adenine receptor, not TLR7 or TLR8. In this study, we revealed the expression of TLR7 in keratinocytes after calcium-induced differentiation. After addition of calcium to cultured keratinocytes, the immunological responses induced by imiquimod, such as activation of NF-κB and induction of TNF-α and IL-8, were more rapid and stronger. In addition, imiquimod induced the expression TLR7, and acted synergistically with calcium to induce proinflammatory cytokines. We confirmed that the responses induced by imiquimod were significantly inhibited by microRNAs suppressing TLR7 expression. These results suggest that TLR7 expressed in keratinocytes play key roles in the activation of NF-κB signaling by imiquimod, and that their modulation in keratinocytes could provide therapeutic potential for many inflammatory skin diseases.     

Aged mice have increased inflammatory monocyte concentration and altered expression of cell-surface functional receptors

The expression of monocyte cell-surface receptors represents one index of immune dysfunction, which is common with aging. Although mouse models of aging are prevalent, monocyte subset assessment is rare. Our purpose was to compare cell receptor expression on classic (CD115⁺/Gr-1^high) and non-classic (CD115⁺/Gr-1^low) monocytes from 80- or 20-week-old CD-1 mice. Three-colour flow cytometry was used to determine the concentration of monocyte subsets and their respective cell-surface expression of TLR2, TLR4, CD80, CD86, MHC II and CD54. These receptors were selected because they have been previously associated with altered monocyte function. Data were analysed with independent t-tests; significance was set at P < 0.05. Old mice had a greater concentration of both classic (258%, P = 0.003) and non-classic (70%, P = 0.026) monocytes. The classic : non-classic monocyte ratio doubled in old as compared with that in young mice (P = 0.006), indicating a pro-inflammatory shift. TLR4 (↓27%, P = 0.001) and CD80 (↓37%, P = 0.004) were decreased on classic monocytes from old as compared with those from young mice. TLR2 (↑24%, P = 0.002) and MHCII (↓21%, P = 0.026) were altered on non-classic monocytes from old as compared with those from young mice. The increased classic : non-classic monocyte ratio combined with changes in the cell-surface receptor expression on both monocyte subsets is indicative of immune dysfunction, which may increase age-associated disease risk.     

Plasma concentration of α-tocopherol in different free-ranging birds of prey

In this study, we investigated the α-tocopherol plasma concentrations in healthy free-ranging nestlings of the white-tailed sea eagle (Haliaeetus albicilla) (n = 32), osprey (Pandion haliaetus) (n = 39), northern goshawk (Accipiter gentilis) (n = 25), common buzzard (Buteo buteo) (n = 31), and honey buzzard (Pernis apivorus) (n = 18) as well as of free-ranging adults of the white-tailed sea eagle (n = 10), osprey (n = 31), and northern goshawk (n = 45). α-Tocopherol plasma concentrations were determined by reverse-phase high-performance liquid chromatography. α-Tocopherol plasma concentrations in nestlings of osprey, white-tailed sea eagle, and northern goshawk did not differ significantly amongst the species, but the common buzzard and honey buzzard nestlings had significantly lower α-tocopherol plasma concentrations than nestlings of the other species (both P < 0.001). Adult male ospreys and white-tailed sea eagles had significantly higher α-tocopherol concentrations compared to adult females (both P < 0.005). Adult ospreys and northern goshawks had significantly higher α-tocopherol plasma concentrations compared to their nestlings (both P < 0.001). In adult female northern goshawks, plasma concentrations of α-tocopherol increased significantly before egg laying (P < 0.001). These results demonstrate α-tocopherol plasma concentrations in birds of prey to be species specific and influenced by age and reproductive status.     

Genetic variants of the IgA Fc receptor (FcαR, CD89) promoter in chronic hepatitis C patients

Fc receptor for IgA (FcαR, CD89) is capable of triggering IgA-mediated immune responses to pathogens and has been proposed to function in circulating IgA clearance. Because inheritable variations modifying individual immune responses or immunoglobulin catabolism may affect the chronicity of viral infection, we investigated whether promoter polymorphisms of the FcαR gene (FCAR) affect chronic hepatitis C virus (HCV) infection and its disease progression. The two −311T/C and −142T/C single-nucleotide polymorphisms (SNPs) were studied by direct DNA sequencing in 177 Japanese patients with chronic hepatitis C (CHC). Both −311CC and −142CC genotypes were more frequent in CHC patients (15.9 and 18.6%) compared with 210 healthy controls (5.7 and 10.0%) [p = 0.001, odds ratio (OR) = 3.10, 95% confidence interval CI) = 1.53–6.30 and p = 0.014, OR = 2.06, 95% CI = 1.14–3.72, respectively], and were associated with infection with HCV genotype 2a/2b (p = 0.019 and p = 0.005, respectively). Conversely, −311CC and −142CC were decreased in 59 patients at advanced stages of disease as assessed on the basis of hepatic fibrosis markers such as decreased platelet count (PLT) ( < 150,000/μl) (5.1 and 8.5%) compared with 91 patients with normal PLT ( ≥ 150,000/μl) (24.2 and 26.4%) (p = 0.006 and p = 0.005, respectively). Moreover, among the patients with normal PLT (but not with decreased PLT), −311CC or −142CC was significantly associated with decreased serum IgA levels (p = 0.023 or p = 0.007, respectively). These results suggest that the FCAR promoter SNPs may be related to chronic HCV infection and disease progression in Japanese CHC, which might be explained by altered FcαR expression affecting IgA-mediated immune responses and/or IgA catabolism.     

