共查询到20条相似文献,搜索用时 15 毫秒
1.
Molecular morphologies and conformation transition of lentinan, a beta-(1-->3)-D-glucan from Lentinus edodes, were studied in aqueous NaOH solution by atomic force microscopy (AFM), viscometry, multiangle laser light scattering, and optical rotation measurements. The results revealed that lentinan exists as triple-helical chains and as single random-coil chains at NaOH concentration lower than 0.05M and higher than 0.08M, respectively. Moreover, the dramatic changes in weight-average molecular weight Mw, radius of gyration [s2](1/2), intrinsic viscosity [eta], as well as specific optical rotation at 589 nm [alpha]589 occurred in a narrow range of NaOH concentration between 0.05 and 0.08M NaOH, indicating that the helix-coil conformation transition of lentinan was carried out more easily than that of native schizophyllan and scleroglucan, and was irreversible. For the first time, we confirmed that the denatured lentinan molecule, which was dissolved in 0.15M NaOH to be disrupted into single coil chains, could be renatured as triple helical chain by dialyzing against abundant water in the regenerated cellulose tube at ambient temperature (15 degrees C). In view of the AFM image, lentinan in aqueous solution exhibited the linear, circular, and branched species of triple helix compared with native linear schizophyllan or scleroglucan. 相似文献
2.
A collagen-like peptide with the sequence (GER)(15) GPCCG was synthesized to study the formation of a triple helix in the absence of proline residues. This peptide can form a triple helix at acidic and basic pH, but is insoluble around neutral pH. The formation of a triple helix can be used to covalently oxidize the cysteine residues into a disulfide knot. Three disulfide bonds are formed between the three chains as has been found at the carboxyl-terminal end of the type III collagen triple helix. This is a new method to covalently link collagen-like peptides with a stereochemistry that occurs in nature. The peptide undergoes a reversible, cooperative triple helix coil transition with a transition midpoint (T(m)) of 17 to 20 degrees C at acidic pH and 32 to 37 degrees C at basic pH. At acidic pH there was little influence of the T(m) on the salt concentration of the buffer. At basic pH increasing the salt concentration reduced the T(m) to values comparable to the stability at acidic pH. These experiments show that the tripeptide unit GER which occurs frequently in collagen sequences can form a triple helical structure in the absence of more typical collagen-like tripeptide units and that charge-charge interactions play a role in the stabilization of the triple helix of this peptide. 相似文献
3.
Schizophyllan exists in aqueous solution as a triple helix, which is intact at room temperature. Its aqueous solution forms some ordered structure at low temperatures but undergoes a sharp transition to a disordered structure as the temperature is raised. The transition temperature Tc is about 7 and 18°C for H2O and D2O solutions, respectively. This transition was followed by time-domain reflectometry to investigate dynamic aspects of the transition. In addition to a major peak around 10 GHz, the dielectric dispersion curve of a 20 wt % schizophyllan in D2O exhibited a small peak around 100 MHz below Tc and around 10 MHz above Tc. The major peak is due to bulk water, whereas the 100 MHz peak is assigned to “bound” or “structured” water, and that around 10 MHz to side-chain glucose residues. However, unlike usual bound water reported for biopolymer solutions, this “structured” water disappears abruptly when the temperature becomes close to Tc without accompanying a conformational transition of the main chain. The above assignment is consistent with the structure of the ordered phase derived from previous static data that it consists of side-chain glucose residues along with nearby water molecules surrounding the helix core that are interacting with each other loosely through hydrogen bonds, and spreads radially only a layer of one or two water molecules but a long distance along the helix axis. © 1995 John Wiley & Sons, Inc. 相似文献
4.
