Prenatal diagnosis of 45,X/46,XX mosaicism and 45,X: implications for postnatal outcome.

The prognosis for 45,X/46,XX mosaicism diagnosed prenatally has yet to be established. We report our experience with 12 patients in whom prenatal diagnosis of 45,X/46,XX mosaicism was detected by amniocentesis for advanced maternal age or decreased maternal serum alpha-feto protein and compared them with 41 45,X/46,XX patients diagnosed postnatally. The girls in the prenatal group range in age from 3 mo to 10 years. All have had normal linear growth. Four had structural anomalies including: ASD (n = 1); ptosis and esotropia (n = 1); labial fusion (n = 1); and urogenital sinus, dysplastic kidneys, and hydrometrocolpos (n = 1). Gonadotropins were measured in seven; one had elevated luteinizing hormone/FSH at 3 mo of age. One has developmental delay and seizures as well as ophthalmologic abnormalities. None would have warranted karyotyping for clinical suspicion of Turner syndrome. The prevalence of 45,X/46,XX mosaicism is 10-fold higher among amniocenteses than in series of postnatally diagnosed individuals with Turner syndrome, which suggests that most individuals with this karyotype escape detection and that an ascertainment bias exists toward those with clinically evident abnormalities. The phenomenon of a milder phenotype for the prenatal group is similar to that observed for 45,X/46,XY diagnosed prenatally. Prenatal counseling for 45,X/46,XX in the absence of such ultrasound abnormalities as hydrops fetalis should take into account the expectation of a milder phenotype (except, possibly, with respect to developmental delay) than that of patients ascertained postnatally. The same does not hold true for 45,x diagnosed prenatally.     

Molecular cytogenetic characterization of ring chromosome 4 in a female having a chromosomally normal child

We present the clinical and molecular findings of mosaic ring chromosome 4. The patient was referred to us for infertility and short stature. Results of three repeated cytogenetic analyses from lymphocytes showed a similar mosaic karyotype with multiple cell-lines [46,XX,r(4)/45,XX,-4/46,XX,dic r(4)/47,XX,r(4),+r(4)/46,XX]. FISH showed deletion of the 4p subtelomeric region and the 4q telomeric region from the ring chromosome 4. The breakpoints were mapped using molecular analysis. Parental karyotypes were normal. During the course of this study, the patient became pregnant without assisted reproductive technology. The result of amniocentesis performed at 16 weeks gestation showed a normal karyotype. Delivery was uncomplicated. This is the first report, to our knowledge, of the presence of ring chromosome 4 having various mosaic conditions in a female having a chromosomally normal fetus.     

Turner syndrome female with a small ring X chromosome lacking the XIST, an unexpectedly mild phenotype and an atypical association with alopecia universalis

Rearranged X chromosome in Turner syndrome (TS) are generally well tolerated but in cases of ring X chromosomes and of X/autosome translocations the incidence of mental retardation and other congenital abnormalities can be significantly higher. These abnormal phenotypes can be ascribed to failed or partial X inactivation. Here, we report a 10-year-old female who was referred for a cytogenetic analysis because she developed an alopecia universalis. The patient, of normal intelligence, had been found to have traits of TS, especially short stature. A first cytogenetic analysis showed a no mosaic 45,X karyotype. Since, the risk of developing gonadoblastoma in TS patients with mosaicism for a Y derivative chromosome and because association of alopecia universalis and TS is uncommon, fluorescence in situ hybridization (FISH) was performed to search for a second cell population. Our patient was found to have a mosaic 45,X/46,X,+r. FISH analysis using sex chromosome probes permitted us to identify the very small marker as a ring X chromosome, detected in 90% of cells. The ring appeared to be formed almost totally of alphoid sequences with breakpoints in the juxtacentromeric region. The r(X) does not include the XIST locus and may, therefore, not be subject to X-inactivation. Unexpectedly mild phenotype in our patient and its association with alopecia universalis will be discussed.     

Short-arm deletion of an X chromosome (45,XO/46,XX p-)

Summary A 31-year-old female patient with short stature, signs of gonadal dysgenesis, and slight Turner signs is described with a mosaic 45,XO/46,XX del (X) (qterp11) determined with trypsin Giemsa-banding and C-staining. BUdR incorporation indicated the deleted X to be late replicating.     