Behaviour of interleukin-2 serum levels in advanced non-small-cell lung cancer patients: relationship with response to therapy and survival

 Interleukin(IL)-2 is a T helper (Th) 1 type cytokine that has been shown to play an important role in antitumour immune responses. In this study, the prognostic significance of serum IL-2 levels was investigated in 60 advanced non-small-cell lung cancer (NSCLC) patients. IL-2 serum levels were determined before chemotherapy, at the end of chemotherapy and during follow-up, using a commercially available enzyme-linked immunoadsorbent assay kit. The results were analysed according to the response to therapy and were used to generate a model predicting overall survival and time to treatment failure. All 60 patients were shown to have higher IL-2 serum levels than controls (P < 0.0001). Stage IV patients had significantly lower IL-2 levels than stage III patients (P < 0.0001), although they were still significantly higher than controls (P < 0.0001). It is interesting that, when patients were divided into responders and non-responders according to the response to therapy, the former were shown to have significantly higher pre-chemotherapy levels than the latter (P < 0.0001). Moreover, a further significant increase in IL-2 serum levels (P=0.004) and a significant decrease (P < 0.0001) were shown in responders and non-responders, respectively at the end of the therapy. Using univariate and multivariate analyses, both overall survival and time to treatment failure were shown to be affected by the mean pathological levels of IL-2. Furthermore, the prognostic significance of the serum level of IL-2 was confirmed by the stepwise regression analysis. In conclusion, determination of pre-treatment IL-2 serum levels was shown to be of independent prognostic utility in patients with advanced NSCLC; therefore, its possible use for prediction of outcome is proposed. Received: 16 March 2000 / Accepted: 27 July 2000     

Association of toll-like receptor four single nucleotide polymorphisms with incidence of infectious bovine keratoconjunctivitis (IBK) in cattle

Toll-like receptor 4 (TLR4) is a receptor protein that binds pathogen ligands, which are mainly associated with Gram-negative bacteria. The objective of this study was to investigate the association of nucleotide polymorphisms in TLR4 with infectious bovine keratoconjunctivitis (IBK), or pinkeye, incidence in American Angus cattle. Animals with previously calculated breeding values for IBK susceptibility were used to identify two SNPs in TLR4; Int1 (A/G) in intron1 (−26 Ex2 position) and Ex3 (C/T) in exon3 (1,678 position). To investigate the possible role of these SNPs in IBK susceptibility, the disease incidence information was collected on 370 calves raised in Iowa at two time points—June or August (disease season) and October (at weaning) and genotyped using PCR-RFLP protocols. In statistical models including year, pasture management group, and SNP, the Int1 SNP had a significant effect on IBK infection rates both in-season (P < 0.05) and at weaning (P < 0.01), whereas the Ex3 SNP was not significant (P > 0.79) at either time point. Furthermore, the Int1 SNP alone could account for 2.1% of phenotypic variation in IBK infection during the disease season and 3.0% of phenotypic variation in IBK infection at the time of weaning. These data indicate that there is a relationship between Int1 genotype and the rate of IBK infection in American Angus cattle.     

Identification of plant volatiles activating single receptor neurons in the pine weevil (Hylobius abietis)

Naturally produced plant volatiles, eliciting responses of single olfactory receptor neurons in the pine weevil, have been identified by gas chromatography linked with mass spectrometry. The receptor neurons (n = 72) were classified in 30 types, according to the compound which elicited the strongest response in each neuron, 20 of which compounds were identified. Most potent for 14 types of neurons (n = 50) were monoterpenes, including bicyclic (e.g. α-pinene, camphor and myrtenal) for 8 types (n = 32), monocyclic (limonene, carvone, α-terpinene) for 3 types (n = 12) and acyclic (e.g. β-myrcene and linalool) for 3 types (n = 6). Other compounds eliciting strongest responses of a neuron were five sesquiterpenes, including α-copaene and a farnesene-isomer, and an anethole type which has no biosynthetic relationship with terpenes. Within one type, receptor neurons with quite selective responses to the most potent compound as well as neurons with additional responses to several, structurally similar compounds were found, indicating that the neurons may have the same functional types of membrane receptors, but different sensitivities. Response spectra of neurons within the bicyclic-, mono-cyclic and acyclic types showed more overlapping than across the neuron types. Minimal overlapping response spectra was found between monoterpene and sesquiterpene neurons. The results suggest that this structure-activity relationship is significant for encoding plant odour information in the pipe weevil. Accepted: 6 January 1997     

