Nucleotide sequence of an arginine transfer ribonucleic acid from bacteriophage T4.

The nucleotide sequence of a phage T4-coded low molecular weight RNA, previously designated polyacrylamide gel band epsilon, has been determined. This RNA can be arranged in the cloverleaf configuration common to tRNAs, with an anticodon sequence, U-C-U, which corresponds to the arginine-specific codons A-G-A and A-G-G; it is therefore assumed to be an arginine tRNA. The complete nucleotide sequence of this RNA species is: pG-U-C-C-C-G-C-U-G-G-U-G-U-A-A-U-Gm2'-G-A-D-A-G-C-A-U-A-C-G-A-U-C-C-U-U-C-U-A-A-G-psi-U-U-G-C-G-G-U-C-C-U-G-G-T-psi-C-G-A-U-C-C-C-A-G-G-G-C-G-G-G-A-U-A-C-C-AOH. The nucleotide sequence was determined by analysis of RNA, uniformly labeled in vivo, according to the conventional techniques. In addition, RNA synthesized in vitro in the presence of alpha-32P-labeled nucleoside triphosphates was analyzed through the use of nearest neighbor sequencing techniques. Although a unique sequence could not be determined by this latter analysis, restrictions on the sequence imposed by nearest neighbor data and secondary structure common to tRNA molecules allowed prediction of the correct nucleotide sequence.     

Primary and secondary structure of 7-3 (K) RNA of Novikoff hepatoma

7-3 RNA (also known as K-RNA and 7SK-RNA) is a distinct small RNA found in insect to mammalian cells. Previous studies showed that this RNA is not capped, contains no modified nucleotides, is conserved through evolution, is synthesized by RNA polymerase III, and, in part, is associated by polyribosomes. In this study, the complete nucleotide sequence of 7-3 RNA was determined by RNA-sequencing methods, and the sequence is compared with several small RNAs and repetitive DNA sequences for homology. This 330-nucleotide-long RNA contained pppGp as its 5' terminus and exhibited heterogeneity with respect to the 3'-terminal AoH. The nucleotide sequence is: (sequence in text) The RNA is G-C rich, and evidence is presented that 7-3 RNA is in a ribonucleoprotein particle in the cytoplasm.     

Primary structure and gene organization of the middle-component RNA of cowpea mosaic virus

Middle component RNA (M RNA) of cowpea mosaic virus (CPMV) was transcribed into cDNA and double-stranded cDNA was inserted into the EcoRI site of plasmid pBRH2. The nucleotide sequence of inserts was determined, after subcloning in bacteriophages M13mp7, M13mp8 or M13mp9, by the dideoxy chain termination method. The complete sequence of CPMV M RNA, up to the poly(A) tail, is 3481 nucleotides long. The sequence contains a long open reading frame starting at nucleotide 161 from the 5' terminus and continuing to 180 nucleotides from the 3' terminus. The sequence does not contain a polyadenylation signal for the poly(A) tail at the 3' end of CPMV RNA. The initiation site at position 161 together with AUG codons in the same reading frame at positions 512 and/or 524 account for the two large colinear precursor polypeptides translated in vitro from M RNA. The amino acid sequence deduced from the nucleotide sequence suggests that both precursor polypeptides are proteolytically cleaved at glutaminyl-methionine and glutaminyl-glycine, respectively, to produce the two viral capsid proteins.     

The nucleotide sequence of nuclear 4.8S RNA of mouse cells

The nucleotide sequence of nuclear 4.8S RNA has been determined. The 4.8S RNA consists of 108 nucleotide residues with one mole each of m²G, m⁶A and Gm, 3 moles each of ψ and Am and 4 moles of Cm as modified nucleosides. This RNA has pppG as the 5′-terminal nucleotide and contains a sequence complementary to some of the splice junctions of mRNA precursors.     

The genome of Bacillus subtilis phage SPP1: structure of an early promoter

The strongest of five 'early' promoters of Bacillus subtilis phage SPP1 was localized in a DNA restriction fragment by analysis of RNA polymerase binding and R-loop formation. The nucleotide sequence of the promoter region was established. The signal structures identified were similar to those recognized by the sigma 55 RNA polymerase of B. subtilis. The promoter precedes an open reading frame with 51 codons. A protein with the Mr predicted from the nucleotide sequence was identified in minicells.     

The nucleotide sequence of the chloroplast 5S ribosomal RNA from spinach.

