Cloning and expression of a cDNA for human cytochrome P-450aldo as related to primary aldosteronism

A cDNA clone encoding human aldosterone synthase cytochrome P-450 (P-450aldo) has been isolated from a cDNA library derived from human adrenal tumor of a patient suffering from primary aldosteronism. The insert of the clone contains an open reading frame encoding a protein of 503 amino acid residues together with a 3 bp 5'-untranslated region and a 1424 bp 3'-untranslated region to which a poly(A) tract is attached. The nucleotide sequence of P-450aldo cDNA is 93% identical to that of P-450(11) beta cDNA. Catalytic functions of these two P-450s expressed in COS-7 cells are very similar in that both enzymes catalyze the formation of corticosterone and 18-hydroxy-11-deoxycorticosterone using 11-deoxycorticosterone as a substrate. However, they are distinctly different from each other in that P-450aldo preferentially catalyzes the conversion of 11-deoxycorticosterone to aldosterone via corticosterone and 18-hydroxycorticosterone while P-450(11)beta substantially fails to catalyze the reaction to form aldosterone. These results suggest that P-450aldo is a variant of P-450(11)beta, but this enzyme is a different gene product possibly playing a major role in the synthesis of aldosterone at least in a patient suffering from primary aldosteronism.     

Novel cAMP regulatory elements in the promoter region of bovine P-450(11 beta) gene

In order to elucidate the cAMP regulatory elements in the promoter region of bovine P-450(11 beta) genes, we analyzed the promoter region using chloramphenicol acetyltransferase (CAT) gene as the reporter. Various deletion plasmids were constructed using the promoter region of CB11 beta-7, which is one of the two normal genes. Examination of the effects of Bt2cAMP on the CAT activities of mouse adrenal tumor cells (Y-1 cells) transfected with these deletion plasmids suggested that two elements named Ad3 and Ad4 play major roles in the induction by cAMP. Ad3(AAGATAAGGCACCCATCCATCTT) is located at -306 bp to -284 bp and Ad4 (CCAAGGTC) is located at -331 bp to -324 bp in the promoter region of the P-450(11 beta) gene. Deletions of both Ad3 and Ad4 resulted in a large decrease of the induction ratio from 9- to 3-fold. Coexistence of Ad3 and Ad4 is essential for their function, because any mutations introduced into either one of them resulted in a decrease of the cAMP induction ratio. These two elements are highly conserved among bovine, mouse, and human P-450(11 beta) genes and have no similarity with known cAMP regulatory elements. DNase I footprint analysis indicated that factors which specifically bind to the two elements exist in the nuclear extract of bovine adrenal cortex cells. Ad3 and Ad4 showed different patterns in gel shift analysis using probes which contained Ad3 or Ad4 sequence, suggesting their interaction with different nuclear factors. We also found two other protected regions by DNase I footprint analysis of the promoter regions of P-450(11 beta) gene, and named them Ad5 and Ad6.(ABSTRACT TRUNCATED AT 250 WORDS)     

Cloning and sequencing of cDNA for the rat plasminogen activator inhibitor-1

A cDNA encoding rat plasminogen activator-inhibitor (PAI-1) has been isolated from an HTC rat hepatoma cell cDNA library constructed in phage lambda gt10. The cDNA contains 118 bp of 5'-untranslated sequence, 1206 bp encoding a 402-amino acid (aa) protein and 1747 bp of 3'-untranslated sequence. The protein-coding sequence and the derived amino acid sequence share 82% and 81% identity, respectively, with human PAI-1 cDNA and protein. The rat cDNA encodes a preprotein with a 23-aa leader peptide and a predicted N-terminal serine for the mature protein. Three of four potential N-glycosylation acceptor sites as well as the active site of rat PAI-1 are identical to the human protein. The 3'-untranslated region contains a number of unusual regions, including 80 bp of tandemly repeated GpA dinucleotides, a 115-bp stretch which shares greater than 90% sequence identity with a region within the 3'-untranslated cDNA of human PAI-1, and two 70-bp stretches of highly T-rich sequence located close to the 3'-terminus of the cDNA.     

