The nucleotide sequence of threonine transfer RNA coded by bacteriophage T4.

The nucleotide sequence of a low molecular weight RNA coded by bacteriophage T4 (and previously identified as species alpha) has been determined. The molecule is of particular biological interest for its associated biosynthetic properties. This RNA is 76 nucleotides in length, contains eight modified bases, and can be arranged in a cloverleaf configuration common to tRNAs. The anticodon sequence is UGU, which corresponds to the threonine-specific codons ACA G. The nucleotide sequence was determined primarily by nearest-neighbor analysis of RNA synthesized in vitro using [alpha-32P]nucleoside triphosphates. Using the single-strand specific nuclease S1, two in vivo labeled half-molecules were generated and analysed. This information together with restrictions imposed by nearest-neighbor data, provided a unique linear sequence of nucleotides with the features of secondary structure common to tRNA molecules.     

Correlation between genetic and nucleotide distances in a bacteriophage T4 transfer,RNA gene

Genetic map distances have been measured for four point mutations whose exact nucleotide positions in the gene for the glutamine transfer RNA of bacteriophage T4 have previously been established. The average frequency of recombination per nucleotide was found to be 0.014. A fifth mutation, which was previously observed to eliminate both the glutamine and leucine tRNA species, is shown by genetic criteria to be a deletion mutation.     

The nucleotide sequence of bacteriophage T5 glutamine transfer RNA

Uniformly ³²P-labeled phage-specific tRNA^Gln has been isolated from bacteriophage T5-infected Escherichia coli cells and its nucleotide sequence has been determined using thin-layer chromatography on cellulose to fractionate the oligonucleotides. The sequence is: pUGGGGAUUAGCUUAGCUUGGCCUAAAGCUUCGGCCUUUGAAGψCGAGAUCAUUGGTψCAAAUCCAAUAUCCCCUGCCA_OH. The main feature of this tRNA is the absence of Watson-Crick pairing between the 5′-terminal base and the fifth base from its 3′-end. The structure of tRNA was confirmed by DNA sequencing of its gene.     

Isolation of the transfer RNA genes of bacteriophage T4 and transfer RNA synthesis in vitro.

Non-glucosylated T4 DNA was restricted with the endonuclease EcoRI and the mixture of DNA fragments separated by gel electrophoresis and transcribed with purified Escherichia coli RNA polymerase. Three purified fragments were shown to act as templates for tRNA synthesis. A smaller fragment, shown to be hybridizable to 32P-labeled T4 tRNA was not transcribable. It was concluded that the promoter for T4 tRNA synthesis had been separated from the structural genes in the smaller fragment by EcoRI and that the distal portion of the tRNA gene cluster lacks internal promoters which display in vitro activity. Preparations of non-glucosylated T4 DNA were never fully restricted with EcoRI and when the larger purified fragments carrying the tRNA were restricted with excess enzyme only a slight cleavage to yield the smaller fragments was obtained. The property of the DNA-limiting complete restriction is not know.     

An Escherichia coli ribonuclease which removes an extra nucleotide from a biosynthetic intermediate of bacteriophage T4 proline transfer RNA.

The biosynthesis of bacteriophage T4 tRNAPro, tRNASer, and tRNAIle requires enzymatic removal of extra nucleotides from the 3' terminus of the respective precursor RNAs. A ribonuclease activity capable of catalyzing such reactions has been partially purified from uninfected Escherichia coli using an artificial precursor RNA as substrate. A number of ribonuclease activities were resolved during purification. Use of E. coli strain BN, a mutant known to be deficient in the relevant ribonuclease activity, permitted us to identify it in wild-type cells. This activity was designated the BN ribonuclease. BN ribonuclease had an apparent molecular weight of 35,000 as measured by Sephadex gel filtration. Mg2+ was required for activity, which was optimal at [Mg2+] of 2mM. Activity did not require monovalent cations K+ or Na+. BN ribonuclease was less efficient at removing extra residues in the biosynthesis of tRNASer and tRNAIle than in the biosynthesis of tRNAPro.     

Three suppressor forms of bacteriophage T4 leucine transfer RNA

Three suppressor forms of bacteriophage T4 leucine transfer RNA were isolated and characterized. One suppresses U-A-G mutations, another suppresses U-A-G and U-A-A mutations, while the third suppresses U-G-A mutations. Each suppressor specifies a new anticodon sequence in leucine transfer RNA. Whereas wild-type leucine transfer RNA has the anticodon sequence N-A-A (N is a modified U), the suppressor forms have C-U-A, N-U-A or N-C-A, respectively.     