Spinacia oleracia cholorplast 5S ribosomal RNA was end-labeled with [32P] and the complete nucleotide sequence was determined. The sequence is: pUAUUCUGGUGUCCUAGGCGUAGAGGAACCACACCAAUCCAUCCCGAACUUGGUGGUUAAACUCUACUGCGGUGACGAU ACUGUAGGGGAGGUCCUGCGGAAAAAUAGCUCGACGCCAGGAUGOH. This sequence can be fitted to the secondary structural model proposed for prokaryotic 5S ribosomal RNAs by Fox and Woese (1). However, the lengths of several single- and double-stranded regions differ from those common to prokaryotes. The spinach chloroplast 5S ribosomal RNA is homologous to the 5S ribosomal RNA of Lemna chloroplasts with the exception that the spinach RNA is longer by one nucleotide at the 3' end and has a purine base substitution at position 119. The sequence of spinach chloroplast 5S RNA is identical to the chloroplast 5S ribosomal RNA gene of tobacco. Thus the structures of the chloroplast 5S ribosomal RNAs from some of the higher plants appear to be almost totally conserved. This does not appear to be the case for the higher plant cytoplasmic 5S ribosomal RNAs.     

The nucleotide sequence of threonine transfer RNA coded by bacteriophage T4.

The nucleotide sequence of a low molecular weight RNA coded by bacteriophage T4 (and previously identified as species alpha) has been determined. The molecule is of particular biological interest for its associated biosynthetic properties. This RNA is 76 nucleotides in length, contains eight modified bases, and can be arranged in a cloverleaf configuration common to tRNAs. The anticodon sequence is UGU, which corresponds to the threonine-specific codons ACA G. The nucleotide sequence was determined primarily by nearest-neighbor analysis of RNA synthesized in vitro using [alpha-32P]nucleoside triphosphates. Using the single-strand specific nuclease S1, two in vivo labeled half-molecules were generated and analysed. This information together with restrictions imposed by nearest-neighbor data, provided a unique linear sequence of nucleotides with the features of secondary structure common to tRNA molecules.     

The nucleotide sequence of phenylalanine tRNA and 5S RNA from Rhodospirillum rubrum

The complete nucleotide sequence of tRNAPhe and 5S RNA from the photosynthetic bacterium Rhodospirillum rubrum has been elucidated. A combination of in vitro and in vivo labelling techniques was used. The tRNAPhe sequence is 76 nucleotides long, 7 of which are modified. The primary structure is typically prokaryotic and is most similar to the tRNAPhe of Escherichia coli and Anacystis nidulans (14 differences of 76 positions). The 5S ribosomal RNA sequence is 120 nucleotides long and again typical of other prokaryotic 5S RNAs. The invariable GAAC sequence is found starting at position 45. When aligned with other prokaryotic 5S RNA sequences, a surprising amount of nucleotide substitution is noted in the prokaryotic loop region of the R. rubrum 5S RNA. However, nucleotide complementarity is maintained reinforcing the hypothesis that this loop is an important aspect of prokaryotic 5S RNA secondary structure. The 5S and tRNAPhe are the first complete RNA sequences available from the photosynthetic bacteria.     

Homologous RNA recombination in brome mosaic virus: AU-rich sequences decrease the accuracy of crossovers.

Brome mosaic virus, a tripartite positive-stranded RNA virus of plants, was used for the determination of sequence requirements of imprecise (aberrant) homologous recombination. A 23-nucleotide (nt) region that included a 6-nt UUAAAA sequence (designated the AU sequence) common between wild-type RNA2 and mutant RNA3 supported both precise and imprecise homologous recombination, though the latter occurred with lower frequency. Doubling the length of the 6-nt AU sequence in RNA3 increased the incidence of imprecise crossovers by nearly threefold. Duplication or triplication of the length of the AU sequence in both RNA2 and RNA3 further raised the frequency of imprecise crossovers. The majority of imprecise crosses were located within or close to the extended AU sequence. Imprecise recombinants contained either nucleotide substitutions, nontemplated nucleotides, small deletions, or small sequence duplications within the region of crossovers. Deletion of the AU sequence from the homologous region in RNA3 resulted in the accumulation of only precise homologous recombinants. Our results provide experimental evidence that AU sequences can facilitate the formation of imprecise homologous recombinants. The generation of small additions or deletions can be explained by a misannealing mechanism within the AU sequences, while replicase errors during RNA copying might explain the occurrence of nucleotide substitutions or nontemplated nucleotides.     

