On immunoglobulin heavy chain gene switching: two gamma 2b genes are rearranged via switch sequences in MPC-11 cells but only one is expressed

During B lymphocytes differentiation, switches in the expression of heavy chain immunoglobulin constant region (CH) genes occur by a novel DNA recombination mechanism. We have investigated the requirements of the CH gene switch by characterizing two rearranged gamma 2b genes from a gamma 2b producing mouse myeloma (MPC-11). One of the two gamma 2b genes is present in 2-3 copies per cell (gamma 2b strong hybridizer) while the other is present in approximately 1 copy per cell (gamma 2b weak hybridizer). Genomic clones of the gamma 2b strongly hybridizing gene indicate that this is an abortive switch event between the S gamma 3 and S gamma 2b regions. However, clones of the gamma 2b weakly hybridizing gene suggest a functional rearrangement due to the presence of VH, JH and S mu sequences. The switch-recombination sites of these rearranged gamma 2b genes and those of other CH genes show a high degree of preference for the sequence AGGTTG 5' of either the S mu donor site or the appropriate CH S acceptor site. AGGTTG and its analogs are rare in the S mu region, are somewhat prevalent in s alpha and in the case of S mu are found 5' of a tandemly repeated DNA sequence (GAGCT, GGGGT) comprising most of S mu.     

Nucleotide sequence and properties of the murine gamma 3 immunoglobulin heavy chain gene switch region: implications for successive C gamma gene switching

During B lymphocyte differentiation, immunoglobulin heavy chain constant region (CH) genes undergo a unique series of DNA recombination events culminating in the CH class switch. CH switch (S) regions are located 2 kb 5' of each CH gene except delta (i.e. mu, gamma 3, gamma 1, gamma 2b, gamma 2a, epsilon and alpha). We describe the structural features of the gamma 3 switch region. Hybridization experiments show that S gamma 3 has remarkable homology to both S mu and other S gamma regions while S mu possesses limited homology to the other S gamma sequences. However, S mu possesses extensive sequence homology with S epsilon and S alpha. The nucleotide sequence of S gamma 3 reveals higher densities of S mu repetitive sequences (GAGCT and GGGGT) and another S region common sequence (YAGGTTG) than observed for S gamma 1, S gamma 2b or S gamma 2a. In addition, the conservation of S mu like repetitive sequences in S gamma regions is correlated with the 5' leads to 3' gamma gene order (i.e. S gamma 3 greater than S gamma 1 greater than S gamma 2b greater than S gamma 2a). A model is presented which suggests that the unique features of S gamma 3 may allow for successive switches from C mu to any C gamma gene.     

Nucleotide sequences of switch regions of immunoglobulin C epsilon and C gamma genes and their comparison

Immunoglobulin class switch involves a unique recombination event that takes place at the switch (S) region which is located 5' to each constant region (C) gene of the heavy (H) chain. For example, differentiation of the B lymphocyte from a mu-chain producer to an epsilon-chain producer is mediated by the switch recombination between the S mu and S epsilon regions. In order to elucidate the molecular mechanism for the switch recombination, we have determined nucleotide sequences surrounding the class switch recombination sites of the C epsilon and C gamma 3 genes and those in the 5' flanking regions of the C gamma 2a and C delta genes. The results indicate that the 5' flanking regions of all the CH genes except for the C delta gene contain the S regions which comprise tandem repetition of short unit sequences in agreement with the previous analyses of the S gamma 1, S gamma 2b, S mu, and S alpha regions. Comparison of the nucleotide sequences of all the S regions revealed that length as well as nucleotide sequences of the S regions vary among different classes of the CH gene, but they share short common sequences, (G)AGCT and TGGG(G). The nucleotide sequence of the S mu region is homologous to those of the other S regions in the decreasing order of the S epsilon, S alpha, S gamma 3, and (S gamma 1, S gamma 2b, s gamma 2a) regions. We have compared the nucleotide sequences immediately adjacent to the recombination sites of seven rearranged genes and have always fund tetranucleotides TGAG and/or TGGG, except for one case. Such tetranucleotides may constitute a part of the recognition sequence of a putative recombinase. These results provide further support for our previous proposal that the switch recombination may be facilitated by short common sequences dispersed in all the S regions.     