Association of TNF-α gene with spontaneous deep intracerebral hemorrhage in the Taiwan population: a case control study

Background  

Genetic factors may play a role in susceptibility to spontaneous deep intracerebral hemorrhage (SDICH). Previous studies have shown that TNF-α gene variation was associated with risks of subarachnoid hemorrhage in multiple ethnicities. The present case-control study tested the hypothesis that genetic variations of the TNF-α gene may affect the risk of Taiwanese SDICH. We examined the association of SDICH risks with four single nucleotide polymorphisms (SNPs) within the TNF-α gene promoter, namely T-1031C, C-863A, C-857T, and G-308A.     

Effects of <Emphasis Type="SmallCaps">l</Emphasis>-Canavanine and ozone on vascular reactivity in septicemic rats

Septicemia leads to oxidative stress with overproduction of reactive-oxygen species (ROS) and consumption of endogenous antioxidant enzymes. We tested a twofold hypothesis: (1) does oxidative stress (OxS) induced by sepsis acting alone or in concert with augmented inflammatory processes contributes to sepsis-related vascular dysfunction, and, (2) whether ozone (O₃) and l-canavanine (CAV) mitigate the negative impact of the aforementioned phenomena. We investigated the relative impact of treatment with CAV and/or O₃ on vascular OxS associated vascular functional changes in septicemic rats. For this study, 60 male Sprague–Dawley rats were used and divided into six experimental groups (n = 10): control group (C), sham-operated (Sham), septicemic rats (S), S rats treated with CAV (100 mg/kg. i.p; S + CAV), S rats treated with O₃ (1.2 mg/kg, i.p.; S + O₃) and S rats treated with both O₃ and CAV (S + O₃ + CAV). After 22 h, the mean arterial blood pressure (MAP), the aortic ring vascular reactivity to phenylephrine, abdominal aortic blood flow (AABF), serum tumor necrosis factor-α (TNF-α) and plasma nitrite/nitrate (NOx) concentration were measured. In addition, hepatic antioxidant enzyme activities sodium dismutase (SOD) and glutathione peroxidase (GSH-Px) were estimated. Septicemia caused significant elevation of serum TNF-α (p < 0.001) and plasma NOx (p < 0.001) and significant (p < 0.001) reduction of AABF (p < 0.001), aortic vascular response to phenylephrine (p < 0.001), MAP (p < 0.001) and hepatic SOD and GSH-Px activity (p < 0.001) compared with the C group, while treatment with O₃ and/or CAV induced significant amelioration of all those increases. Abnormalities were attenuated to a similar extent with treatment with both O₃ and CAV. These results suggested that concomitant administration of O₃ and CAV alleviated the compromised vascular reactivity in septicemic conditions and prevent its progression into septic shock compared with each alone.     

A meta-analysis on the association between three promoter variants of TNF-α and Crohn’s disease

Tumor necrosis factor-alpha (TNF-α) has been regarded as a candidate gene for Crohn’s disease (CD) based on its inflammatory function in immune reaction and the clinical effectiveness of anti-TNF-α therapy. However, studies to date have reported inconsistent findings for the association between TNF-α and CD. The PubMed, EMBASE, and Medline databases were systematically reviewed from all English language publications up to April, 2011. A total of twenty-nine studies concerning the association between CD and the TNF-α promoter polymorphisms of −308G/A, −857C/T and −238G/A were identified, among of them only twenty-three studies match the inclusion criteria (including 3,843 cases and 6,260 controls) and were selected for the statistical test. We found that neither the G allele of −308G/A (OR 1.02, 95% CI 0.87–1.19, P = 0.84), C allele of −857C/T (OR 0.97, 95% CI 0.86–1.09, P = 0.57) and G allele of −238G/A (OR 0.91, 95% CI 0.70–1.18, P = 0.48), and nor their GG (OR 1.05, 95% CI 0.88–1.25, P = 0.59), CC (OR 0.98, 95% CI 0.86–1.12, P = 0.76) and GG (OR 0.92, 95% CI 0.70–1.21, P = 0.55) genotypes were associated with CD susceptibility, respectively. Our meta-analysis demonstrates that three promoter polymorphisms of TNF-α above may not confer susceptibility to CD.     

