Aib-containing peptide analogs: Cellular uptake and utilization in oligonucleotide delivery

α-Aminoisobutyric acid (Aib)-containing peptide analogs derived from TV-XIIa, a cell-penetrating peptide (CPP), were synthesized to explore structure-activity relationships. The replacement of Aib at position 1, 5, or 9 in the TV-XIIa amino acid sequence with alanine (Ala) suppressed the cellular uptake, whereas the simultaneous substitution of the two proline (Pro) residues at positions 6 and 10 with Aib (P-IV) considerably increased the cellular uptake. In order to explore the potential use of the Aib-containing peptide analogs for the cellular delivery of oligonucleotides (ODNs), we synthesized a covalent conjugate (P-IV-AON) of a 15-mer antisense ODN, which is complementary to luciferase gene, with P-IV, and the antisense effect of the P-IV-AON conjugate on luciferase expression in A549 cells was examined. Luciferase expression was decreased in the presence of the conjugate upon treatment with the reaction buffer at the concentrations of 5 and 10 μM.     

Cellular uptake of cationic lipid/DNA complexes by cultured myoblasts and myotubes

Several cationic lipids which are highly efficient for delivering genes in vitro do not increase gene delivery in vivo after an intramuscular injection. In order to elucidate the origin of this phenomenon, we have studied the cellular uptake and intracellular fate of cationic lipid/DNA complexes in vitro on myogenic mouse cells (myoblasts and myotubes) of the C2 cell line and of primary cultures. We used a cationic lipid with a spermine head group and its fluorescent analog, and a fluorescent plasmid obtained by nick-translation. In myoblasts, transgene expression was obtained and lipoplexes were internalized in cytoplasmic vesicles. In myotubes, no transgene expression could be detected and we observed an absence of lipoplex internalization. The in vitro uptake of cationic lipid was inversely correlated with the degree of fusion of C2 cell myotubes cultures.     

Inhibition of cell adhesion to plastic substratum by phosphorothioate oligonucleotide.

Antisense oligonucleotides have been widely used to achieve specific inhibition of targeted gene expression. However, the mechanism of action is not well understood and in many systems sequence-independent effects occur. We have recently shown that chronic administration of an antisense c-myc phosphorothioate oligonucleotide can specifically inhibit expression of the c-myc protein and growth in human breast cancer cells. We now identify an additional effect of the same oligonucleotide on cell adhesion. Transient delivery through electroporation of 2.5 microM antisense-myc oligonucleotide to MCF-7 cells results in 85% inhibition of adhesion to plastic substratum within 24 h. Both the onset of this effect and the subsequent recovery occur without a change in cell viability, growth, or alteration of adhesion to Matrigel, collagen IV, laminin, or fibronectin. However, no parallel changes in c-myc mRNA or protein expression are detectable, suggesting that in this instance inhibition of adhesion caused by antisense-myc oligonucleotide may involve a mechanism independent of the target sequence.     

Cellular uptake of covalent conjugates of oligonucleotide with membrane-modifying peptide, peptaibol

Using the membrane-modifying peptide, trichorovin-XIIa (TV-XIIa), which is an 11-residual peptaibol isolated from the fungus Trichoderma viride, we synthesized covalent conjugates of 20-mer oligonucleotide with TV-XIIa to examine the potential use of TV-XIIa in cellular delivery. The results indicated that the conjugates were progressively taken up by human lung carcinoma A549 cells. Next, the antisense effects of the conjugates on p53 protein expression were examined. The p53 expression was significantly decreased by ca. 20-50% in the presence of the conjugates upon treatment with the transfection solution at the concentration of 5 μM.     