A boy with small supernumerary marker chromosome X identified by FISH

Marker or ring X chromosomes are frequently seen in Ullrich-Turner Syndrome with 46,X,r(X) karyotype, but only 8 children were reported with an extra marker X chromosome in at least some of their cell lines, we describe a 5 years old male patient who is mosaic (17%) for a cell line with an extra ring shaped marker X chromosome in addition to a normal 46,XY cell line. He had mild motor mental retardation, a dysmorphic face, dysplastic ears, high arched palate, cryptorchidism and brachydactyly. G-banding showed 46,XY[83]/47,XY,+r?[17] karyotype. NOR banding revealed no satellite region but its centromere was intact in C-banding. By fluorescent in situ hybridization (FISH) technique, dual X/Y alpha-satellite probes were used to detect the origin of ring shaped marker chromosome and 17% of his cells had two X chromosome signals due to marker X; hybridization with X chromosome inactivation center (XIST) specific probe revealed the absence of the locus on the ring chromosome. In this report, clinical features of our patient are compared with previously reported cases and the cytogenetic and molecular cytogenetic techniques used to detect origin of marker chromosome are discussed.     

The proportion of cells with functional X disomy is associated with the severity of mental retardation in mosaic ring X Turner syndrome females

Turner syndrome females (45,X) do not have mental retardation (MR), whereas some mosaic ring X Turner syndrome females, with 45,X/46,X,r(X), have severe MR. The MR is believed to be caused by a failure of X chromosome inactivation (XCI) of the small ring X chromosome, which leads to functional X disomy (FXD), To explore this hypothesis, we examined the proportion of FXD cells in the peripheral blood of four ring X Turner syndrome females with various levels of MR, using two newly developed XCI assays based on DNA methylation of X-linked genes. As a result, the two patients with extremely severe MR showed complete FXD patterns, whereas the remaining two patients with relatively milder MR showed partial FXD patterns. These results indicate that the proportion of FXD cells may be associated with the severity of MR in mosaic ring X Turner syndrome females, although this association should be confirmed by examining brain cells during development. One of the cases with severe MR and a complete FXD pattern neither lacked the XIST gene nor had uniparental X isodisomy, and we discuss the mechanism of the failure of XCI in this case.     

Cytogenetic findings in a consecutive series of 478 patients with Turner syndrome. The Leuven experience 1965-1989

In this report, we present the cytogenetic findings in 478 patients with Turner syndrome diagnosed in Leuven in the period 1965-1989. The karyotypic anomalies are classified into seven groups: 1) classic, 45,X karyotype (52.1%); 2) mosaic 45,X/46,XX (10.9%); 3) mosaic 45,X/47,XXX and other "super-female" cell lines (4.6%); 4) isochromosomes i(Xq) and i(Xp) (16.1%); 5) ring chromosomes r(X) (4.4%); 6) other structural aberrations of the X chromosome (7.7%); and finally 7) mosaic 45,X/46,XY patients (4%). The most pertinent chromosomal findings are briefly discussed and compared with previous reported surveys on subject.     

45,X/46,SYq dic-Sexchromosome mosaic]

This is the report on an obese girl with small stature and sexual infantilism. A 45,X/46,XYq dic mosaic was found in blood and fibroblast cultures. A summary is given of the cases so far reported in the literature. The clinical picture does not differ significantly from that of 45,X/46,XY cases. The relationship of phenotype and structural abnormalities of the Y chromosome is discussed.     

45,X/46,XYq dic-Geschlechtschromosomenmosaik

Zusammenfassung Es wird über eine Patientin mit Kleinwuchs, Adipositas und sexuellem Infantilismus berichtet. Die Abklärung ergab ein 45,X/46,XYq dic-Mosaik. Es folgt eine Zusammenfassung der bis jetzt in der Literatur beschriebenen Fälle von Ydic. Das klinische Bild unterscheidet sich nicht wesentlich von jenem des 45,X/46,XY-Mosaiks. Anschließend werden die Zusammenhänge zwischen strukturellen Aberrationen des Y-Chromosoms und Phänotypus diskutiert.

---

45,X/46,XYq dic-Sexchromosome mosaic

Summary This is the report on an obese girl with small stature and sexual infantilism. A 45,X/46,XYq dic mosaic was found in blood and fibroblast cultures. A summary is given of the cases so far reported in the literature. The clinical picture does not differ significantly from that of 45,X/46,XY cases. The relationship of phenotype and structural abnormalities of the Y chromosome is discussed.