The nucleotide sequence of a full length cDNA clone encoding rat liver urate oxidase

Recently we reported the sequence of a cDNA clone (pUOX-1), isolated from a lambda gt11 cDNA library, which encoded for rat liver urate oxidase (EC 1.7.3.3), but this clone lacked the nucleotide sequences encoding the N-terminal region for this enzyme. Using the cDNA insert from the pUOX-1 clone as a probe, we have now isolated a full length cDNA clone, pUOX-2, from a lambda gt10 library by plaque hybridization. Nucleotide sequence analysis of the pUOX-2 clone showed that it has 1379 base pairs with an open reading frame coding for 303 amino acid residues corresponding to a molecular mass of 34,931 daltons. In addition to the open reading frame the pUOX-2 contains 439 bp of 3'-untranslated and 41 bp of 5'-untranslated sequences. The consensus polyadenylation signal AATAAA precedes a stretch of poly(A)+ residues at the 3' end.     

Cloning of a complete cDNA encoding human aromatase: immunochemical identification and sequence analysis

A complete cDNA clone encoding a human aromatase was isolated from a human placental cDNA library in lambda gt11. An antibody to the polypeptide specified by the isolated clone was prepared, and Western blot analysis and antibody inhibition experiments of human placental aromatase activity confirmed the identification of the clone as aromatase cDNA. The isolated aromatase cDNA clone of 3030 bp with two unique EcoRI sites contained a 3'-noncoding region of 1397 bp, an open reading frame of 1509 bp encoding 503 amino acid residues, and a 5'-noncoding region of 124 bp. Analysis of the amino acid sequence of aromatase and comparison of aromatase with other forms of cytochrome P-450 indicated that this enzyme is a unique form of the cytochrome P-450 superfamily.     

Structural analysis of multiple bovine P-450(11 beta) genes and their promoter activities

A bovine genomic library was constructed using a cosmid vector, pHC79, and bovine DNA partially digested by EcoRI. Bovine P-450(11 beta) cDNA, pcP-450(11 beta)-2 [Morohashi et al. (1987) J. Biochem. 102,559-568], was used as a probe for screening the genomic library. Ten clones carrying P-450(11 beta) genomic DNA were isolated from 8 x 10(4) colonies and classified into five groups (CB11 beta-1, CB11 beta-3, CB11 beta-7, CB11 beta-20, and CB11 beta-21) according to differences in the restriction endonuclease sites. Nucleotide sequences of amino acid coding regions of the five clones were determined by the dideoxy sequencing method using synthetic nucleotides corresponding to various parts of the cDNA as primers. The nucleotide sequences revealed that three clones, CB11 beta-1, CB11 beta-3, and CB11 beta-21, were pseudogenes. Amino acid sequences coded by the other two clones, CB11 beta-7 and CB11 beta-20, were identical with that coded by a previously described cDNA, pcP-450(11 beta)-3 [Kirita et al. (1988) J. Biochem. 104, 683-686]. The promoter regions of the five clones were introduced in front of chloramphenicol acetyltransferase (CAT) gene of pSV00CAT and used to examine P-450(11 beta) gene regulation in cultured cells. The five recombinant plasmids showed cAMP-responsive CAT activities in Y-1 cells, a cell strain derived from adrenal tumor. The induction rates of the recombinant plasmids carrying the promoters of normal genes, CB11 beta-7 and -20, were larger than those of pseudogenes, CB11 beta-1, -3, and -21. CAT activities expressed by the promoter regions of the normal genes in the presence or absence of cAMP in Y-1 cells were almost equal to that by the promoter region of human P-450(SCC) gene. Though the promoter of the P-450(SCC) gene also showed cAMP-responsive CAT activity in I-10 cells, a cell strain derived from Leyding cell tumor, P-450(11 beta) gene promoter did not express the activity in I-10 cells.     

Expression of CEA-related genes in the first trimester human placenta

Eight cDNA clones, closely related to the carcino-embryonic antigen gene family, have been isolated from a cDNA library representing genes expressed in the first trimester human placenta. Sequence analysis of one clone shows it to be a pregnancy-specific beta 1-glycoprotein (PS beta G) closely related to three other PS beta G cDNA recently characterised from a term placenta library. The protein encoded by the cDNA is predicted to be less high glycosylated than those reported previously and differs markedly in the C-terminal sequence. The 3' untranslated region of the cDNA is very similar to the equivalent region of beta 1-glycoprotein PS beta G E except that it contains the 12bp repeat sequence found flanking the Alu sequence in CEa and an additional 67bp of sequence that appears to be derived from CEA.     