Antisense gene inhibition by phosphorothioate antisense oligonucleotide in Arabidopsis pollen tubes

Sexual reproduction is an essential biological event for proliferation of plants. The pollen tube (PT) that contained male gametes elongates and penetrates into the pistils for successful fertilization. However, the molecular mechanisms of plant fertilization remain largely unknown. Here, we report a transient inhibition of gene function using phosphorothioate antisense oligodeoxynucleotides (AS‐ODNs) without cytofectin, which is a simple way to study gene function in Arabidopsis thaliana PTs. The PTs treated with AS‐ODNs against both ANX1 and ANX2 showed short, knotted, and ruptured morphology in vitro/semi‐in vitro, whereas normal PT growth was shown in its sense control in vitro/semi‐in vitro. PT growth was impaired in a manner dependent on the dose of AS‐ODNs against both ANX1 and ANX2 above 10 μm . The treatment with AS‐ODNs against ROP1 and CalS5 resulted in waving PTs and in short PTs with a few callose plugs, respectively. The expression levels of the target genes in PTs treated with their AS‐ODNs were lower than or similar to those in the sense control, indicating that the inhibition was directly or indirectly related to the expression of each mRNA. The AS‐ODN against fluorescent protein (sGFP) led to reduced sGFP expression, suggesting that the AS‐ODN suppressed protein expression. This method will enable the identification of reproductively important genes in Arabidopsis PTs.     

Cellular uptake of cationic gadolinium-DOTA peptide conjugates with and without N-terminal myristoylation

Cellular and nuclear uptake of dual labelled conjugates could be of great value for chemotherapy and cancer diagnostics. Therefore we designed conjugates in which gadolinium (Gd)-1,4,7,10-tetraazacyclododecane-1,4,7,10-tetraacetic acid (DOTA), a contrast agent for magnetic resonance imaging and fluorescein isothiocyanate (FITC), a fluorescence marker were coupled to membrane translocation sequences (MTS). The MTSs we employed were the third helix of the Antennapedia homeodomain, the HIV-1 Tat peptide and the N-myristoylated HIV-1 Tat peptide. We used confocal laser scanning microscopy, fluorescence activated cell sorting, magnetic resonance imaging (MRI) and viability tests to examine the cellular and nuclear uptake of these conjugates into U373 glioma cells, as well as their cytotoxic effects. We found that the Antennapedia conjugate was taken up by no more than 20% of the cells. The HIV-1 Tat conjugate showed even lower uptake into less than 3% of cells. Interestingly, N-myristoylation of the HIV-1 Tat conjugate drastically improved its cellular uptake. Up to 70% of cells showed cellular and nuclear uptake of the N-myristoylated HIV-1 Tat conjugate. Conjugate cytotoxicity appears to correlate with cellular uptake.     

Kinetics of phosphorothioate oligonucleotide metabolism in biological fluids.

The in vitro stability and metabolism of GEM[91, a 25mer phosphorothioate antisense oligonucleotide complementary to the gag mRNA region of HIV-1, was investigated using capillary electrophoresis (CE). The in vitro degradation of the parent compound at 37 degrees C was followed over the course of 120 h in human plasma. A CE method using laser-induced fluorescence detection was able to detect 5'-end intact metabolites including the parent compound extracted from biological fluids. Because the primary metabolic pathway is believed to be via 3'-exonuclease activity, the results of this study were compared with the stability of the compound in a solution containing 3'-exonuclease. The numerical solution of sequential first-order reactions was used to obtain kinetic parameters. Exonuclease digestion of the parent compound, as measured using an automated CE-UV instrument, yielded striking similarities between the two in vitro systems as well as between in vitro and in vivo systems.     

Stimulation of murine lymphocyte proliferation by a phosphorothioate oligonucleotide with antisense activity for herpes simplex virus

To investigate further the immunological properties of nucleic acids, the mitogenicity of a phosphorothioate oligonucleotide (S-oligo 1082) with anti-sense activity for herpes simplex virus was tested. This compound stimulated proliferation and antibody production by murine lymphocytes in in vitro cultures. Proliferation was dose-dependent and unaffected by T cell depletion. Furthermore, inclusion of a non-mitogenic DNA in the medium did not block stimulation. Since 1082 does not have homology to a known gene involved in lymphocyte activation, these observations suggest that S-oligo antisense compounds may display non-specific activating effects, at least on murine B cells.     