Triple helix formation by oligopurine-oligopyrimidine DNA fragments. Electrophoretic and thermodynamic behavior 总被引:19,自引:0,他引:19
G Manzini L E Xodo D Gasparotto F Quadrifoglio G A van der Marel J H van Boom 《Journal of molecular biology》1990,213(4):833-843
The 26mer oligodeoxynucleotide d(GAAGGAGGAGATTTTTCTCCTCCTTC) adopts in solution a unimolecular hairpin structure (h), with an oligopurine-oligopyrimidine (Pu-Py) stem. When h is mixed with d(CTTCCTCCTCT) (s1) the two strands co-migrate in polyacrylamide gel electrophoresis at pH 5. If s1 is substituted with d(TCTCCTCCTTC) (s2), such behavior is not observed and the two strands migrate separately. This supports the suggestion of the formation of a triple-stranded structure by h and s1 (h:s1) but not by h and s2, and confirms the strand polarity requirement of the third pyrimidine strand, which is necessary for this type of structure. The formation of a triple helix by h:s1 is supported by electrophoretic mobility data (Ferguson plot) and by enzymatic assay with DNase I. Circular dichroism measurements show that, upon triple helix formation, there are two negative ellipticities: a weaker one (delta epsilon = 80 M-1 cm-1) at 242 nm and a stronger one (delta epsilon = 210 M-1 cm-1) at 212 nm. The latter has been observed also in triple-stranded polynucleotides, and can be considered as the trademark for a Py:Pu:Py DNA triplex. Comparison of ultraviolet absorption at 270 nm and temperature measurements shows that the triple-stranded structure melts with a biphasic profile. The lower temperature transition is bimolecular and is attributable to the breakdown of the triplex to give h and s1, while the higher temperature transition is monomolecular and is due to the transition of hairpin to coil structure. The duplex-to-triplex transition is co-operative, fully reversible and with a hyperchromism of about 10%. The analysis of the melting curves, with a three-state model, allows estimation of the thermodynamic parameters of triple helix formation. We found that the duplex-to-triplex transition of h: s1 is accompanied by an average change in enthalpy (less the protonation contribution) of -73(+/- 5) kcal/mol of triplex, which corresponds to -6.6(+/- 0.4) kcal/mol of binding pyrimidine, attributable to stacking and hydrogen bonding interactions. 相似文献
5.
Shimizu A Kawai K Yanagino M Wakiyama T Machida M Kameyama K Naito Z 《Journal of biochemistry》2007,142(1):33-40
The overall structure of type IV collagen is the same at neutral and acidic pH, as determined by circular dichroism spectra. The heating rate dependence of denaturation midpoint temperature (T(m)) shows that type IV collagen is unstable at body temperature, similarly to type I collagen. The heating rate dependence of T(m) at neutral pH has two phases, but that at acidic pH apparently has a single phase. The T(m) of the first phase (lower T(m)) at neutral pH is consistent with that at acidic pH, and the activation energy of these phases is consistent, within experimental error. The triple helix region of type IV collagen corresponding to the second phase (higher T(m)) at neutral pH is thermally stable when compared to the triple helical structure at acidic pH. At acidic pH, as the loosely packed and unstable region has spread throughout the whole molecule, the thermal transition is thought to be cooperative and is observed as a single phase. Structural flexibility is related to protein function and assembly; therefore, the unstable structure and increased flexibility of type IV collagen induced at acidic pH may affect diseases accompanied by type IV collagen disorder. 相似文献
6.
Triple helical polysaccharide-induced good dispersion of silver nanoparticles in water 总被引:1,自引:0,他引:1
Silver nanoparticles were constructed by using triple helical polysaccharide (lentinan) dissolved in water as matrix for the first time. The structure, morphology, and size of the nanocomposites in the polysaccharide aqueous solutions were investigated with UV-visible spectroscopy (UV-vis), transmission electron microscopy (TEM), and dynamic laser light scattering (DLS). The results revealed that the silver nanoparticles were attached to the polysaccharide chains through the strong noncovalent interactions, leading to the good dispersion of silver nanoparticles with mean radius of 6 nm in water. The silver nanoparticles were stable in the lentinan aqueous solution for 9 months. However, with an addition of NaOH, the polysaccharide with the imperfect helical structure broken partially by NaOH could aggregate in the alkali aqueous solution. The aggregation of the lentinan-bonded silver nanoparticles increased with an increase in the NaOH concentration, whereas the size of the silver nanoparticles barely changed, further confirming that the Ag nanoparticles were stable in this system. The aggregation was related to the conformation transition of the polysaccharide from the triple helix to random coil in the solution. A new method to detect the aggregates and aggregation rate was established according to the intensity of the maximum absorption peaks of the polysaccharide labeled by Ag nanoparticles in the UV spectrum. 相似文献
7.
