Overexpression of virD1 and virD2 genes in Agrobacterium tumefaciens enhances T-complex formation and plant transformation.

The VirD1 and VirD2 proteins encoded by an inducible locus of the virulence (vir) region of the Agrobacterium tumefaciens Ti plasmid are required for site-specific nicking at T-DNA border sites. We have determined the nucleotide sequence of a 3.6-kilobase-pair fragment carrying the virD locus from nopaline Ti plasmid pTiC58. In contrast to the previous report (Hagiya et al., Proc. Natl. Acad. Sci. USA 82:2669-2673, 1985), we found that the first three open reading frames were capable of encoding polypeptides of 16.1, 49.7, and 21.4 kilodaltons. Deletion analysis demonstrated that the N-terminal conserved domain of VirD2 was absolutely essential for its endonuclease activity. When extra copies of the virD1 and virD2 genes were present in an A. tumefaciens strain carrying a Ti plasmid, increased amounts of T-strand and nicked molecules could be detected at early stages of vir induction. Such strains possessed the ability to transform plants with higher efficiency.     

Function of heterologous and pseudo border repeats in T region transfer via the octopine virulence system of Agrobacterium tumefaciens

The successful transfer of the Ti plasmid T region to the plant cell is mediated by its 24 bp border repeats. Processing of the T-region prior to transfer to the plant cell is started at the right border repeat and is stimulated by a transfer enhancer sequence called overdrive. Left and right border repeats differ somewhat in nucleotide sequence; moreover, the repeats of different Ti and Ri plasmids are slightly different. Our data indicate that these differences do not have a significant influence on border activity. However, the overdrive sequence is essential for the efficient transfer of a T region via an octopine transfer system. Our data suggest that an overdrive sequence must also be present next to the right border repeats of the nopaline Ti plasmid and the agropine of octopine and nopaline Ti plasmids express some differences in T-DNA processing activities. of cotopine and nopaline Ti plasmids express some differences in T-DNA processing activities.Furthermore, we demonstrate that certain pseudo border repeats, sequences that resemble the native 24 bp border repeat and naturally occur within the octopine Ti plasmid T-region, are able to mediate T region transfer to the plant cell, albeit with much reduced efficiency as compared to wild-type border repeats.     

Activation of Agrobacterium tumefaciens vir gene expression generates multiple single-stranded T-strand molecules from the pTiA6 T-region: requirement for 5'' virD gene products.

Agrobacterium tumefaciens transfers its Ti-plasmid T-DNA to plant cells. This process is initiated by plant-induced activation of the Ti-plasmid virulence loci, resulting in the generation of single stranded (ss) cleavages of the Ti-plasmid T-DNA border sequences (border nicks) and ss linear unipolar T-DNA molecules (T-strands). A single T-strand is produced from the two-border T-region of the pGV3850 nopaline plasmid. In this paper the induced molecular events for the complex T-region of the pTiA6 octopine plasmid are analyzed. This T-region carries four T-DNA borders delimiting three T-DNA elements (TR, TC and TL). Induction of pTiA6 generates cleavages independently at its border repeats, and six distinct T-strand species corresponding to TR, TR/TC, TR/TC/TL, TC, TC/TL and TL. These T-strand molecules are linear and correspond to the bottom strand of the pTiA6 T-region. Thus, borders can function for both initiation and termination of T-strand synthesis. We propose that the different pTiA6 T-strands are independently generated, and that the distribution of border nicks within the parental T-region determines which T-strand is produced. To identify genes involved in T-strand production, pTiA6 virulence (vir) and chromosomal virulence (chv) mutant strains were analyzed. VirA and VirG, the vir regulatory loci are required. Furthermore, the two 5' cistrons of virD are required for both border nicks and T-strands, suggesting that these genes encode the border endonuclease, and that T-strand production is dependent on border nicks. That no mutants are defective for T-strands alone suggests that functions encoded outside of vir and chv might mediate some of the later reactions of T-strand synthesis.     