Interaction of cationic bilayer fragments with a model oligonucleotide

The interaction between cationic bilayer fragments and a model oligonucleotide was investigated by differential scanning calorimetry, turbidimetry, determination of excimer to monomer ratio of 2-(10-(1-pyrene)-decanoyl)-phosphatidyl-choline in bilayer fragment dispersions and dynamic light scattering for sizing and zeta-potential analysis. Salt (Na?HPO?), mononucleotide (2'-deoxyadenosine-5'-monophosphate) or poly (dA) oligonucleotide (3'-AAA AAA AAA A-5') affected structure and stability of dioctadecyldimethylammonium bromide bilayer fragments. Oligonucleotide and salt increased bilayer packing due to bilayer fragment fusion. Mononucleotide did not reduce colloid stability or did not cause bilayer fragment fusion. Charge neutralization of bilayer fragments by poly (dA) at 1:10 poly (dA):dioctadecyldimethylammonium bromide molar ratio caused extensive aggregation, maximal size and zero of zeta-potential for the assemblies. Above charge neutralization, assemblies recovered colloid stability due to charge overcompensation. For bilayer fragments/poly (dA), the nonmonotonic behavior of colloid stability as a function of poly (dA) concentration was unique for the oligonucleotide and was not observed for Na?HPO? or 2'-deoxyadenosine-5'-monophosphate. For the first time, such interactions between cationic bilayer fragments and mono- or oligonucleotide were described in the literature. Bilayer fragments/oligonucleotide assemblies may find interesting applications in drug delivery.     

Maternal and fetal distribution of a phosphorothioate oligonucleotide in rats after intravenous infusion

BACKGROUND: Fetal uptake of an antisense oligonucleotide was evaluated after intravenous (i.v.) dosing of ISIS 2105, a 20-base phosphorothioate oligonucleotide, in timed-pregnant Sprague-Dawley rats. METHODS: To maximize the potential for fetal exposure, ISIS 2105 was administered as a 3-hr infusion at 6.6 mg/kg/hr with a total dose of 20 mg/kg, or as a continuous 7-day infusion at 0.35 mg/kg/hr with a total dose of 59 mg/kg. This dosing regime is higher than a patient would be expected to receive in the clinical use of oligonucleotides. Infusions were delivered through a jugular vein cannula by syringe pump on gestation day (GD) 19 (3-hr exposure) or by osmotic pumps implanted subcutaneously (s.c.) starting on GD 12 (7-day exposures). RESULTS: After a 3-hr infusion, maternal and fetal plasma concentrations of ISIS 2105 were >100 microg/ml and <0.07 microg/ml, respectively with a maternal fetal ratio of >1,000. Maternal regions of the placenta had twice the oligonucleotide concentration compared to fetal regions of the placenta (6 microg/g vs. 3 microg/g). After this acute exposure the concentrations in fetal kidney and liver were approximately 140- and 500-fold less than the maternal kidney and liver respectively. After 7-day infusion maternal plasma concentrations were 0.82 microg/ml and fetal concentrations were <0.22 microg/ml. By capillary gel electrophoresis (CGE) only the fetal liver consistently had quantifiable oligonucleotide concentrations (range=1.01-4.95 microg/g) compared to a mean concentration of 50.11+/-1.71 microg/g in the maternal liver a maternal to fetal ratio of approximately 10:50 after 7 days of infusion. CONCLUSIONS: There was a low level of transfer from dam to fetus, consistent with a slow equilibrium but the permeability of placenta to this 6 kDa polyanionic compound seemed to be limited even at supraclinical doses.     

In vitro and in vivo characterisation of a novel c-FLIP-targeted antisense phosphorothioate oligonucleotide

Previous studies have suggested that the caspase 8 inhibitor FLIP is a promising anti-cancer therapeutic target. In this study, we characterised a novel FLIP-targeted antisense phosphorothioate oligonucleotide (AS PTO). FLIP AS and control PTOs were assessed in vitro in transient transfection experiments and in vivo using xenograft models in Balb/c nude mice. FLIP expression was assessed by QPCR and Western. Apoptosis induction was determined by flow cytometry and Western. Of 5 sequences generated, one potently down-regulated FLIP. AS PTO-mediated down-regulation of FLIP resulted in caspase 8 activation and apoptosis induction in non-small cell lung (NSCLC) cells but not in normal lung cells. Similar results were observed in colorectal and prostate cancer cells. Furthermore, the FLIP AS PTO sensitized cancer cells but not normal lung cells to apoptosis induced by rTRAIL. Moreover, the FLIP AS PTO enhanced chemotherapy-induced apoptosis in NSCLC cells. Importantly, compared to a control non-targeted PTO, intra-peritoneal delivery of FLIP AS PTO inhibited the growth of NSCLC xenografts and enhanced the in vivo antitumour effects of cisplatin. We have identified a novel FLIP-targeted AS PTO that has in vitro and in vivo activity and which therefore has potential for further pre-clinical development.     