     

Case report: a successful pregnancy outcome in a patient with non-mosaic Turner syndrome (45, X) via in vitro fertilization

We describe a successful pregnancy outcome in a patient with non-mosaic Turner syndrome (45, X) via in vitro fertilization. The patient achieved a second pregnancy at 35 years of age. The her blood lymphocyte karyotype was examined by G-band and FISH. Furthermore, cumulus cells and her elbow skin cells were evaluated via FISH. Non-mosaic Turner syndrome was determined by G-banding [100 % (50/50) 45, X]. Lymphocytes were shown as 478/500 (95.6 %) cells of X sex chromosome signal, 15/500 (3.0 %) cells of XXX signal, and 7/500 (1.4 %) cells of XX signal. The cumulus cells were mosaic: 152/260 (58.5 %) were X; 84/260 (32.3 %) were XXX, 20/260 (7.7 %) were XX, and 4/260 (1.5 %) were XY. Moreover, skin cells included a mosaic karyotype [47, XXX(29)/46, XX(1)]. We conclude that the collection of a large number of blood lymphocytes can reveal different mosaic patterns (X, XX and XXX) by FISH in spite of non-mosaic Turner syndrome.     

A case of 46,XY/45,X/46,XX intersex

Summary A case of 46,XY/45,X/46,XX mosaicism in a phenotypic intersex is decribed in detail. A few relevant aspects, which emerge especially from the phenotypic and karyotypic analysis, are briefly commented upon.

---

Zusammenfassung Es wird ein Fall von Mosaicismus 46,XY/45,X/46,XX beschrieben. Einige Aspekte, die aus der phänotypischen und karyotypischen Analyse des Patienten hervorgehen, sind kurz kommentiert.

     

A study of 45,X/46,XX mosaicism in Turner syndrome females: a novel primer pair for the (CAG)n repeat within the androgen receptor gene

This paper describes the procedures developed for the determining of diparental/uniparental origin of X chromosomes in mosaic Turner females (karyotype 45,X/46,XX), and accounts for results of the analysis of chromosomal material from 20 girls with Turner syndrome. An (CAG)n repeat within the androgen receptor (AR) gene was selected as a genetic marker. A novel primer pair for amplification of the (CAG)12-30 repeat was designed. These primers gave an amplification product of 338 bp in length and were following (5'-->3'): agttagggctgggaagggtc and cggctgtgaaggttgctgt. Nineteen of the subjects were heterozygous for the selected marker. In 4 cases there were distinct signals from three alleles. The only Turner female in the study who had been previously ascribed a non-mosaic 45,X karyotype by using cytogenetic techniques, proved to be a cryptic mosaic, displaying two alleles of the genetic marker in the more sensitive molecular assay. These results suggest that in most cases 45,X/46,XX mosaicism in Turner females arises through loss of one of the X chromosomes in some cell lines in originally 46,XX conceptuses, rather than through mitotic non-disjunction during early embryogenesis in originally 45,X conceptuses. A high sensitivity of the modified assay based on PCR-amplification of the (CAG)n repeat within AR gene proves its usefulness as a tool for studying mosaicism in Turner syndrome.     

Seven ring (X) chromosomes lacking the XIST locus, six with an unexpectedly mild phenotype

Small ring (X) chromosomes lacking the XIST gene at Xq13.2 have been associated with a severe phenotype that includes mental retardation, facial dysmorphism and congenital abnormalities. It has been hypothesised that the loss of XIST results in functional disomy for the sequences contained in the ring. We studied 47 females with a 45,X/46,r(X) karyotype and found seven to have an XIST-negative ring. Only one of the seven patients had the severe phenotype. The remaining six patients had physical phenotypes consistent with Turner syndrome. The rings were characterised cytogenetically and molecularly. The severe phenotype in one patient can be explained by the absence of XIST expression, the relatively large amount of Xp material in the ring and, possibly, the concomitant maternal uniparental isodisomy. We propose three explanations for the unexpectedly mild phenotypes in the remaining six patients; (1) the rings contained limited amounts of X-chromosome material, and sequences that, when functionally disomic, result in a severe phenotype were absent; (2) mosaicism resulting in the absence of the ring from tissues, such as the brain, which are important in the severe phenotype and (3) the presence of an inactive X in some tissues at some time, exemplified by the demonstration of XIST expression in one patient.     

The rate of sister chromatid exchange in normal human bone marrow cells

Summary A ring chromosome 22 is described in a 6-year-old mentally retarded boy, who presented a dysmorphic syndrome. The ring chromosome 22 was inherited from the mother, in whom a 46,XX/46,XX,r(22)/45,XY,-15,-22,+t(15;22)(p11;q11) mosaic karyotype was found, indicating a high degree of instability of the chromosome(s) 22 in this woman.     