The virD4 gene is required for virulence while virD3 and orf5 are not required for virulence of Agrobacterium tumefaciens

The virD operon of the resident Ti plasmid of Agrobacterium tumefaciens contains loci involved in T-DNA processing and undefined virulence functions. Nucleotide sequence of the entire virD operon of pTiC58 revealed similarities to the virD operon of the root-inducing plasmid pRiA4b and to that of the octopine-type plasmid pTiA6NC. However, comparative sequence data show that virD of pTiC58 is more akin to that of the pRiA4b than to that of the pTiA6NC. T7f10::virD gene fusions were used to generate polypeptides that confirm the presence of four open reading frames virD1, virD2, virD3, and virD4 within virD which have a coding capacity for proteins of 16.1, 49.5, 72.6, and 73.5 kDa, respectively. virD3 therefore encodes a polypeptide 3.4 times larger (72.6 versus 21.3 kDa) than that encoded by virD3 of octopine Ti plasmids. Non-polar virD4 mutants could not be complemented by a distant homologue, TraG protein of plasmid RP4. An independently regulated fifth ORF (orf5) is located immediately downstream of 3′ end of virD4 and encodes a polypeptide of 97.4 kDa. The expression of orf5 is dependent on its own promoter and is independent of acetosyringone induction in A. tumefaciens. Recently, it has been shown that virD3 of octopine Ri or Ti plasmids is not required for virulence. In this report, we confirm and extend these findings on a nopaline Ti plasmid by using several virD non-polar mutants that were tested for virulence. virD3 and orf5 non-polar mutants showed no effect on tumorigenicity on 14 different plant species, while virD4 mutants lost their tumorigenicity completely on all these test plants. These data suggest that virD3 and orfS are not essential for virulence whereas virD4 is absolutely required on a wide range of host plants.     

The virD operon of Agrobacterium tumefaciens encodes a site-specific endonuclease

Tumor formation by Agrobacterium tumefaciens involves the transfer and integration of a defined segment (T-DNA) of tumor-inducing (Ti) plasmid DNA into the plant nuclear genome. A set of plasmid genes outside the T-DNA, the vir genes, are thought to mediate the transfer process. We report here that the virD operon encodes a site-specific endonuclease that cleaves at a unique site within each of the 24 bp direct repeats that flank the T-DNA. The endonuclease function was further localized to the 5' end of this operon by demonstrating that cleavage does not occur in virD mutant strains of Agrobacterium and that the 5' end of the virD operon is sufficient to direct cleavage in E. coli. Analysis of nucleotide sequence and protein data indicate that two proteins of 16.2 and 47.4 kd are involved.     

The promoter proximal region in the virD locus of Agrobacterium tumefaciens is necessary for the plant-inducible circularization of T-DNA

Summary The formation of crown gall tumours involves the transfer of the T-DNA region of the Ti plasmid from Agrobacterium to plant cells and its subsequent integration into plant chromosomes. When agrobacteria are incubated with plant protoplasts or exudates of plants, the T-DNA region is circularized by recombination or cleavage and rejoining between the 25 bp terminal repeats; the formation of circular T-DNAs is thought to be one step in T-DNA transfer (Koukolikova-Nicola et al. 1985; Machida et al. 1986). We previously showed that the virulence region of the Ti plasmid is required for T-DNA circularization. In the present paper, we examined the circularization event in agrobacteria harbouring octopine Ti plasmids with mutations in various loci of the virulence region. The results clearly demonstrate that the gene(s) encoded in the virD locus are necessary for T-DNA circularization. In particular, the gene(s) present in the region proximal to the virD promoter are essential. We propose that roduct(s) of this gene have recombinase or endonuclease activity which specifically recognizes the 25 bp terminal repeats of T-DNA.     