Reactive derivatives of oligonucleotide phosphorothioate analogues: IV. Site-directed modification of nucleic acids and intramolecular alkylation of phosphorothioate groups

Alkylation of the 22-mer DNA target pTGCCTGGAGCTGCTTGATGCCC (I) by oligodeoxynucleotide phosphorothioate derivatives (PTAO) GpsCpsApsTpsCpsApsApsGpsCpsApsGpsCpN(CH₃)CH₂(RCl)(II-PS) and (RCl)CH₂N(CH₃)pGpsCpsAps TpsCpsApsApsGpsCpsApsGpsC (III-PS) bearing a residue of an aromatic analogue of nitrogen lost (RCl=C₆H₄N(CH₃)(CH₂CH₂Cl) at the 3′- or 5′-end was studied. It was shown that the internucleotide phosphorothioate bonds do not affect the regiospecificity of the target modification. The maximum degree of the target modification (att→∞) at 20°C was about 25% for both (II-PS) and (III-PS). The use of GCATCAAGCAGCpN(CH₃)CH₂(RCl)(II-PO), containing internucleotide phosphodiester bonds, under the same conditions gave about 65% of the modified DNA. Kinetics of the PTAO-induced complementarily addressed nucleic acid (NA) modification was analyzed. The rate constants of the reaction of the intermediate reactive ethylenimmonium ion with phosphorothioate groups of the reagents were evaluated both in solution and in duplex. The intramolecular alkylation of phosphorothioate groups considerably affected the DNA target modification by decreasing the effectiveness of the modification in a wide range of temperatures and changing the temperature dependence of the modification from a bell-like to an S-like profile. It was concluded that, in the course of the modification, the PTAO phosphorothioate groups are intramolecularly alkylated both in solution and in the complementary NA target-oligonucleotide duplex. For Part III, see [1].     

Cellular proteins prevent antisense phosphorothioate oligonucleotide (SdT18) to target sense RNA (rA18): development of a new in vitro assay

There are numerous indications that the "antisense" mechanism alone cannot account for the observed effects in living cells. Despite that, interactions between antisense oligonucleotides (ASO) and cellular proteins are usually not considered. In this work, we have tested the ability of antisense phosphorothioate (SdT) oligonucleotides and natural deoxyoligonucleotides (dT) for their ability to interact with target RNA in the presence of cellular proteins. We show that the affinity for cellular proteins is an essential factor that determines the success of RNA targeting. We have used a simple nuclease digestion assay to detect RNA/ASO hybrid formation in the presence of proteins. The results show the inability of a phosphorothioate oligonucleotide (SdT18) to reach the target RNA (rA18) in vitro in the presence of proteins. However, if proteins are absent, the RNA targeting was successful, as is usual in in vitro assays. Note that the target RNA concentration exceeded physiological values by several orders of magnitude while the crude protein extract was 20-fold diluted in the reaction tube. This finding is compatible with the notion that therapeutic properties of phosphorothioates could largely derive from a so-called "aptamer" effect.     

Parallel-stranded guanine quadruplex interactions with a copper cationic porphyrin

