Transcription of gene in an acrystalliferous strain of Bacillus thuringiensis XBU001 positively regulated by the metalloprotease camelysin gene at the onset of stationary phase

The calY gene, encoding metalloprotease camelysin in the Bacillus thuringiensis acrystalliferous strain XBU001, was amplified and sequenced. The camelysin from the calY sequence was 199 amino acids in size (c. 22?000?Da). The temperature-sensitive plasmid pKESX was used to construct a metalloprotease camelysin-deficient strain of B. thuringiensis. The calY gene was replaced by an erythromycin-resistant gene in KCTF. Sodium dodecyl sulfate polyacrylamide gel electrophoresis and MS analysis showed that the metalloprotease InhA was not expressed after knocking out the gene calY. The temperature-sensitive plasmid pKPC was used to construct a metalloprotease camelysin complementation strain KCTFC. The InhA protein was found in KCTFC. Analysis of the expression of InhA in the wild-type strain KCTF12, camelysin-deficient and complementation strains indicated that inhA expression depended on camelysin. Although camelysin did not directly regulate the expression of the InhA through binding to the promoter of the inhA, the results suggest that camelysin can positively regulate the expression of the InhA protein.     

A temperature-sensitive mutant ofEscherichia coli with an alteration in ribosomal protein L22

A temperature-sensitive, protein synthesis-defective mutant ofEscherichia coli exhibiting an altered ribosomal protein L22 has been investigated. The temperature-sensitive mutation was mapped to therplV gene for protein L22. The genes from the wild type and mutant strains were amplified by the polymerase chain reaction and the products were sequenced. A cytosine to thymine transition at position 22 of the coding sequence was found in the mutant DNA, predicting an arginine to cysteine alteration in the protein. A single cysteine residue was found in the isolated mutant protein. This amino acid change accounts for the altered mobility of the mutant protein in two-dimensional gels and during reversed-phase HPLC. The temperature-sensitive phenotype was fully complemented by a plasmid carrying the wild type L22 gene. Ribosomes from the complemented cells showed only wild type protein L22 by two dimensional gel analysis and were as heat-resistant as control ribosomes in a translation assay. The point mutation in the L22 gene is uniquely responsible for the temperature-sensitivity of this strain.     

Structure and function of tryptophan tRNA from wheat germ.

The coding properties of tRNATrp from yeast and wheat germ were studied. Unlike E. coli tRNATrp or mitochondrial tRNATrp, eukaryotic tRNATrp did not recognize the UGA codon in vitro. The sequence of wheat germ tRNATrp as determined by [32P] post-labelling techniques is: [sequence in text] The interesting features are: (i) Presence of a C11:G24 base pair in contrast to the U11:G24 in E. coli Su- tRNATrp. (ii) The anticodon sequence is -CmCA- compared to -CCA- in E. coli tRNATrp. (iii) Lack of a hypermodified base i6A adjacent to the 3'-end of the anticodon. (iv) Presence of -T psi CG- sequence instead of -psi psi CG- sequence present in mammalian tRNATrp.     

Acetate-nonutilizing mutants of Neurospora crassa: acu-6, the structural gene for PEP carboxykinase and inter-allelic complementation at the acu-6 locus

Summary Revertants of an acu-6 mutant of Neurospora crassa have been isolated. One revertant, which showed temperature-sensitive growth on acetate (Fig. 2), was found to possess an abnormally thermolabile PEP carboxykinase (Fig. 3). The temperature-sensitive property mapped at, or extremely close to, the site of the original mutation, confirming that acu-6 is the structural gene for PEP carboxykinase.A group of acu-6 mutants were examined by polyacrylamide gel electrophoresis for the presence of a protein migrating in the same position as PEP carboxykinase. Two of the seven mutants examined were found to possess such protein and both of these show inter-allelic complementation. When grown on acetate the complementing heterokaryons showed about 5% of the wild type level of PEP carboxykinase activity. This activity was more thermolabile than that in wild type (Fig. 6) and the heterokaryons showed temperature-sensitive growth on acetate (Fig. 5).     