Leandro G. Nandi João P.T.A. GuerraIsmael C. Bellettini Vanderlei G. MachadoEdson Minatti 《Carbohydrate polymers》2013
Morphological and conformational transitions of lentinan (LT), a β-glucan extracted from Shiitake mushrooms (Lentinula edodes), were investigated at different concentrations of aqueous NaOH, using Small Angle X-ray Scattering (SAXS) technique. At low NaOH(aq) concentration LT chains are self-associated and adopt the triple helix form where as at higher NaOH concentrations the polymer chains undergo a transition to random coil chains. Also, the presence of fractal dimensions was observed through analysis of the exponential decay of the scattering intensity as a function of the scattering angle. In addition, the lateral radius of gyration was determined for LT in different concentrations of NaOH solution, indicating a rigid triple helix present as a small rod-like structure. Interactions of LT with two zwitterionic surfactants were investigated by surface tension, fluorescence, and static light scattering measurements. Experimental data showed that the formation of LT–(surfactant) complexes occurred through a cooperative process. 相似文献
8.
The hexanucleoside pentaphosphate d(m5CpGpm5CpGpm5CpG) has been studied in solution by ultra-violet absorption, circular dichroism and 31P nuclear magnetic resonance under various experimental conditions. In 0.2 M NaClO4 at low temperature, an hexamer duplex is formed which has a B or B-like conformation. As the salt concentration is increased, a transition from a B-form to the Z-form occurs and is complete in 3 M NaClO4. In 3 M NaClO4, the behavior of the Z double helix is complex as a function of temperature. The variation of the circular dichroism at 295 nm is biphasic. A first transition occurs over a large range of temperature and corresponds to a conformational change due to a non-cooperative intramolecular process. Ultra-violet absorption and 31P nuclear magnetic resonance show that the new conformation arising from a distortion of the backbone is not similar to that observed in low salt conditions (B-form). At high hexanucleotide concentration, aggregates are formed. The second transition is cooperative and corresponds to the melting of a double stranded helix into single strands. 相似文献
9.
The dependence of denaturation transition thermodynamic parameters in various collagens from imino acid compositions has been analysed. Computational and experimental data suggest independence of the collagen molecule hydration on imino acid composition and sequence in the polypeptide chain. The continuous net of hydrogen bonds is interrupted, if imino acid residues occur in the sequence of amino acid residues, as follows from Monte Carlo computations, because the hydrogen of NH-group plays sufficient role in water shell formation for this conformation. As a consequence, entropy of denatured collagen-water system increases hand by hand with increasing imino acid content and therefore delta S increases. The increase of enthalpy of transition from imino acid content is determined by favorable Van der Waals interactions of pyrrolidine rings in native triple helical collagen structure. It was pointed out that proline role is determined by decreasing hydration in the single stranded polypeptide chain in Polyproline II conformation that leads to an increase of entropy of the polypeptide-water system. Thus, the collagen structure formation by imino acids is promoted in the water media due to single chain left-helical conformation being unfavorable for proline residues as well as due to the enthalpy nature of the triple helix stabilization. 相似文献
10.