Physical mapping of the bovine immunoglobulin heavy chain constant region gene locus

Bovine antibodies have recently attracted increasing attention, as they have been shown to exhibit prophylactic and therapeutic properties in selected infectious diseases in humans. In the present study, we have isolated bacterial artificial chromosomes and cosmid clones containing the bovine JH, mu, delta, gamma 1, gamma 2, gamma 3, epsilon, and alpha genes, which allowed us to make a contig of the genes within the bovine IGHC locus. The genes are arranged in a 5'-JH-7 kb-mu-5 kb-delta-33 kb-gamma 3-20 kb-gamma 1-34 kb-gamma 2-20 kb-epsilon- 13 kb-alpha-3' order, spanning approximately 150 kb DNA. Examination of the bovine germline JH locus revealed six JH segments, two of which, JH1 and JH2, were shown to be functional although there was a strong preference for expression of the former. Sequence alignment of the bovine 5' E mu enhancer core region with those of other mammals, demonstrated an absence of the mu E3 motif and a shortened spacer between the mu A and mu B sites within the bovine E mu enhancer core region. Furthermore, the essential sequence element for class switching, switch mu, spanning approximately 3-kb repetitive sequence and abundant in the switch region motifs CTGGG (187 repeats) and CTGAG (127 repeats), was identified immediately upstream of the mu gene. A further sequence comparison revealed that the bovine IGHC genes display an extensive polymorphism leading to expression of multiple antibody allotypes.     

Two new isotype-specific switching activities detected for Ig class switching

Ig class switch recombination (CSR) occurs by an intrachromosomal deletional process between switch (S) regions in B cells. To facilitate the study of CSR, we derived a new B cell line, 1.B4.B6, which is uniquely capable of mu --> gamma3, mu --> epsilon, and mu --> alpha, but not mu --> gamma1 CSR at its endogenous loci. The 1.B4.B6 cell line was used in combination with plasmid-based isotype-specific S substrates in transient transfection assays to test for the presence of trans-acting switching activities. The 1.B4.B6 cell line supports mu --> gamma3, but not mu --> gamma1 recombination, on S substrates. In contrast, normal splenic B cells activated with LPS and IL-4 are capable of plasmid-based mu --> gamma1 CSR and demonstrate that this S plasmid is active. Activation-induced deaminase (AID) was used as a marker to identify existing B cell lines as possible candidates for supporting CSR. The M12 and A20 cell lines were identified as AID positive and, following activation with CD40L and other activators, were found to differentially support mu --> epsilon and mu --> alpha plasmid-based CSR. These studies provide evidence for two new switching activities for mu --> gamma1 and mu --> epsilon CSR, which are distinct from mu --> gamma3 and mu --> alpha switching activities previously described. AID is expressed in all the B cell lines capable of CSR, but cannot account for the isotype specificity defined by the S plasmid assay. These results are consistent with a model in which isotype-specific switching factors are either isotype-specific recombinases or DNA binding proteins with sequence specificity for S DNA.     

Immunoglobulin gene expression and DNA methylation in murine pre-B cell lines

DNA modification accompanying immunoglobulin gene expression was examined in various Abelson murine leukemia virus (A-MuLV)-transformed cell lines, which were able to differentiate from the mu- to mu+ stage or to undergo an isotype switch during in vitro culture. The C mu genes were relatively demethylated in the A-MuLV-transformed cell lines examined irrespective of whether or not the C mu genes were expressed. Normal IgM-bearing B cells, as well as a T cell line, also showed a similar DNA methylation pattern and the C mu genes were relatively demethylated. In one of the mu+ clones, however, the expressed C mu gene was heavily methylated. The DNA methylation pattern did not change and remained hypermethylated before and after gamma 2b expression in the two cell lines which underwent class switch to gamma 2b during in vitro culture, suggesting that expression of the gamma 2b gene was not accompanied by demethylation of the C gamma 2b gene. Taken together, these results indicate that DNA demethylation within and around the CH gene may not be necessary for its expression.     

