Alpha-amylase genes (amyR2 and amyE+) from an alpha-amylase-hyperproducing Bacillus subtilis strain: molecular cloning and nucleotide sequences.

amyR2, amyE+, and aroI+ alleles from an alpha-amylase-hyperproducing strain, Bacillus subtilis NA64, were cloned in temperate B. subtilis phage p11, and the amyR2 and amyE+ genes were then recloned in plasmid pUB110, which was designated pTUB4. The order of the restriction sites, ClaI-EcoRI-PstI-SalI-SmaI, found in the DNA fragment carrying amyR2 and amyE+ from the phage genome was also found in the 2.3-kilobase insert of pTUB4. Approximately 2,600 base pairs of the DNA nucleotide sequence of the amyR2 and amyE+ gene region in pTUB4 were determined. Starting from an ATG initiator codon, an open reading frame was composed of a total 1,776 base pairs (592 amino acids). Among the 1,776 base pairs, 1,674 (558 amino acids) were found in the cloned DNA fragment, and 102 base pairs (34 amino acids) were in the vector pUB110 DNA. The COOH terminal region of the alpha-amylase of pTUB4 was encoded in pUB110. The electrophoretic mobility in a 7.5% polyacrylamide gel of the alpha-amylase was slightly faster than that of the parental alpha-amylases. The NH2 termination portion of the gene encoded a 41-amino acid-long signal sequence (Ohmura et al., Biochem. Biophys. Res. Commun. 112:687-683, 1983). The DNA sequence of the mature extracellular alpha-amylase, a potential RNA polymerase recognition site and Pribnow box (TTGATAGAGTGATTGTGATAATTTAAAAT), and an AT-rich inverted repeat structure which has free energy of -8.2 kcal/mol (-34.3 kJ/mol) were identified. The AT-rich inverted repeat structure seemed to correspond to the hyperproducing character. The nucleotide sequence around the region was quite different from the promoter region of the B. subtilis 168 alpha-amylase gene which was cloned in the Escherichia coli vector systems.     

Novel plasmid-based expression vectors for intra- and extracellular production of recombinant proteins in Bacillus subtilis

Two plasmid-based expression vectors have been constructed where one allows intracellular production of recombinant proteins while the second directs the proteins into the culture medium. Both vectors use the strong promoter preceding the groESL operon (codes for the essential heat shock proteins GroES and GroEL) of Bacillus subtilis fused to the lac operator allowing their induction by addition of ITPG. While the background level of expression of these expression cassettes is very low in the absence of the inducer, an induction factor of about 1300 was measured. When the genes htpG and pbpE (coding for a heat shock protein and a penicillin-binding protein, respectively) were fused to the groE promoter, the amount of recombinant protein produced after addition of IPTG represented 10 and 13%, respectively, of the total cellular protein. To obtain secretion of recombinant proteins, the coding region for the signal peptide of the amyQ gene encoding an alpha-amylase from Bacillus amyloliquefasciens was fused to the groE promoter. High-level secretion of amyQ alpha-amylase and cellulase A and B of Clostridium thermocellum was demonstrated.