Sequence context of the T-DNA border repeat element determines its relative activity during T-DNA transfer to plant cells

Summary We present a detailed analysis of the function of the right and left T-DNA border regions of the nopaline Ti plasmid of Agrobacterium tumefaciens. An avirulent deletion of the right border of the nopaline Ti plasmid (pGV3852) was used as an acceptor for 14 different T-DNA border constructs. The functional activities of these constructs were assayed by their ability to restore virulence, i.e. transformation on inoculated plants. Tumorigenicities were measured in several independent experiments over a 2 year period and the statistical significance of their relative levels was evaluated. The data indicate: (i) the entire sequence of the 25 bp direct repeat of the T-DNA is required to provide an efficient substrate for mediating T-DNA transfer events; deletion derivatives of either the conserved or the vaiable domain of the repeat are defective in T-DNA transfer; (ii) while the 25 bp direct repeat alone can promote the T-DNA transfer, the flanking sequences of the repeats enhance (on the right) or attenuate (on the left) their activity; and (iii) tumorigenicity measurements vary depending on the plant assay system: potato discs are more sensitive than wounded tobacco leaves in detecting differences in T-DNA border activity.     

The opine synthase genes carried by Ti plasmids contain all signals necessary for expression in plants

Signals necessary for in vivo expression of Ti plasmid T-DNA-encoded octopine and nopaline synthase genes were studied in crown gall tumors by constructing mutated genes carrying various lengths of sequences upstream of the 5' initiation site of their mRNAs. Deletions upstream of position -294 did not interfere with expression of the octopine synthase gene while those extending upstream of position -170 greatly reduced the gene expression. The estimated size of the octopine synthase promoter is therefore 295 bp. The maximal length of 5' upstream sequences involved in the in vivo expression of the nopaline synthase gene is 261 bp. Our results also demonstrated that Ti plasmid-derived sequences contain all signals essential for expression of opine synthase genes in plants. Expression of these genes, therefore, is independent of the direct vicinity of the plant DNA sequences and is not activated by formation of plant DNA and T-DNA border junction.     

Characteristics of Ti plasmids from broad-host-range and ecologically specific biotype 2 and 3 strains of Agrobacterium tumefaciens.

Agrobacterium tumefaciens strains isolated from crown gall tumors on grapevines in California were consistently of the biotype 3 group. All 11 of these strains were limited in their host range and harbored Ti plasmids with molecular masses between 119 and 142 megadaltons (Mdal) as well as a larger cryptic plasmid of greater than 200 Mdal; occasionally a smaller cryptic plasmid of 65 Mdal was also present. Ti plasmids o these strains have DNA sequences in common with Ti plasmids of octopine and nopaline strains belonging to the biotype 1 group and exhibited sequence homologies with the conserved region of the T-DNA. Ten of the 11 strains utilized octopine as a sole source of carbon and nitrogen and 3 strains catabolized both octopine and nopaline, whereas 1 strain catabolized only nopaline. All of these strains were resistant to the bacteriocin agrocin-84, except one grapevine strain that belonged to the biotype 1 group and was agrocin sensitive; it is also differed in its plasmid and virulence characteristics. Isolations from Rubus ursinus ollalieberry galls yielded exclusively biotype 2 strains. These strans were insensitive to agrocin-84, utilized nopaline as a sole carbon and nitrogen source, and were highly virulent on all host plants tested. They contained Ti plasmids ranging between 100 and 130 Mdal and occasionally a cryptic plasmid of 69 Mdal. Their Ti plasmids have DNA sequences in common with Ti plasmids of biotype 1 strains and with the conserved region of the T-DNA.     

A comparison of virulence determinants in an octopine Ti plasmid, a nopaline Ti plasmid, and an Ri plasmid by complementation analysis of Agrobacterium tumefaciens mutants