R J Wenstrup A W Shrago-Howe L W Lever C L Phillips P H Byers D H Cohn 《The Journal of biological chemistry》1991,266(4):2590-2594
Affected individuals from two apparently distinct, mild osteogenesis imperfecta families were heterozygous for a G to T transition in the COL1A2 gene that resulted in cysteine for glycine substitutions at position 646 in the alpha 2(I) chain of type I collagen. A child with a moderately severe form of osteogenesis imperfecta was heterozygous for a G to T transition that resulted in a substitution of cysteine for glycine at position 259 in the COL1A2 gene. Type I collagen molecules containing an alpha 2(I) chain with cysteine at position 259 denaturated at a lower temperature than molecules containing an alpha 2(I) chain with cysteine at position 646. In contrast to cysteine for glycine substitutions in the alpha 1(I) chain, the severity of the osteogenesis imperfecta phenotype is not directly proportional to the distance of the mutation from the amino-terminal end of the triple helix. These findings could be explained if the type I collagen triple helix contains discontinuous domains that differ in their contributions to maintaining helix stability. 相似文献
11.
Lacroix L Arimondo PB Takasugi M Hélène C Mergny JL 《Biochemical and biophysical research communications》2000,270(2):363-369
Oligonucleotides can be used as sequence-specific DNA ligands by forming a local triple helix. In order to form more stable triple-helical structures or prevent their degradation in cells, oligonucleotide analogues that are modified at either the backbone or base level are routinely used. Morpholino oligonucleotides appeared recently as a promising modification for antisense applications. We report here a study that indicates the possibility of a triple helix formation with a morpholino pyrimidine TFO and its comparison with a phosphodiester and a phosphoramidate oligonucleotide. At a neutral pH and in the presence of a high magnesium ion concentration (10 mM), the phosphoramidate oligomer forms the most stable triple helix, whereas in the absence of magnesium ion but at a physiological monovalent cation concentration (0.14 M) only morpholino oligonucleotides form a stable triplex. To our knowledge, this is the first report of a stable triple helix in the pyrimidine motif formed by a noncharged oligonucleotide third strand (the morpholino oligonucleotide) and a DNA duplex. We show here that the structure formed with the morpholino oligomer is a bona fide triple helix and it is destabilized by high concentrations of potassium ions or divalent cations (Mg(2+)). 相似文献
12.
13.
Persikov AV Xu Y Brodsky B 《Protein science : a publication of the Protein Society》2004,13(4):893-902
The folding of collagen in vitro is very slow and presents difficulties in reaching equilibrium, a feature that may have implications for in vivo collagen function. Peptides serve as good model systems for examining equilibrium thermal transitions in the collagen triple helix. Investigations were carried out to ascertain whether a range of synthetic triple-helical peptides of varying sequences can reach equilibrium, and whether the triple helix to unfolded monomer transition approximates a two-state model. The thermal transitions for all peptides studied are fully reversible given sufficient time. Isothermal experiments were carried out to obtain relaxation times at different temperatures. The slowest relaxation times, on the order of 10-15 h, were observed at the beginning of transitions, and were shown to result from self-association limited by the low concentration of free monomers, rather than cis-trans isomerization. Although the fit of the CD equilibrium transition curves and the concentration dependence of T(m) values support a two-state model, the more rigorous comparison of the calorimetric enthalpy to the van't Hoff enthalpy indicates the two-state approximation is not ideal. Previous reports of melting curves of triple-helical host-guest peptides are shown to be a two-state kinetic transition, rather than an equilibrium transition. 相似文献
14.
beta-1,3-D-glucans have been isolated from fungi as right-handed 6(1) triple helices. They are categorized by the side chains bound to the main triple helix through beta-(1-->6)-D-glycosyl linkage. Indeed, since a glucose-based side chain is water soluble, the presence and frequency of glucose-based side chains give rise to significant variation in the physical properties of the glucan family. Curdlan has no side chains and self-assembles to form an water-insoluble triple helical structure, while schizophyllan, which has a 1,6-D-glucose side chain on every third glucose unit along the main chain, is completely water soluble. A thermal fluctuation in the optical rotatory dispersion is observed for the side chain, indicating probable co-operative interaction between the side chains and water molecules. This paper documents molecular dynamics simulations in aqueous solution for three models of the beta-1,3-D-glucan series: curdlan (no side chain), schizophyllan (a beta-(1-->6)-D-glycosyl side-chain at every third position), and a hypothetical triple helix with a side chain at every sixth main-chain glucose unit. A decrease was observed in the helical pitch as the population of the side chain increased. Two types of hydrogen bonding via water molecules, the side chain/main chain and the side chain/side chain hydrogen bonding, play an important role in determination of the triple helix conformation. The formation of a one-dimensional cavity of diameter about 3.5 A was observed in the schizophyllan triple helix, while curdlan showed no such cavity. The side chain/side chain hydrogen bonding in schizophyllan and the hypothetical beta-1,3-D-glucan triple helix could cause the tilt of the main-chain glucose residues to the helix. 相似文献
15.