46,X,i(Xq)/47,XX,+13 mosaicism

A 10-year-old girl with short stature and other features of Turner's syndrome was found to be a mosaic consisting of 46,X,i(Xq) and 47,XX,+13 cell lines, a hitherto undescribed situation. She had none of the clinical features of trisomy 13 syndrome, with a possible exception of postaxial polydactyly of the left foot. Her PHA-stimulated blood lymphocytes and EB virus-transformed B lymphocytes both revealed the Xi(Xq)/XX,+13 mosaicism, while her skin fibroblasts showed an exclusively 46,X,i(Xq) karyotype. Studies using Q-and R-banding heteromorphisms as markers indicated that the patient started as a 13 trisomic zygote resulting from a maternal meiotic error, followed by the loss of chromosome 13 at an early mitotic division. C-banding analysis revealed two C banding blocks in the iso X chromosome, an indication that the chromosome was dicentric. BrdU-Hoechst-Giemsa analysis revealed that the iso X chromosome was late-replicating with both its arms either synchronously or asynchronously replicating. The iso X chromosome was thus designated as idic (Xq)(p11:p11). In view of the presence of the XX cell line, it was concluded that the patient started as an XX,+13 zygote, followed by two mitotic events, the loss of a chromosome 13 and the formation of the iso X chromosome, occurring either simultaneously or in succession.     

Report of a case of true hermaphroditism with karyotype 45,X/46,XX/46,X,mar/47,XX,mar

The case of a 24-year-old man with hypoplastic external genitalia, lack of the right scrotal testis and gynaecomastia has been described. In the intermitotic cells the cytogenetic investigations revealed the presence of the X body and the absence of the Y body. A 45,X/46,XX/46,X,mar/47,XX,mar karyotype could be established. On laparotomy a rudimentary ovary, uterus and vagina were detected on the right side of the abdominal cavity.     

46,XX/46,XX,del (10) (p13)/47,XX,+r/47,XX,del (10) (p13), + r mosaicism and partial trisomy 10p phenotype (author's transl)]

The mosaicism 46,XX/46,XX,del(10)(p13)/47,XX, +r/47,XX,del(10)(p13), +r was found in the lymphocytes and the fibroblasts of a patient with the following : profound mental retardation; craniofacial dysmorphism with frontal bossing, fine eyebrows, a large hypoplastic nasal bridge, prognathism of the upper jaw, thick lips; a long and thin neck; congenital heart disease; skeletal malformations, with club feet; and hypotonia and lax ligaments. These malformations, compatible with the trisomy 10p syndrome, suggest that the supernumerary ring chromosome was composed of 10p material. An increase of HK1 and GOT1 activities was found. This is in favour of a partial trisomy of chromosome 10. The relative frequencies of the clones constituting the mosaic vary from tissue to tissue and with time.     

Molecular analysis of a ring chromosome X in a family with fragile X syndrome

The phenotypically normal sister of a patient affected by fragile X syndrome was referred for genetic counselling and was found to carry a mosaic karyotype 46,X,r(X)/45,X. Because the probability of the simultaneous chance occurrence of fragile X syndrome and a ring chromosome X in the same family is very low, we postulated that the breakpoint of the ring chromosome X originated in the cytogenetic break in Xq27.3 responsible for fragile X syndrome. In order to determine the relative positions of the breakpoint on the ring chromosome X and the (CGG)n unstable sequence responsible for the fragile X mutation, we used molecular markers to analyse the telomeric regions of chromosome X in this family. The results showed that the ring chromosome X was the maternal fragile X chromosome and that the telomeric deletion on the long arm encompassed the (CGG)n sequence. This suggests that the cytogenetic break in Xq27.3 is distinct from the unstable (CGG)n sequence, or that the break followed by the end-to-end fusion creating the ring chromosome was not completely conservative. Analysis of DNA markers on the short arm of chromosome X evidenced a deletion of a large part of the pseudoautosomal region, allowing us to position the genes involved in stature and in some syndromes associated with telomeric deletions of Xp on the proximal side of the pseudoautosomal region.     

Dicentric Y-chromosome mosaicism in a girl with clitoral hypertrophy

Summary A 12-year-old girl with small stature and a hypertrophic clitoris was found to be mosaic for 45,X/46,X.dic(Y)(qter»p11:p11»qter)/46,XX/47, XX,dic(Y)(qter»p11:raqter). The dicentric chromosome was identified using Q-banding. These findings indicate mitotic instability of the dicentric Y, as well as the presence of an X chromosome in this patient.