The nucleotide sequence of the 5S RNA of chicken embryo fibroblasts.

The nucleotide sequence of uniformly 32P-labelled chicken 5S RNA has been determined by analysing the end-products of T1 and pancreatic ribonuclease digestion. These oligonucleotides can be aligned by homology with the human sequence to give a sequence differing in only seven positions from that of Man. The sequence deduced here differs in two position from that previously published for chicken 5S RNA.     

Isolation from tobacco mosaic virus-infected tobacco of a solubilized template-specific RNA-dependent RNA polymerase containing a 126K/183K protein heterodimer

The complete nucleotide sequence was determined for the putative RNA polymerase (183K protein) gene of tobacco mosaic virus (TMV) OM strain, which differed from the related strain, vulgare, by 51 positions in its nucleotide sequence and 6 residues in its amino acid sequence. Three segments of this 183K protein, each containing the sequence motif of methyltransferase (M), helicase (H), or RNA-dependent RNA polymerase (P), were expressed in Escherichia coli as fusion proteins with hexahistidine tags, and domain-specific antibodies were raised against purified His-tagged M and P polypeptides. By immunoaffinity purification, a template-specific RNA-dependent RNA polymerase containing a heterodimer of the full-length 183K and 126K (an amino-terminal-proximal portion of the 183K protein) viral proteins was isolated. We propose that the TMV RNA polymerase for minus-strand RNA synthesis is composed of one molecule each of the 183- and 126-kDa proteins, possibly together with two or more host proteins.     

Messenger RNA orientation on the ribosome. Placement by electron microscopy of antibody-complementary oligodeoxynucleotide complexes

Messenger RNA orients on the small ribosomal subunit by base pairing with a complementary sequence in ribosomal RNA. We have positioned this ribosomal RNA segment and thus oriented the mRNA using a new technique--localization of an antibody-recognizable modified complementary oligodeoxynucleotide by electron microscopy. A synthetic oligodeoxynucleotide complementary to the message-positioning ribosomal RNA sequence was modified at either or both ends with different antigenic markers. Electron microscopy of subunit-oligodeoxynucleotide-antibody complexes allowed separate placement of each terminal marker of the oligodeoxynucleotide probe. The 5'-end of the complementary sequence contacts the subunit at the platform tip (rRNA nucleotide 1542). The message then extends along the interior side of the platform to the level of the fork of the cleft separating the platform from the subunit body, and displaced slightly to the convex side of the platform (rRNA nucleotide 1531). Based on our results and data from other laboratories, we propose a model for the positioning of messenger RNA on the 30 S subunit.     

Molecular cloning and the complete nucleotide sequence of the creatine kinase-M cDNA from chicken.

The nucleotide sequence of creatine kinase-M (CK-M) cDNA clones has been determined. It includes the entire coding region of 381 amino acids in addition to 5' and 3' untranslated regions. A comparison with a partial sequence from rat CK-M reveals 84% nucleotide sequence homology in the coding region but divergence in the 3' untranslated region. The amino acid sequence is 94% conserved between chicken and rat. Hybridization to RNA immobilized on filters indicates homology between the CK-M 3' untranslated region and additional muscle specific RNA species. The coding region hybridizes only to CK-M RNA.     

New RNA-mediated reactions by yeast mitochondrial group I introns.

The group I self-splicing reaction is initiated by attack of a guanosine nucleotide at the 5' splice site of intron-containing precursor RNA. When precursor RNA containing a yeast mitochondrial group I intron is incubated in vitro under conditions of self-splicing, guanosine nucleotide attack can also occur at other positions: (i) the 3' splice site, resulting in formation of a 3' exon carrying an extra added guanosine nucleotide at its 5' end; (ii) the first phosphodiester bond in precursor RNA synthesized from the SP6 bacteriophage promoter, leading to substitution of the first 5'-guanosine by a guanosine nucleotide from the reaction mixture; (iii) the first phosphodiester bond in already excised intron RNA, resulting in exchange of the 5' terminal guanosine nucleotide for a guanosine nucleotide from the reaction mixture. An identical sequence motif (5'-GAA-3') occurs at the 3' splice site, the 5' end of SP6 precursor RNA and at the 5' end of excised intron RNA. We propose that the aberrant reactions can be explained by base-pairing of the GAA sequence to the Internal Guide Sequence. We suggest that these reactions are mediated by the same catalytic centre of the intron RNA that governs the normal splicing reactions.