The oscillatory rheology of one rodlike and one semiflexible xanthan sample has been investigated as a function of temperature in the range of xanthan concentrations where the polymer forms a lyotropic liquid crystalline phase in aqueous NaCl solutions. Readily observed changes in the rheological observables at temperatures corresponding to phase boundaries permit construction of the biphasic chimney region of the temperature-composition phase diagram. The chimney region leans toward larger values of the polymer concentration with increasing temperature, presumably as a consequence of a reduction in the effective axial ratio of the helical polymer with increasing temperature. The results permit construction of plots of the rheological observables as a function of polymer concentration at temperatures T in the range 20 相似文献
16.
Dietmar Prschke 《Biopolymers》1971,10(10):1989-2013
The properties of oligonucleotide helices of adeuylic- and uridylic acid oligomers have been investigated by measurements of hypo-and hyperchromieity. High ionic strengths favor the formation of triple helices. Thus, the double helix-coil transition can be studied (without interference by triple helices) only at low ionic-strength. A “phase diagram” is given representing the Tm-values of the various transitions at different ionic strengths for the system A(pA)17 + U(pU)17. Oligonucleolides of chain lengths <8 always form both double and triple helices at the nucleotide concentrations required for base pairing. For this reason the double helix-coil transition without coupling of the triple helix equilibrium can only be measured for chain lengths higher than 7. Melting curves corresponding to this transition have been determined for chain lengths 8, 9, 10, 11, 14 and 18 at different concentrations. An increase in nucleotide concentration leads to an increase in melting temperature. The shorter the chain length the lower the Tm-value and the broader the helix-coil transition. The experimental transition curves have been analysed according to a staggering zipper model with consideration of the stacking of the adeuylic acid single strands and the electrostatic repulsion of tlip phosphate charges on opposite strands. The temperature dependence of the nucleation parameter has been accounted for by a slacking factor x. The stacking factor expresses the magnitude of the stacking enthalpy. By curve fitting xwas computed to be 0.7, corresponding to a stacking enthalpy of about S kcal/mole. The model described allows the reproduction of the experimental transition curves with relatively high accuracy. In an appendix the thermodynamic parameters of the stacking equilibrium of poly A and of the helix-coil equilibria of poly A + poly U at neutral pH are calculated (ΔHA = ?7.9 kcal/mole for the poly A stacking and ΔH12 = ?10.9 kcal/mole for the formation of the double helix from the randomly coiled single strands). A formula for the configurational entropy of polymers derived by Flory on the basis of a liquid lattice model is adapted to calculate the stacking entropies of adenylic oligomers. 相似文献
17.
Dielectric studies have been carried out for the helix–coil transition of poly-β-benzyl-L -aspartate with m-cresol as a solvent. The transition of the solute molecules has been sharply reflected as a characteristic change in the dielectric dispersion curves in changing temperature. Two polarizations, one having a low and the other a high critical frequency, have appeared. According to theoretical considerations of a model of a broken helix, the former is found to come from the orientation. of helical sequences and the latter from the chemical relaxation due to the helix–coil transition. It also seems likely that the unfolded chain may have a polarizability which could not be neglected at the high-temperature side of the transition. 相似文献
18.