The effect of point mutations affecting Escherichia coli tryptophan tRNA on anticodon-anticodon interactions and on UGA suppression

tRNA species in Escherichia coli that translate codons starting with U contain 2-methyl-thio-N6-isopentenyl-adenosine in position 37, 3' adjacent to the anticodon. The role of this hypermodification in protein synthesis and trp operon attenuation has been investigated. Temperature-jump relaxation methods have been applied to study the interaction between E. coli tRNAPro, with anticodon VGG (V is uridine-5-oxyacetic acid) complementary to that of tRNATrp, and three species of E. coli tRNATrp: wild type tRNATrp (with ms2i6A37 and G24), UGA suppressor tRNATrp (with ms2i6A37 and A24 in the dihydrouridine stem but the same anticodon CCA), and the same suppressor molecule but ms2i6A-deficient as a result of the mutation miaA. Complex formation between tRNAPro and ms2i6A-containing tRNATrp shows thermodynamic parameters close to those found for several other pairs of tRNA with complementary anticodons. However, ms2i6A-deficient tRNATrp makes less stable complexes with tRNAPro, which dissociate eightfold faster. No effect on the complementary anticodon interaction of the mutation in the dihydrouridine stem can be detected. When the tRNA analogous to the opal codon, E. coli tRNASerIV (anticodon VGA) replaces tRNAPro in similar experiments, very weak complexes are observed with both normally hypermodified species of tRNATrp, the wild type and UGA suppressor; these show a lifetime about 50-fold shorter than with tRNAPro, but are again similar. No complex formation is detectable with the ms2i6A-deficient species. This may explain why the hypermodification is necessary for the efficient suppression of the UGA terminator of Q beta coat protein in vitro. The data on complexes with tRNAPro suggest that deficiency in ms2i6A may also reduce the efficiency of UGG reading. Thus, miaA may affect trp operon attenuation by slowing translation of the tandem UGG codons in the leader sequence. Temperature-jump differential spectra suggest that ms2i6 stabilizes the anticodon interaction by improved stacking of base 37.     

Site-specific targeting of aflatoxin adduction directed by triple helix formation in the major groove of oligodeoxyribonucleotides.

The targeted adduction of aflatoxin B1- exo -8,9-epoxide (AFB1- exo -8,9-epoxide) to a specific guanine within an oligodeoxyribonucleotide containing multiple guanines was achieved using a DNA triplex to control sequence selectivity. The oligodeoxyribonucleotide d(AGAGAAGATTTTCTTCTCTTTTTTTTCTCTT), designated '3G', spontaneously formed a triplex in which nucleotides C27*G2*C18 and C29*G4*C16 formed base triplets, and nucleotides G7*C13formed a Watson-Crick base pair. The oligodeoxyribonucleotide d(AAGAAATTTTTTCTTTTTTTTTTCTT), designated '1G', also formed a triplex in which nucleotides C24*G3*C24 formed a triplet. Reaction of the two oligodeoxyribonucleotides with AFB1-exo-8,9-epoxide revealed that only the 3G sequence formed an adduct, as determined by UV absorbance and piperidine cleavage of the 5'-labeled adduct, followed by denaturing polyacrylamide gel electrophoresis. This site was identified as G7by comparison to the guanine-specific cleavage pattern. The chemistry was extended to a series of nicked bimolecular triple helices, constructed from d(AAAGGGGGAA) and d(CnTTCTTTTTCCCCCTTTATTTTTTC5-n) (n = 1-5). Each oligomer in the series differed only in the placement of the nick. Reaction of the nicked triplexes with AFB1- exo -8,9-epoxide, piperidine cleavage of the 5'-labeled adduct, followed by denaturing polyacrylamide gel electrophoresis, revealed cleavage corresponding to the guanine closest to the pyrimidine strand nick. By using the appropriate pyrimidine sequence the lesion was positioned within the purine strand.     

R plasmid dihydrofolate reductase with subunit structure.

Dihydrofolate reductase, specified by the type II plasmid of a trimethoprim-resistant Escherichia coli, was purified 40-fold to homogeneity using a combination of gel filtration, DEAE-Sephacel chromatography, and hydrophobic chromatography. The final product shows a single protein band on polyacrylamide gel electrophoresis and has a specific activity of 1.0 unit/mg. The molecular weight of the purified enzyme is 36,000 as determined both by gel filtration and Ferguson analysis of polyacrylamide gel electrophoresis. In contrast, a single polypeptide with a molecular weight of 8,500 was observed on sodium dodecyl sulfate-gel electrophoresis. These experiments suggest that, unlike any bacteria or vertebrate dihydrofolate reductase previously examined, the type II R plasmid reductase is a tetramer composed of four identical subunits. A partial amino acid sequence determination shows no heterogeneity of the subunits and also no clear homology with any reductase sequence previously reported.     