Transposon-insertion mutants with vir^? Ti plasmids were characterized and then used in complementation experiments. One of the mutants (LBA 1517) had a mutation in a newly discovered vir locus called virF. The virF mutation led to a strongly diminished virulence on tomato and tobacco, but not on certain other plant species. Also a mutant (LBA 1505) was isolated with a mutation somewhere in the bacterial genome but outside the octopine Ti plasmid that caused a restriction in host range for tumor induction. Introduction of a nopaline Ti plasmid or an Ri plasmid into LBA 1505 did not restore normal virulence, showing that the vir gene affected in LBA 1505 determines a factor which is essential for normal tumor induction both by different types of Ti plasmids and by the Ri plasmid. The introduction of R primes containing part or all of the octopine Ti plasmid virulence region led to a restoration of virulence in strains with a vir^? nopaline Ti plasmid. Also the transfer of an Ri plasmid to a large number of different vir^? octopine or nopaline Ti plasmid mutants rendered these strains virulent. These results indicate that the octopine Ti plasmid, the nopaline Ti plasmid, and the Ri plasmid each have a similar virulence system which can mediate the transfer of T-DNA to plant cells from different types of Ti or Ri plasmids. In complementation experiments between vir^? octopine Ti plasmid mutations and vir^? nopaline Ti plasmid mutations it was found that equivalent functions are determined by the areas of DNA homology in the virulence regions of these two types of Ti plasmids. The previously defined octopine Ti plasmid virC locus appeared to consist of two different loci. One of these loci was found to be in a region of the octopine Ti plasmid which does not share DNA homology with the nopaline Ti plasmid, and was therefore called virO (octopine Ti plasmid specific). For the other locus the name virC was retained. Whereas mutations in the virC locus were avirulent on all plant species tested, mutations in virO were avirulent on tomato and pea, but virulent on sunflower and Nicotiana rustica. VirO^? mutants produced rooty tumors on Kalanchoë tubiflora.     

Right 25 bp terminus sequence of the nopaline T-DNA is essential for and determines direction of DNA transfer from agrobacterium to the plant genome

We have determined which sequences at the right border of the T-DNA region of the nopaline C58 Ti plasmid are required for transfer and/or integration of the T-DNA into the plant cell genome. The results indicate that the 25 bp T-DNA terminus repeat sequence, TGACAGGATATATTGGCGGGTAAAC, is directly responsible for T-DNA transfer; furthermore, this sequence is directional in its mode of action. A transfer-negative nononcogenic Ti plasmid derivative, pGV3852, was constructed, in which 3 kb covering the right T-DNA border region was substituted for by pBR322 sequences. The pBR322 sequences in pGV3852 provide a site for homologous recombination with pBR-derived plasmids containing sequences to assay for transfer activity. First, a 3.3 kb restriction fragment overlapping the deleted region in pGV3852 was shown to restore transfer activity. Second, a sequence of only 25 bp, the T-DNA terminus sequence, was shown to be sufficient to restore normal transfer activity. The transfer-promoting sequences are most active when reinserted in one orientation, that normally found in the Ti plasmid.     

Interactions between octopine and nopaline plasmids in Agrobacterium tumefaciens.

Transfer of octopine Ti plasmids to strains already carrying an octopine Ti plasmid was found to occur at the same (high) frequency as transfer to Ti plasmid lacking recipients, showing that resident Ti plasmids do not exhibit entry exclusion towards incoming Ti plasmids. The resident octopine Ti plasmid was lost by the recipient after the entrance of the incoming Ti plasmid, which is indicative of the incompatibility between the Ti plasmids. Octopine Ti plasmids were found to become established only infrequently in recipients with a nopaline Ti plasmid and, vice versa, nopaline Ti plasmids were only rarely established in recipients with an octopine Ti plasmid. Rare clones in which the incoming octopine (nopaline) Ti plasmid had been established despite the presence of a nopaline (octopine) Ti plasmid appeared to harbor cointegrates consisting of the entire incoming Ti plasmid and the entire resident Ti plasmid. The integration event invariably had occurred in a region of the plasmids that is highly conserved in evolution and that is essential for oncogenicity. These results show that octopine and nopaline Ti plasmids cannot be maintained as separate replicons by one and the same cell. Therefore, be definition, these plasmids belong to the same incompatibility group, which has been names inc Rh-1. Agrobacterial non-Ti octopine and nopaline plasmids were found to belong to another incompatibility group. The tumorigenic properties of strains harboring two different Ti plasmids, in a cointegrate structure, were indicative of the virulence genes of both of them being expressed. The agrobacterial non-Ti octopine and nopaline plasmids did not influence the virulence properties encoded by the Ti plasmid.     