Cloning, structure and expression of a cDNA encoding the human androgen receptor

A cDNA clone has been isolated from a library prepared of mRNA of human breast cancer T47D cells with an oligonucleotide probe homologous to part of the region encoding the DNA-binding domain of steroid receptors. The clone has a size of 1505 bp and sequence analysis revealed an open reading frame of 1356 bp. The deduced amino acid sequence displays two highly conserved regions identified as the putative DNA-binding and hormone binding domains respectively of steroid receptors. Expression of this cDNA clone in COS cells produces a nuclear protein with all the binding characteristics of the human androgen receptor (hAR). The gene encoding the cDNA is assigned to the human X-chromosome. High levels of three hybridizing mRNA species of 11, 8.5 and 4.7 kb respectively are found in the human prostate cancer cell line (LNCaP), which contains elevated levels of hAR. The present data provide evidence that we have isolated a cDNA that encodes a major part of the human androgen receptor.     

Cloning and analysis of cDNA clones for rat kidney alpha-spectrin

We have isolated a 3922-base pair (bp) cDNA clone for rat nonerythroid alpha-spectrin from a rat kidney lambda gt11 cDNA library. Sequence analysis revealed that this cDNA contains an open reading frame of 3090 bp encoding for the C-terminal 1030 amino acid sequence of rat kidney alpha-spectrin. The 3'-untranslated region (including a 38-bp poly(A+) tail) contains an 832-bp sequence. A single mRNA of about 8 kilobase pairs was detected in rat liver, kidney, brain, heart, intestine, lung, testis, stomach, spleen, and muscle with varying abundances, which is consistent with and further confirms the presence of spectrins in nonerythroid tissues as demonstrated previously by immunoblot analysis. Southern blot analysis suggested that there is a single gene for nonerythroid alpha-spectrin. The derived amino acid sequence contains sequence from the spectrin 106-residue internal repeat 12 to the C terminus of rat kidney alpha-spectrin. Sequence comparison with human and chicken nonerythroid alpha-spectrin showed that nonerythroid alpha-spectrin is well conserved during evolution. The rat kidney alpha-spectrin sequence, when compared to rat brain alpha-spectrin, contains an extra 76-amino-acid sequence at the C terminus. Sequence comparison of all the internal repeats available revealed that the internal repeat 3, 4, 5, 6, 7, and 8 has highest sequence similarity with internal repeat 12, 13, 14, 15, 16, and 17, respectively. Therefore, internal repeats 3-8 and 12-17 are most likely derived from an ancestral gene through gene duplication, suggesting that the spectrin gene is derived from a half-spectrin gene by gene duplication and divergence during evolution.     

Molecular cloning and nucleotide sequence of the cDNA for human liver glutamate dehydrogenase precursor

Two cDNA clones (lambda GDHh1 and lambda GDHn61) for glutamate dehydrogenase (GDH) were isolated from a human liver cDNA library in lambda gt11. The clone, lambda GDHh1, was isolated from the library using a synthetic 45mer oligodeoxy-ribonucleotide, the sequence of which was derived from the known amino acid sequence near the NH2-terminus of human liver GDH. Subsequently, lambda GDHn61 was isolated from the same library using lambda GDHh1 as a probe. The inserts of both clones contained an overlapping cDNA sequence for human liver GDH, consisting of a 5'-untranslated region of 70 bp, an open reading frame of 1677 bp, a 3'-untranslated region of 1262 bp and a 15 base poly(A) tract. The predicted amino acid sequence revealed that the human liver GDH precursor consisted of a total of 558 amino acid residues including the NH2-terminal presequence of 53 amino acids. The sequence deduced for the mature enzyme showed 94% homology to the previously reported amino acid sequence of human liver GDH.     