DNA detection system using molecularly imprinted polymer as the gel matrix in electrophoresis

To develop a simple and inexpensive method for DNA detection, we prepared a molecularly imprinted polymer (MIP) for recognizing a specific double-stranded DNA (dsDNA) sequence and used it in an electrophoretic gel matrix. The MIP gel has many binding sites that are complementary in size, shape, and arrangement of functional groups of the target dsDNA sequence. During MIP gel electrophoresis (MIPGE), migration of the target dsDNA should be hindered by the capture effect of the binding sites in the MIP gel. This was confirmed by observation of deviations from the linear relationship between the migration distances of the DNA standard size markers in the polyacrylamide gel and those in the MIP gel. The migration distances of nontarget dsDNA maintained a linear relationship, however. In addition, the sequence selectivity of dsDNA in this method was investigated by using the Ha-ras gene and its point mutants. Except for A.T to T.A base pair substitution, mutant dsDNA (for example, substitution from A.T to C.G and from G.C to T.A) could be distinguished from the target (wild-type) dsDNA. Although some improvement in A.T (T.A) base pair distinction is still needed, this study is the first to demonstrate detection of a specific dsDNA sequence with MIPs and, as such, opens up a new realm for practical applications of MIPs.     

Genetic characterization of a novel Tib-derived variant of soybean Kunitz trypsin inhibitor detected in wild soybean (Glycine soja).

A novel variant of soybean Kunitz trypsin inhibitor (SKTI) was detected in 530 lines of wild soybean (Glycine soja). This variant showed an intermediate electrophoretic mobility between the Tia and Tic types. In isoelectric focusing polyacrylamide gel electrophoresis gels containing urea, this variant had a similar isoelectric point as that of Tia. The genetic analysis of SKTI bands in F2 seeds from crosses of the new variant type with Tia or Tic type showed that this variant type is controlled by a codominant allele at the SKTI locus. We propose the genetic symbol Tif for this novel variant. When the nucleotide sequence of the Tif gene was compared with those of other types of SKTI genes (Tia, Tib, and Tic), the sequence of Tif was identical to that of Tib with the exception of one A-->G transitional mutation occurring at position 676 of Tif. This mutation resulted in an amino acid change from Lys to Glu at the 178 residue. These results suggest that this variant is derived from Tib through a point mutation. In addition, we settled an inconsistency in the number of amino acid differences between Tia and Tib (eight or nine). Analysis of nucleotide and amino acid sequences revealed that Tib was different from Tia by nine amino acids.     

Cloning, nucleotide sequence, and expression in Escherichia coli of the Bacillus stearothermophilus peroxidase gene (perA).

The gene encoding a thermostable peroxidase was cloned from the chromosomal DNA of Bacillus stearothermophilus IAM11001 in Escherichia coli. The nucleotide sequence of the 3.1-kilobase EcoRI fragment containing the peroxidase gene (perA) and its flanking region was determined. A 2,193-base-pair open reading frame encoding a peroxidase of 731 amino acid residues (Mr, 82,963) was observed. A Shine-Dalgarno sequence was found 9 base pairs upstream from the translational starting site. The deduced amino acid sequence coincides with those of the amino terminus and four peptides derived from the purified peroxidase of B. stearothermophilus IAM11001. E. coli harboring a recombinant plasmid containing perA produced a large amount of thermostable peroxidase which comigrated on polyacrylamide gel electrophoresis with the B. stearothermophilus peroxidase. The peroxidase of B. stearothermophilus showed 48% homology in the amino acid sequence to the catalase-peroxidase of E. coli.     

An apparent discrepancy between chain length and electrophoretic mobility of restriction fragments: a case of human mitochondrial DNA

Summary DNA sequence analysis and electrophoresis in denaturing gel revealed that a 60 base pair insertion which had been previously postulated on the basis of native polyacrylamide gel electrophoresis of mitochondrial DNA from Japanese (Horai and Matsunaga 1986) did not exist at all. Unusual behavior of certain restriction fragments in native polyacrylamide gels apparently resulted in what appeared to be an insertion. Further study revealed that this behavior is most likely due to secondary structures of the fragments. The results of the present study suggest that adequate care should be taken when assessing molecular weights of restriction fragments by native polyacrylamide gel electrophoresis.     