UV-induced mutation in bacteriophage T4.

Two late gene am mutants of bacteriophage T4 that can be induced to revert by UV were crossed to a temperature-sensitive ligase mutant. In the double mutants, UV-induced reversion was eliminated at a semirestrictive temperature. When the single am mutants were irradiated and then allowed a single passage in a permissive host, the UV-induced reversion frequency was increased by 15- to 25-fold. This increased mutagenesis was also abolished by the presence of the ligase allele. When the UV-irradiated single am mutants multiply infected a permissive host, allowing multiplicity reactivation to occur, the induced reversion frequency was reduced similarly to the reduction in lethality. The mutagenesis that remained was again abolished by the presence of the ligase allele. It is concluded that UV induces mutations in phage T4 through the action of a pathway that includes polynucleotide ligase. The increase in mutation frequency after growth in a permissive host implies that mutagenesis can occur at more than one stage of the infection rather than only in an early stage before expression of the mutant genome. The process of multiplicity reactivation appears to be error-free since it overcomes lethal lesions without inducing new mutations.     

Conditionally lethal mutants of bacteriophage T4 defective in production of a transfer RNA

The two buried carboxyls (Asp-102 and Asp-194) in both chymotrypsin and chymotrypsinogen are ionized at pH values greater than 4.2 and may be ionized even as low as pH 3.This was demonstrated by coupling most of the surface carboxyis of the proteins by a carbodi-imide with glycinamide or semicarbazide to diminish the groups ionizing at low pH and then titrating the proton uptake on denaturation by sodium dodecyl sulphate between pH 3.0 and 4.6. At pH values greater than 4.2 all unblocked carboxyls are ionized. The proton uptake during the conformational change on denaturation was determined by a stopped-flow procedure and found to be about 2H⁺/mol between pH 3.0 and 3.6. The rate constant for the uptake of protons is the same as that for the exposure of tryptophan and lies in the tens of millisecond region.The buried negative charge at the active site appears to be mainly on Asp-102 rather than on His-57, the pK_a of which must be raised by the buried charge. This enhances its efficacy as a base catalyst in the “charge relay system”.The presence of an intact charge relay system in the inactive zymogen illustrates the importance of stereochemical fit between enzyme and substrate. Enzyme catalysis could hardly be mediated by a catalyst which is uniquely reactive in the absence of correct enzyme-substrate orientation as this would be inconsistent with its specificity.     

An ochre suppressor of bacteriophage T4 that is associated with a transfer RNA

Ultraviolet circular dichroism spectra have been obtained for native and heat-denatured Drosophila virilis satellite DNAs I, II and III. Gall &; Atherton (1974) have found that these DNAs have simple, unique sequences. We compare here the circular dichroism spectra of these satellite sequences with the circular dichroism spectra of synthetic DNAs of simple sequences which are combined in first-neighbor calculations. We also apply an analytical procedure for determining nearest-neighbor frequencies from the DNA spectra (Allen et al., 1972). The results are an indication of the potential usefulness and present limitations of circular dichroism measurements in confirming or determining the nearestneighbor frequencies of satellite DNAs of simple sequences.     

A functional requirement for modification of the wobble nucleotide in the anticodon of a T4 suppressor tRNA

Temperature-sensitive mutants of E. coli have been isolated which restrict the growth of strains of bacteriophage T4 which are dependent upon the function of a T4-coded amber or ochre suppressor transfer RNA. One such mutant restricts the growth of certain ochre but not amber suppressor-requiring phage. Analysis of the T4 tRNAs synthesized in this host revealed that many nucleotide modifications are significantly reduced. The modifications most strongly affected are located in the anticodon regions of the tRNAs. The T4 ochre suppressor tRNAs normally contain a modified U residue in the wobble position of the anticodon; it has been possible to correlate the absence of this specific modification in the mutant host with the restriction of suppressor activity. Furthermore, the extent of this restriction varies dramatically with the site of the nonsense codon, indicating that the modification requirement is strongly influenced by the local context of the mRNA. An analysis of spontaneous revertants of the E. coli ts mutant indicates that temperature sensitivity, restriction of phage suppressor function, and undermodification of tRNA are the consequences of a single genetic lesion. The isolation of a class of partial revertants to temperature insensitivity which have simultaneously become sensitive to streptomycin suggests that the translational requirement for the anticodon modification can be partially overcome by a change in the structure of the ribosome.     