Isolation and sequence determination of cDNA clones for porcine and human lipoamide dehydrogenase. Homology to other disulfide oxidoreductases

A 2.3-kilobase cDNA clone encoding lipoamide dehydrogenase was isolated from a porcine adrenal medulla library in the vector pCD by screening with four synthetic oligonucleotide probes corresponding to amino acid sequence from tryptic peptides of porcine lipoamide dehydrogenase. A 450-bp fragment of the porcine cDNA was used to screen a human small cell lambda gt10 library at reduced stringency. Overlapping human cDNA clones of various lengths were isolated, the largest of which was again 2.3 kilobases in length. Sequencing of both porcine and human cDNAs revealed a short 5'-untranslated region followed by 1530-bp of coding region and 700 bp of 3'-untranslated region preceding a poly(A) tail. The porcine cDNA displayed coding regions corresponding to the known tryptic peptides and a 35-amino acid leader sequence involved in targeting of the protein to the mitochondria. The human lipoamide dehydrogenase cDNA is 96% identical to the porcine at the amino acid level. Alignment of the deduced amino acid sequence of human lipoamide dehydrogenase with human erythrocyte glutathione reductase and mercuric reductase from Tn501 revealed extensive homologies throughout the primary sequence, suggesting that secondary and tertiary structure is also similar among these three enzymes.     

Molecular cloning of LMO41, a new human LIM domain gene

We have identified a new human LIM domain gene by isolating an autoantigenic cDNA clone from a human breast tumor cDNA library. The predicted amino acid sequence of the cDNA clone's 495 bp open reading frame contains two tandem LIM domain motifs, and within the LIM domain region there is 62% identity with the analogous region of the LIM-only gene LMO1. The homology to LMO1 is restricted to the 360 bp region encoding the tandemly repeated LIM domains, the rest of the open reading frame as well as the extensive, GC-rich 5' untranslated region, and 3' region of the 2 kb cDNA sequence are unrelated to any known genes. This gene has been designated LMO4.     

Nucleotide sequence of a cDNA for the alpha subunit of human mitochondrial ATP synthase.

A full length cDNA clone of the alpha subunit of mitochondrial ATP synthase (EC 3.6.1.34) has been isolated from a cDNA library prepared from LX-1 human tumor cells in the lambda-Zap vector. The clone is 1883 base pairs (bp) in length and contains a 1659 bp open reading frame encoding a polypeptide of 553 residues. The deduced amino acid sequence is highly homologous to ATP synthase from several other species.     

Structural organization and chromosomal assignment of the gene encoding endothelin

Endothelin is a 21-amino acid vasoconstrictor synthesized and secreted by vascular endothelial cells. The human peptide is derived from a 212-amino acid precursor, preproendothelin. A nearly full length clone containing DNA complementary to human preproendothelin mRNA was isolated, and its nucleotide sequence was determined. Using this cDNA as a probe, the genomic organization of the human endothelin gene was determined and the promoter region delineated. The gene contains five exons and four intervening sequences. Nucleotide sequences encoding endothelin are contained within the second exon, and the third exon specifies a portion of preproendothelin that is homologous to endothelin. The second and third exons may represent descendants of a common progenitor exon. The 3'-untranslated portion of the gene contains a 250-base pair region that is highly conserved between human and porcine genomes and may have an important role in endothelin mRNA stability. On the basis of DNA isolated from human-mouse somatic hybrid cell lines, the endothelin gene was assigned to human chromosome 6.     

Human lysosomal acid phosphatase: cloning, expression and chromosomal assignment.

A 2112-bp cDNA clone (lambda CT29) encoding the entire sequence of the human lysosomal acid phosphatase (EC 3.1.3.2) was isolated from a lambda gt11 human placenta cDNA library. The cDNA hybridized with a 2.3-kb mRNA from human liver and HL-60 promyelocytes. The gene for lysosomal acid phosphatase was localized to human chromosome 11. The cDNA includes a 12-bp 5' non-coding region, an open reading frame of 1269 bp and an 831-bp 3' non-coding region with a putative polyadenylation signal 25 bp upstream of a 3' poly(A) tract. The deduced amino acid sequence reveals a putative signal sequence of 30 amino acids followed by a sequence of 393 amino acids that contains eight potential glycosylation sites and a hydrophobic region, which could function as a transmembrane domain. A 60% homology between the known 23 N-terminal amino acid residues of human prostatic acid phosphatase and the N-terminal sequence of lysosomal acid phosphatase suggests an evolutionary link between these two phosphatases. Insertion of the cDNA into the expression vector pSVL yielded a construct that encoded enzymatically active acid phosphatase in transfected monkey COS cells.