G-quadruplexes are formed by association of DNA strands containing multiple contiguous guanines. The capability of drugs to induce formation of or stabilize G-quadruplexes is an active area of investigation. We report the interactions of CuTMpyP4, the Cu(2+) derivative of 5,10,15,20-tetrakis(1-methyl-4-pyridyl)-21H,23H-porphine, with the parallel-stranded G-quadruplexes formed by d(T(4)G(4)T(4)) (1) and d(T(4)G(8)T(4)) (3). Absorption titrations of CuTMpyP4 with (1)(4) or (3)(4) cause both bathochromicity and hypochromicity of the porphyrin Soret band, with larger changes observed for the longer oligonucleotide. An approximate binding constant for (1)(4) and CuTMpyP4 according to the Scatchard model is 5.6 x 10(6) M(-)(1) in terms of quadruplexes and according to the McGhee-von Hippel model is 1.3 x 10(6) M(-)(1) in terms of potential binding sites. An approximate binding constant for (3)(4) and CuTMpyP4 according to the Scatchard model is 5.2 x 10(7) M(-)(1) in terms of quadruplexes and in terms of the McGhee-von Hippel model is 2.4 x 10(6) M(-)(1) in terms of potential binding sites. The site size for CuTMpyP4 and (1)(4) is four using the McGhee-von Hippel model. We find a 2:1 binding stoichiometry for CuTMpyP4 and (1)(4) and a 3:1 binding stoichiometry for CuTMpyP4 and (3)(4) using the method of continuous variation analysis. Induced emission spectra of CuTMpyP4 with (1)(4) or (3)(4) indicate a mode of binding in which the ligand is protected from the solvent. Electron paramagnetic resonance spectra of CuTMpyP4 with added oligonucleotide show an increase in the Cu-N superhyperfine coupling constant as the length of the oligonucleotide increases. On the basis of these data, we propose that for both (1)(4) and (3)(4), CuTMpyP4 molecules externally stack at each end of the run of guanines, similar to other planar G-quadruplex ligands. For (3)(4), our data are consistent with intercalation of a CuTMpyP4 molecule into the G-quadruplex.     

Mechanisms of single-stranded phosphorothioate modified antisense oligonucleotide accumulation in hepatocytes

Single-stranded antisense oligonucleotides (SSOs) are used to modulate the expression of genes in animal models and are being investigated as potential therapeutics. To better understand why synthetic SSOs accumulate in the same intracellular location as the target RNA, we have isolated a novel mouse hepatocellular SV40 large T-antigen carcinoma cell line, MHT that maintains the ability to efficiently take up SSOs over several years in culture. Sequence-specific antisense effects are demonstrated at low nanomolar concentrations. SSO accumulation into cells is both time and concentration dependent. At least two distinct cellular pathways are responsible for SSO accumulation in cells: a non-productive pathway resulting in accumulation in lysosomes, and a functional uptake pathway in which the SSO gains access to the targeted RNA. We demonstrate that functional uptake, as defined by a sequence-specific reduction in target mRNA, is inhibited by brefeldin A and chloroquine. Functional uptake is blocked by siRNA inhibitors of the adaptor protein AP2M1, but not by clathrin or caveolin. Furthermore, we document that treatment of mice with an AP2M1 siRNA blocks functional uptake into liver tissue. Functional uptake of SSO appears to be mediated by a novel clathrin- and caveolin-independent endocytotic process.     

Phosphodiester and phosphorothioate oligonucleotide condensation and preparation of antisense nanoparticles

Protamine is a cationic peptide with a molecular mass of approx. 4000 Da that is able to condense DNA. In the present study it was used to complex antisense oligonucleotides (ODNs) and to form solid particles with initial diameters of 90-150 nm. The reaction was very rapid and occurred by simple mixing of diluted solutions of the polycation with the oligonucleotide. The aggregation was dependent on the oligonucleotide chain length and the protamine/ODN mass ratio. Particle formation required a minimal chain length of nine nucleotides and a mass ratio of 0.5:1. The particle surface charge and the number of particles depended on the mass ratio. With increasing amounts of the peptide, the number of particles and the zeta potential increased. Both negatively and positively charged particles improved the stability of oligonucleotides against DNase I digestion. Above a mass ratio of 2.5:1 no degradation was found. The uptake of unbound rhodamine-labelled ODNs and its complexes with protamine was determined with Vero cells under in vitro cell culture conditions at 37 degrees C and 4 degrees C. At 37 degrees C the cellular uptake increased with increasing mass ratio. The internalized oligonucleotides were localized in the cytoplasm and in the nucleus of the cells. When Vero cells were treated with these samples at 4 degrees C for 4 h, no fluorescence could be detected inside the cells. Therefore, our data indicate an energy dependent endocytotic uptake mechanism. In contrast, spermine and spermidine, which are also known condensation agents, did not aggregate with oligonucleotides into nanoparticles under the same conditions.     