R plasmid dihydrofolate reductase with a dimeric subunit structure

Dihydrofolate reductase specified by plasmid R483 from a trimethoprim-resistant strain of Escherichia coli has been purified 2,000-fold to homogeneity using dye-ligand chromatography, gel filtration, and polyacrylamide gel electrophoresis. The protein migrated as a single band on nondenaturing polyacrylamide gel electrophoresis and had a specific activity of 250 mumol/mg min(-1). The molecular weight was estimated to be 32,000 by gel filtration and 39,000 by Ferguson analysis of polyacrylamide gel electrophoresis. When subjected to electrophoresis in the presence of sodium dodecyl sulfate, the protein migrated as a single 19,000-molecular weight species, a fact that suggests that the native enzyme is a dimer of similar or identical subunits. Antibody specific for R483-encoded dihydrofolate reductase did not cross-react with dihydrofolate reductase encoded by plasmid R67, T4 phage, E. coli RT500, or mouse L1210 leukemia cells. The amino acid sequence of the first 34 NH2-terminal residues suggests that the R483 plasmid dihydrofolate reductase is more closely related to the chromosomal dihydrofolate reductase than is the enzyme coded by plasmid R67.     

Purification and properties of a non-histone chromatin protein with a molecular weight of 38,000 daltons specific for transformed rat cells

Non-histone chromatin proteins prepared from a normal rat cell line (No. 7) and the cells transformed with Rous sarcoma virus (RSV) (s7-1) were compared by means of reverse-phase high performance liquid chromatography (reverse-phase HPLC), followed by SDS-polyacrylamide gel electrophoresis (SDS-PAGE). The results revealed that several proteins were specifically present in the transformed cell chromatin. A specific non-histone chromatin protein with a molecular weight of 38,000 daltons, 38K protein, was purified as a single species from s7-1 cells. This 38K protein was only detected in the transformed state of the cells transformed with a temperature-sensitive (ts) mutant of the src gene and the mutant cells which showed temperature sensitivity as to the transformation with wild type RSV.     

New rapid methods for DNA sequencing based in exonuclease III digestion followed by repair synthesis.

We describe improve enzymatic methods for sequencing method for sequencing DNA. They are based on partial digestion of duplex DNA with exonuclease III to produce DNA molecules with 3' ends shortened to varying lengths, followed by repair synthesis to extend and label the 3' ends. After asymmetrical cleavage of the DNA with a restriction enzyme, the labeled products are separated by gel electrophoresis and the sequence read from the autoradiogram. The entire procedures, beginning with unrestricted DNA and followed through gel electrophoresis, takes only one day for sequencing both strands of the DNA molecule. These methods are especially suitable for sequencing DNA cloned in plasmid vectors, and they greatly extend the usefulness of the dideoxynucleotide chain termination method of Sanger et al. (Proc. Natl. Acad. Sci. USA 74, 5463, 1977). Using these methods we have determined the sequence of a 410 base pair fragment which includes the yeast SUP3 tyrosine tRNA gene.     

Endonuclease A degrades chromosomal and plasmid DNA of Escherichia coli present in most preparations of single stranded DNA from phagemids.

With E. coli, large and variable amounts of chromosomal and plasmid DNAs are observed in the supernatants of overnight cultures when the cells carry an endA mutation, but are not detected by gel electrophoresis when the cells carry the wild type allele of endA. Significant amounts of nuclease activity in DH11S endA+ supernatants were detected by two simple assays; the rapid degradation of added pBR322 plasmid DNA, as judged by agarose gel electrophoresis, and a decrease of more than 100000 fold in transformation efficiency of the added pBR322 plasmid DNA. By employing isogenic endA mutant and wild type strains of DH11S and DH10B/F' proAB+ laclq Z delta M15, it was shown that detectable levels of chromosomal and plasmid DNAs are observed only in the endA mutant strains. These results indicate that Endonuclease I activity is responsible for degradation of chromosomal and plasmid DNA usually present in preparations of ssDNA. Therefore, a wild type endA gene is useful for the rapid and simple production of highly purified ssDNA from cells containing phagemid vectors.