Shinichi Kitamura Takashi Hirano Kenichi Takeo Harumi Fukada Katsutada Takahashi Berit H. Falch Bjrn T. Stokke 《Biopolymers》1996,39(3):407-416
The conformational transitions of schizophyllan were studied in aqueous alkaline solutions by high-sensitivity differential scanning calorimetry (DSC) and optical rotation measurements. The temperature of half completion for reversible intramolecular conformational transition determined by DSC, centered at 7.4°C in water, increases to 37.2°C at 0.01M KOH with increasing alkaline concentration. The transition enthalpy per mole of the polysaccharide repeating unit is 2.62 ± 0.23 kJ mol−1 independent of the alkaline concentration. The cooperative unit size for the transition decreases with increasing alkaline concentration. Optical rotation was measured as a function of pH at 25 and 60°C. A sharp decrease in optical rotation was observed at pH = 13, which is ascribed to the triple helix-coil transition. From data obtained by DSC and optical rotation measurements, in combination with results reported previously, a phase diagram for the conformation of schizophyllan as a function of temperature and pH is proposed. The irreversibility of the triple helix to single coil transition, induced by strong alkali, was investigated as a function of polymer concentration by gel permeation chromatography and electron microscopy. The renatured samples at polymer concentrations < 1.0 mg/mL, which are prepared by dissolution in 0.25M KOH followed by neutralization with HCl, are observed as a mixture of globular, linear, and circular structures, and larger aggregates with less-defined morphology by electron microscopy. Higher concentrations lead to increased proportions of multichain clusters (aggregates). Subsequent annealing of the renatured samples at 115–120°C increases the proportion of circular species. The change in molecular weight distribution of samples that accompanies the renaturation and annealing mentioned above can be well interpreted in terms of the proportion of species having different morphology as observed by electron microscopy. © 1996 John Wiley & Sons, Inc. 相似文献
19.
The hysteresis observed in cyclic acid-base titrations of the three-standed polyribonucleotide helix poly (A)-2 POLY (U) strongly depends on ionic strength. For NaCl and at 25 degrees C, hysteresis occurs in the limited concentration range between 0.03 M and 1.0 M(NaCl). The transition points associated with the cyclic conversions between the triple helix and the poly (A)-poly (A) double helix and (free) poly (U) constitute a (pH ionic strength) phase diagram covering the ranges of stability and metastability of the hysteresis system. Variations with NaCl concentration of some hysteresis parameters can be quantitatively described in terms of polyelectrolyte theories based on the cylinder-cell model for rodlike polyions. The results of this analysis suggest that the metastability is predominantly due to dlectrostatic energy barriers preventing the equilibrium transition of the partially protonated triple helix above a critical pH value. Ultraviolet absorbance and potentiometric titration data of poly (A)in the acidic pH range can be analyzed in terms of two types of double-helical structures. Spectrophotometric titrations reveal isosbestic wavelengths for structural transitions of poly (A). "Time effects" commonly observed in poly (A) titrations are suggested to reflect helix transitions between the two acidic structures. 相似文献
20.
Kai T Uchiyama S Nishi Y Kobayashi Y Tomiyama T 《Journal of biomolecular structure & dynamics》2004,22(1):51-58
The collagen model peptide (Pro-Pro-Gly)10 is known to fold into a triple helix in solution. So far, the triple helix has been considered to exist as a single state. However, our previous study of (Pro-Pro-Gly)10 in solution has indicated the presence of two different states of the triple helix, a lower (HL) and a higher temperature state (HH). In the present study, these triple-helical states were investigated in more detail by NMR. Complete stereospecific assignments of the methylene protons of the proline residues were accomplished by the use of NOESY and TOCSY spectra. The temperature dependence of the 1H chemical shifts showed that the HL-to-HH thermal transition can be attributed to a conformational change of the first proline (Pro1) residues of the (Pro-Pro-Gly) triplets. Since TOCSY spectra with a 10 ms mixing-time confirmed a down puckering of these Pro residues in the HL state, but interconverting down and up puckerings in the HH state, the HL-to-HH thermal transition corresponds to conformational changes of the pyrrolidine rings of the Pro1 residues from an uniform down puckering to a more flexible state. The results confirm that thermal unfolding of the triple helix proceeds through the intermediate HH state. 相似文献