Human tonsil B lymphocyte function. II. Pokeweed mitogen-induced plasma cell differentiation of B cell subpopulations expressing multiple heavy chain isotypes on their surface

Human tonsil non-T cells were successfully separated into surface IgM+G-ve (sIgM+G-), sIgM+G+, sIgM-G-, and sIgM-G+ B cell fractions. The two-step separation technique used did not affect the pokeweed mitogen- (PWM) induced plasma cell differentiation of the B cells. The highest percentages of plasma cells after PWM stimulation were found in the sIgM- fractions, and the lowest percentage was in the sIgM+G- fraction (20.8 +/- 2.3%), the latter predominantly cytoplasmic mu-chain-positive (c mu +) (84.1 +/- 3.5%) plasma cells. In this fraction, almost no c gamma + plasma cells were found. The sIgM+G+ produced c mu + (47.5 +/- 7.5%), c gamma + (35.7 +/- 5.8%), and c alpha + (16.8 +/- 4.0%) plasma cells. All three isotypes were found on the surface of the B cells in this fraction before PWM stimulation. The sIgM-G- fraction contained about 10% plasma cells before stimulation, which were predominantly c gamma +. After PWM stimulation, primarily c alpha + (64.2 +/- 4.3%) plasma cells were found. The sIgM-G+ fraction produced both c gamma + (75.0 +/- 2.3%) and c alpha + (24.1 +/- 2.5) plasma cells. A mu to gamma class switch did not occur in vitro in the sIgM+G- fraction on PWM stimulation, and the sIgM+G+ fraction did not complete in vitro the mu to gamma switch it had started in vivo.     

B cell maturation in the chicken Harderian gland

We have characterized maturation of B lymphocytes in the chicken Harderian gland. Expression of Ig genes was studied by using lambda L and mu H chain-specific DNA probes. In unstimulated chickens, the concentration of mu H chain and lambda L chain mRNA in the Harderian gland was observed to be greater than 8 times higher than in the bursa of Fabricius or spleen. By using in situ hybridization, the plasma cells expressing mu mRNA were located in central area of the gland packed around the tubules. Antibodies produced by the Harderian plasma cells were measured from the tears before and after antigenic stimulation. In unstimulated chickens high levels of total IgM, IgA, and IgG were observed. After ocular stimulation with tetanus toxoid, specific antitetanus IgG and IgA antibodies appeared in the tears but IgM antibodies were barely detectable. These results indicate that after antigenic stimulation the Harderian B cells rapidly mature through IgM secretion to the production of IgG or IgA. Southern blot analysis of the Harderian total genomic DNA showed strong rearrangement in the lambda L chain locus. In contrast, the band indicating major rearrangement in the mu H chain locus gave a very poor hybridization signal, indicating deletion of C mu genes in the Harderian gland DNA. As a conclusion, our present data indicate for the Harderian gland a role in terminal B cell differentiation and Ig class switch.     

Ig mu-epsilon isotype switch in IL-4-treated human B lymphoblastoid cells. Evidence for a sequential switch.