Photobactericidal plastic films based on cellulose esterified by chloroacetate and a cationic porphyrin

The synthesis and characterisation of pyridinium porphyrinic chloroacetyl cellulose ester chlorides, where photosensitizing agents are covalently bounded to the polymeric chain, is presented in this paper. First, cellulose was homogenously converted into chloroacetate cellulose ester in DMAc/LiCl solvent by using chloroacetyl chloride. The complete substitution of cellulose was achieved using 7equiv of chloroacetyl chloride for a 2h reaction at room temperature. The absence of base did not prove detrimental to reaction. The grafting of monopyridyltritolylporphyrin onto chloroacetate cellulose ester was then realised by alkylation of the photosensitizer in DMF. These new plastic films were found to be thermostable up to 55 degrees C; higher temperatures led to progressive deacetylation. First results of their photobactericidal activity against Staphylococcus aureus and Escherichia coli strains are very encouraging. Such materials could find applications in medical environments as an alternative to overcome the rampant bacterial multiresistance to classical antibiotics.     

Circular dichroism spectroscopy of a cationic porphyrin bound to DNA

Recently, the porphyrin photosensitizer meso-tetra(4-N-methyl-pyridyl)-porphine was identified as a DNA-reactive agent demonstrating both electrostatic and intercalative binding. A series of porphyrin derivatives were synthesized and studied to see if similar compounds manifested identical behavior. One derivative, meso-tetra(p-N-trimethylanilinium) porphine did not exhibit intercalation behavior but did show avid binding and novel circular dichroic features when bound to B-form DNA. At an ionic strength of 1.02, the binding constant was found to be on the order of 10⁴ and higher at lower ionic strength. The large binding constants and induced optical activity suggest that at large porphyrin/DNA ratios the final porphyrin · DNA complex may take the form of a suprahelical helix.     

Complex formation and vectorization of a phosphorothioate oligonucleotide with an amphipathic leucine- and lysine-rich peptide: study at molecular and cellular levels

Optical spectroscopic techniques such as CD, Raman scattering, and fluorescence imaging allowed us to analyze the complex formation and vectorization of a single-stranded 20-mer phosphorothioate oligodeoxynucleotide with a 15-mer amphipathic peptide at molecular and cellular levels. Different solvent mixtures (methanol and water) and molecular ratios of peptide/oligodeoxynucleotide complexes were tested in order to overcome the problems related to solubility. Optimal conditions for both spectroscopic and cellular experiments were obtained with the molecular ratio peptide/oligodeoxynucleotide equal to 21:4, corresponding to a 7:5 ratio for their respective +/- charge ratio. At the molecular level, CD and Raman spectra were consistent with a alpha-helix conformation of the peptide in water or in a methanol-water mixture. The presence of methanol increased considerably the solubility of the peptide without altering its alpha-helix conformation, as evidenced by CD and Raman spectroscopies. UV absorption melting profile of the oligodeoxynucleotide gave rise to a flat melting profile, corresponding to its random structure in solution. Raman spectra of oligodeoxynucleotide/peptide complexes could only be studied in methanol/water mixture solutions. Drastic changes observed in Raman spectra have undoubtedly shown: (a) the perturbation occurred in the peptide secondary structure, and (b) possible interaction between the lysine residues of the peptide and the oligodeoxynucleotide. At the cellular level, the complex was prepared in a mixture of 10% methanol and 90% cell medium. Cellular uptake in optimal conditions for the oligodeoxynucleotide delivery with low cytotoxicity was controlled by fluorescence imaging allowing to specifically locate the compacted oligonucleotide labeled with fluorescein at its 5'-terminus with the peptide into human glioma cells after 1 h of incubation at 37 degrees C.     

Investigation of a facile synthetic method for phosphorothioate dimer synthons in oligonucleotide phosphorothioates synthesis

A facile synthetic method of a phosphorothioate dimer block was investigated. Dinucleoside phosphite triester intermediates were obtained in one-pot synthesis by the coupling of a protected nucleoside bearing free 5'-OH and a protected nucleoside bearing free 3'-OH in the presence of phosphorous trichloride (PCl3) and 1,2,4-triazole. The intermediates were easily sulfurized to afford the desired phosphorothioate dimer blocks in 33-64% overall yields.