Sequence analysis of the vir-region from Agrobacterium tumefaciens octopine Ti plasmid pTi15955

The nucleotide sequence of 42 775 bp of the vir-region from the Agrobacterium tumefaciens octopine Ti plasmid pTi15955 is reported here. Although the nucleotide sequences of several parts of this region from this or closely related plasmids have been published previously, the present work establishes for the first time the complete arrangement of all the essential virulence genes and their intergenic regions of an octopine Ti plasmid. The disruption of some of the intergenic areas by insertion (IS) elements is typical for the octopine Ti plasmids. Several new ORFs were identified, including ORFs immediately downstream of virD4 and virE2, which probably represent new genes involved in virulence.     

Association of the virD2 protein with the 5'' end of T strands in Agrobacterium tumefaciens.

The soil bacterium Agrobacterium tumefaciens can incite tumors in many dicotyledonous plants by transferring a portion (T-DNA) of its Ti plasmid into susceptible plant cells. The T-DNA is flanked by border sequences that serve as recognition sites for specific cleavage by an endonuclease that comprises two virD-encoded proteins (VirD1 and VirD2). After cleavage, both double-stranded, nicked T-DNA molecules and single-stranded T-DNA molecules (T strands) were present. We have determined that a protein is tightly associated with, and probably covalently attached to, the 5' end of the T strands. Analysis of deletion derivatives in Escherichia coli, immunoprecipitation, and a procedure combining immunoblot and nucleic acid hybridization data identified this protein as the gene product of virD2.     

Transfer of the octopine T-DNA segment to plant cells mediated by different types of Agrobacterium tumor- or root-inducing plasmids: generality of virulence systems.

Genetic complementation studies demonstrated that the transfer to plant cells of the octopine T-DNA, entirely present as the only part of the tumor-inducing (Ti) plasmid on the plasmid pAL1050, was effected by the virulence systems from related plasmids, viz. the nopaline Ti plasmid pTiC58, the limited host range plasmid pTiAg57, and the root-inducing (Ri) plasmid pRi1855. Rhizobium symbiosis plasmids were not capable of effecting the introduction of pAL1050 into plant cells.     

Virulence of Agrobacterium tumefaciens Strain A281 on Legumes

This study addresses the basis of host range on legumes of Agrobacterium tumefaciens strain A281, an l,l-succinamopine strain. We tested virulence of T-DNA and vir region constructs from this tumor-inducing (Ti) plasmid with complementary Ti plasmid regions from heterologous nopaline and octopine strains.     

An Agrobacterium virulence factor encoded by a Ti plasmid gene or a chromosomal gene is required for T-DNA transfer into plants

Mutagenesis of the vir region on the Ti plasmid of Agrobacterium tumefaciens revealed a new locus, virJ , that is induced by the plant-wound signal molecule, acetosyringone (AS). virJ lies between virA and virB , and is transcribed in the same direction. The amino acid sequence of virJ is similar to a region of a previously characterized chromosomal gene, acvB , required for virulence. virJ can complement the avirulent phenotype of an acvB mutant, indicating that virJ and acvB encode the same factor required for tumorigenesis. Southern analysis revealed that virJ is present on the Ti plasmid of an octopine but not a nopaline strain whereas acvB is present on the chromosomes of both octopine and nopaline strains. While virJ is regulated by AS under the control of the virA/virG two-component regulatory system, acvB is not induced by AS. VirJ possesses a putative signal peptide and was found predominantly in the periplasmic fraction. The strain lacking both acvB and virJ had an impaired ability to transfer T-DNA into plant cells, suggesting that the factor encoded by virJ or acvB is required for T-DNA transfer from A. tumefaciens to plant cells. acvB is the first chromosomal gene implicated in T-DNA transfer, but whether it functions specifically for this process is not clear. We hypothesize that virJ evolved from acvB , presumably for a more specialized role in tumorigenesis.