IgE is produced by B lymphocytes that have undergone a deletional rearrangement of their Ig H chain gene locus, a rearrangement that joins the switch region of the mu gene, S mu, with the corresponding region of the epsilon gene, S epsilon. To examine the resulting composite S mu-S epsilon junctions of human lymphoid cells, we have used a polymerase chain reaction strategy to clone the switch regions of the human myeloma U266 and of two IgE-producing human cell lines generated by treatment of lymphocytes with EBV plus IL-4. The switch junction of one of the EBV lines is a complex rearrangement in which a fragment of S gamma is interposed between S mu and S epsilon. This finding suggested that the switch to epsilon in this human lymphoid cell was preceded by a S mu-S gamma recombination. To determine whether this sequential switch rearrangement represented a unique event or occurred with some regularity in human B cells switching to IgE production, DNA samples from bulk cultures of lymphocytes treated with IL-4 were subjected to polymerase chain reaction amplification of their S mu-S epsilon junctions. When the resulting fragments were examined by Southern blotting, a substantial fraction hybridized to an S gamma probe. This finding suggests that sequential recombination involving S gamma is not rare in the switch to epsilon production in humans. Our polymerase chain reaction strategy should be useful in studying isotype switching at the DNA level.     

Increased T gamma and T mu cells in BALB/c mice with IgG and IgM plasmacytomas and hybridomas

The results of previous studies in our laboratory have shown that mice bearing plasmacytomas and hybridomas that secrete IgA or IgE are accompanied by increased frequencies of Lyt-1-2+ T lymphocytes bearing Fc receptors (FcR) for IgA (T alpha) or IgE (T epsilon), respectively. The present study was undertaken to examine whether IgG- or IgM-secreting tumors influenced the frequency of T lymphocytes that express FcR for IgG or IgM. We studied mice bearing IgG- and IgM-secreting plasmacytomas and hybridomas. BALB/c mice injected subcutaneously with the IgG-secreting hybridoma HDP1 (gamma 1 kappa, anti-TNP) were sequentially examined for the frequencies and Lyt phenotypes of splenic lymphocytes bearing FcR for IgG (T gamma), IgM (T mu), and IgA (T alpha). A threefold increase in the frequency of T gamma lymphocytes that were Lyt-1-2+, L3T4- was seen. The frequencies of T mu and T alpha lymphocytes in these mice were not significantly altered. Similarly, mice injected subcutaneously with the IgM-secreting plasmacytoma MOPC 104E (mu lambda, anti-dextran) or the IgM-secreting hybridoma C1D1 (mu kappa, anti-ox RBC) were examined sequentially for the frequencies of T gamma, T mu, and T alpha lymphocytes. Mice with established IgM subcutaneous tumors showed a twofold increase in splenic, nylon wool-nonadherent T mu lymphocytes. This was associated with a relative increase in Lyt-2+ splenic T lymphocytes and a relative decrease in Lyt-1+ splenic T lymphocytes. No changes were observed in the frequencies of either T gamma or T alpha lymphocytes. These studies extend to IgG and IgM the observation that plasmacytomas and hybridomas secreting immunoglobulins of a specific isotype cause an expansion of T lymphocytes bearing FcR specific for the corresponding isotype. The expansion of FcR+ Lyt-1-2+ T lymphocytes likely represents an exaggerated, but otherwise normal, immunoregulatory response of the host. These cells may be an important element in the regulation of isotype expression.     

Detection of an immunoglobulin switch region-specific DNA-binding protein in mitogen-stimulated mouse splenic B cells.

We have detected a nuclear protein from lipopolysaccharide- and dextran sulfate-stimulated mouse splenic B cells which binds specifically to the immunoglobulin switch mu (S mu) sequence. We have termed the binding protein NF-S mu. DNA containing the S mu repeated sequence, GAGCTGGGGTGAGCTGAGCTGAGCT, was used as a probe in electrophoretic mobility shift assays. Methylation interference analysis indicated that binding centers on the run of four guanine residues. Competitions with mutated S mu sequences confirmed the importance of the run of G residues and revealed that optimal binding occurs when they are flanked by GAGCT. The kinetics of the expression of NF-S mu in splenic B cells treated with lipopolysaccharide and dextran sulfate parallels the induction of recombinational activity at S mu in these cells. On the basis of these data, we suggest that NF-S mu may be an effector of switch recombination.