Systematic mutation of bacteriophage T4 lysozyme

Amber mutations were introduced into every codon (except the initiating AUG) of the bacteriophage T4 lysozyme gene. The amber alleles were introduced into a bacteriophage P22 hybrid, called P22 e416, in which the normal P22 lysozyme gene is replaced by its T4 homologue, and which consequently depends upon T4 lysozyme for its ability to form a plaque. The resulting amber mutants were tested for plaque formation on amber suppressor strains of Salmonella typhimurium. Experiments with other hybrid phages engineered to produce different amounts of wild-type T4 lysozyme have shown that, to score as deleterious, a mutation must reduce lysozyme activity to less than 3% of that produced by wild-type P22 e416. Plating the collection of amber mutants covering 163 of the 164 codons of T4 lysozyme, on 13 suppressor strains that each insert a different amino acid substitutions at every position in the protein (except the first). Of the resulting 2015 single amino acid substitutions in T4 lysozyme, 328 were found to be sufficiently deleterious to inhibit plaque formation. More than half (55%) of the positions in the protein tolerated all substitutions examined. Among (N-terminal) amber fragments, only those of 161 or more residues are active. The effects of many of the deleterious substitutions are interpretable in light of the known structure of T4 lysozyme. Residues in the molecule that are refractory to replacements generally have solvent-inaccessible side-chains; the catalytic Glu11 and Asp20 residues are notable exceptions. Especially sensitive sites include residues involved in buried salt bridges near the catalytic site (Asp10, Arg145 and Arg148) and a few others that may have critical structural roles (Gly30, Trp138 and Tyr161).     

Function of the bacteriophage T4 transfer RNA's

Maximum growth of bacteriophage T4 requires the phage complement of transfer RNA. tRNA-deficient T4 grown on laboratory strains of Escherichia coli showed a moderate decrease in burst size that correlated with a decrease in the rate of synthesis of the major structural proteins of the T4 tail fiber. Some tRNA-defieient T4 mutants showed a 20-fold reduction in burst size on one of a number of E. coli strains isolated from hospital patients. We consider it most likely that the T4 tRNA's function to ensure optimum rates of protein synthesis in the maximum number of hosts by supplementing the reading capacity for those codons used more commonly in the virus than in the host.     

Competition between bacteriophage f2 RNA and bacteriophage T4 messenger RNA

In an $\text{Escherichia coli}$ cell-free protein synthesis assay, mRNA isolated from cells late after infection by phage T4 out-competes bacteriophage f2 RNA. Addition of a saturating or subsaturating amount of T4 mRNA inhibits translation of f2 RNA, while even an excess of f2 RNA has no effect on translation of T4 mRNA. Peptide mapping of reaction products labeled with formyl-[³⁵S]-methionyl-tRNA was used to quantitate f2 and T4 protein products synthesized in the same reaction. We suggest that messenger RNA competition might be one mechanism by which T4 superinfection of cells infected with phage f2 blocks translation of f2 RNA and possibly host mRNA.     

Self cleavage of a precursor RNA from bacteriophage T4

We found that a precursor of an RNA molecule from T4-infected Escherichia coli cells (p2Spl; precursor of species 1) has the capacity to cleave itself in a specific position. This cleavage is similar to a cleavage carried out by the aid of a protein, RNase F, that has been previously identified. This cleavage could lead to the maturation of an RNA (species 1) found in T4-infected E. coli cells. The reaction is time and temperature-dependent and is relatively slow as compared to the protein-dependent reaction. It requires at least a monovalent cation and is aided by non-ionic detergents. In the absence of detergent the cleavage can occur but at a reduced rate. The substrate does not contain hidden nicks and a variety of experiments suggest that it does not contain a protein. Moreover, we found no indication that the cleavage is due to contaminating nucleases in the substrate or in the reagents. The intact secondary and tertiary structures of the molecule are necessary for the cleavage to occur. The finding of a self cleaving RNA molecule has interesting evolutionary implications.