Immunologic significance of HLA class I genes in measles virus-specific IFN-γ and IL-4 cytokine immune responses

The variability of immune responses modulated by human leukocyte antigen (HLA) genes and secreted cytokines is a significant factor in the development of a protective effect of measles vaccine. We studied the association between type 1 helper T cells (Th1)- and Th2-like cytokine immune responses and HLA class I alleles among 339 schoolchildren who previously received two doses of the measles vaccine. Median values for measles-specific interferon gamma (IFN-γ) and interleukin-4 (IL-4) cytokines were 40.7 pg/ml [interquartile range (IQR) 8.1–176.7] and 9.7 pg/ml (IQR 2.8–24.3), respectively. Class I HLA-A (*0101 and *3101) and HLA-Cw (*0303 and *0501) alleles were significantly associated with measles-virus-induced IFN-γ secretion. HLA-A*3101 and Cw*0303 were associated with a higher median IFN-γ response, while A*0101 and Cw*0501 were associated with lower measles-specific IFN-γ response. We found limited associations between HLA class I gene polymorphisms and Th2-like (IL-4) immune responses after measles vaccination, indicating that HLA class I molecules may have a limited effect on measles-vaccine-induced IL-4 secretion. Understanding the genetic factors that influence variations in cytokine secretion following measles vaccination will provide insight into the factors that influence both cell-mediated and humoral immunity to measles.     

Oral Administration of Lycopene Reverses Cadmium-suppressed Body Weight Loss and Lipid Peroxidation in Rats

Cadmium (Cd) exposure has been recognized to result in a wide variety of cellular responses, including oxidative stress and body weight loss. The aim of the present study was to examine the effect of lycopene supplementation on the antioxidant defense system, lipid peroxidation (LPO) level, nitric oxide (NO), tumor necrosis factor alpha (TNF-α) production, and body weight in Cd-exposed rats. Animals were divided into four groups (n = 7): control, Cd-treated, Cd plus lycopene-treated, and lycopene-treated. Cadmium (as CdCl₂) was administrated orally for 20 days (6.6 mg kg⁻¹ day⁻¹), and lycopene (10 mg kg⁻¹ day⁻¹) was similarly administered. Lycopene administration significantly suppressed Cd-induced LPO in plasma and kidney homogenates. Lycopene also reversed Cd-decreased body weight compared to the control. Cadmium treatment had diverse effects on the antioxidant enzyme activities. Although antioxidant superoxide dismutase activity was unchanged, glutathione peroxidase activity was decreased, and catalase activity was elevated in kidney homogenates of Cd-administrated group. However, lycopene treatment reversed Cd-changed enzyme activities to the control level. Xanthine oxidase activity and TNF-α concentration were not altered by Cd administration, indicating that superoxide anion production and inflammation were not stimulated. Cadmium did not change NO levels in kidney homogenates but decreased those in plasma, and this effect was not prevented by lycopene supplementation. The result suggests that consumption of adequate levels of lycopene may be useful to prevent heavy-metal-induced LPO and body weight loss.     

Pathogen specific cytokine release reveals an effect of TLR2 Arg753Gln during Candida sepsis in humans

Toll-like receptors (TLRs) are crucial pattern-recognition receptors (PRRs) for activation of innate and adapted immunity. TLR2 heterodimerizes with TLR1 or TLR6 to recognize multiple pathogen-associated molecular patterns (PAMPs) of fungi, Gram-positive pathogens, and mycobacteria. Receptor activation culminates in monocyte, T-helper (Th)1, and Th2 cytokine release. Single nucleotide polymorphisms (SNPs) Arg753Gln and Arg677Trp affect TLR2 responsiveness and may contribute to the course of sepsis, which is associated with substantial morbidity and mortality during intensive care treatment. We genotyped 325 critically ill patients with septic shock, and performed a detailed clinical follow-up with 47 of these patients. Here, we investigated whether distinct sepsis episodes result in defined plasma cytokine patterns, and whether cytokine profiles may be linked to the TLR2 polymorphisms. Blood sampling was done daily and microbiological testing was performed on a routine basis. DNA was extracted from whole blood and TLR2 SNPs were typed by pyrosequencing. Cytokines were measured by multiplexed array technologies and the leukocyte phenotype was determined by flow cytometry. Among the 325 ICU patients, 17 individuals (5.2%) were heterozygous for Arg753Gln. The SNP Arg677Trp was not found in any patient. Episodes of Gram-negative, Gram-positive, and Candida sepsis were recorded. During Gram-positive sepsis, the cytokine pattern did not differ between Arg753Gln heterozygous patients and wild type patients. By contrast, during Candida sepsis, the Arg753Gln heterozygous patients showed biomarker patterns that differed from wild type patients with elevated TNF-α plasma concentrations, but reduced IFN-γ and IL-8 levels. In conclusion, TLR2 SNP Arg753Gln results in altered cytokine release in response to Candida but not to Gram-positive sepsis.