Fluorescence lifetime distributions of DNA-4',6-diamidino-2-phenylindole complex

Time-resolved fluorescence of 4',6-diamidino-2-phenylindole (DAPI) complexes show that for a homogeneous polymer (polyd(AT) or polyd(A).polyd(T)) at high P/D (phosphate/dye) ratio, a single exponential component adequately describes the fluorescence decay. For the AT polymers at low P/D ratio or for native DNA, the decay cannot be described by a single-exponential term. A continuous distribution of lifetime values of Gaussian shape gives a good fit to the decay data. We propose that the lifetime distribution method for the analysis of the fluorescence decay of DNA-DAPI complexes provides a useful method of characterizing the microheterogeneity of site binding.     

Differential fluorescence of sister chromatids with 4'-6-diamidino-2-phenylindole.

Differential fluorescence of sister chromatids and sister chromatid exchanges (SCE) in chromosomes from human lymphocytes grown two replication cycles in medium containing 5-bromodeoxyuridine can be detected by fluorescence microscopy after staining with 4'-6-diamidino-2-phenylindole (DAPI). The DAPI fluorescence appears to be more stable than that of the dye 33258 Hoechst and may provide a more sensitive method for the detection of SCE.     

The binding of 4',6-diamidino-2-phenylindole to bovine serum albumin.

The binding of 4',6-diamidino-2-phenylindole (DAPI) to bovine serum albumin (BSA) has been investigated between pH 6 and 8, in 0.05 M phosphate buffer at 20 degrees C, by fluorescence titrations and the results analyzed according to a procedure previously reported (R. Favilla and A. Mazzini, Biochim. Biophys. Acta 788 (1984) 48). The dye binds to the protein with a blue shift of about 4 nm in its fluorescence emission maximum, but with an enhancement factor of 10 of its fluorescence quantum yield. The dissociation constant decreases from 100 microM to 54 microM as the pH is increased from 6 to 8, with a constant number of nearly three equivalent binding sites. The complete displacement of DAPI bound to BSA by Ca2+ suggests a possible specificity of this substantially electrostatic interaction. The fluorescence decay of DAPI bound to the protein shows a double exponential kinetics, with a tau 1 = 0.97 ns and tau 2 = 2.78 ns. These results, compared with those obtained for DAPI alone, tau 1 = 0.16 ns and tau 2 = 2.8 ns, are rationalized in terms of two different rotamers of DAPI. Both rotamers are able to bind to the protein, but only one of them undergoes an intramolecular proton transfer, from the 6-amidinium group to the indole aromatic ring, in the excited singlet state of DAPI alone. When DAPI interacts with BSA this transfer does not occur and consequently a large increase of fluorescence is observed.(ABSTRACT TRUNCATED AT 250 WORDS)     

Interactions of 4'', 6-diamidine-2-phenylindole with synthetic polynucleotides.

4', 6-Diamidine-2-phenylindole forms fluorescent complexes with synthetic DNA duplexes containing AT, AU and IC base pairs; no fluorescent complexes were observed with duplexes containing GC base pairs or with duplexes containing a single AT base pair sandwiched between GC pairs. The binding site size is one molecule of dye per 3 base pairs. The intrinsic binding constants are higher for alternating sequence duplexes than for the corresponding homopolymer pairs. With the exception of the four-stranded helical poly rI which exhibits considerable fluorescence enhancement upon binding of the ligand, none of the single- or multi- stranded polyribonucleotides and ribo-deoxyribonucleotide hybrid structures form fluorescent complexes with the dye. Poly rI is the only RNA which forms a DNA B-like structure (Arnott et al. (1974) Biochem. J. 141, 537). The B conformation of the helix and the absence of guanine appear to be the major determinants of the specificity of the fluorescent binding mode of the dye. Nonfluorescent interactions of the dye with polynucleotides are nonspecific; UV absorption and circular dichroic spectra demonstrate binding to synthetic single- and double-stranded DNA and RNA analogs, including those containing GC base pairs.     

Property of the M-DNA probed by a minor groove binding dye 4',6-diamidino-2-phenylindole

Spectral properties including circular and linear dichroism (CD and LD) of M-DNA, a molecular electric wire, formed at a high Zn(2+) concentration have been studied using a minor groove binding drug 4',6-diamidino-2-phenylindole (DAPI) as a probe. As the Zn(2+) concentration increased, the magnitude of LD in the DNA absorption region decreased at pH 8.5, implying the aggregation of DNA, which is in contrast with the retained LD magnitude at pH 7.0. As the M-DNA formed, change in the secondary structure of DNA was observed by CD spectrum, which resembles that of the C-form DNA, although overall structure seemed to remain as a right handed double helix. The DAPI-DNA complex in the presence of high concentration of Zn(2+) ions at pH 7.0 exhibited the similar CD spectrum with that in the absence of Zn(2+) ion, consisting of type I, II and III. In contrast, at pH 8.5 at a high Zn(2+) concentration in which DNA is in its M-form, DNA bound DAPI produced only the type III CD, suggesting that DAPI binds at the surface of M-DNA: the presence of Zn(2+) ions prevents the minor groove binding of DAPI.     

DNA mediated resonance energy transfer from 4',6-diamidino-2-phenylindole to [Ru(1,10-phenanthroline)2L]2+

The binding site of Delta- and Lambda-[Ru(phenanthroline)2L]2+ (L being phenanthroline (phen), dipyrido[3,2-a:2'3'-c]phenazine (DPPZ), and benzodipyrido[3,2-a:2'3'-c]phenazine (benzoDPPZ)), bound to poly[d(A-T)2] in the presence and absence of 4',6-diamidino-2-phenylindole (DAPI) was investigated by circular dichroism and fluorescence techniques. DAPI binds at the minor groove of poly[d(A-T)2] and blocks the groove. The circular dichroism spectrum of all Ru(II) complexes are essentially unaffected whether the minor groove of poly[d(A-T)2] is blocked by DAPI or not, indicating that the Ru(II) complexes are intercalated from the major groove. When DAPI and Ru(II) complexes simultaneously bound to poly[d(A-T)2], the fluorescence intensity of DAPI decreases upon increasing Ru(II) complex concentrations. The energy of DAPI at excited state transfers to Ru(II) complexes across the DNA via the F?rster type resonance energy transfer. The efficiency of the energy transfer is similar for both [Ru(phen)2DPPZ]2+ and [Ru(phen)2benzoDPPZ]2+ complexes, whereas that of [Ru(phen)3]2+ is significantly lower. The distance between DAPI and [Ru(phen)3]2+ is estimated as 0.38 and 0.64 F?rster distance, respectively, for the Delta- and Lambda-isomer.     

Influence of water chlorination on the counting of bacteria with DAPI (4',6-diamidino-2-phenylindole).

Counting bacteria in drinking water samples by the epifluorescence technique after 4',6-diamidino-2-phenylindole (DAPI) staining is complicated by the fact that bacterial fluorescence varies with exposure of the cells to sodium hypochlorite. An Escherichia coli laboratory-grown suspension treated with sodium hypochlorite (5 to 15 mg of chlorine liter-1) for 90 min was highly fluorescent after DAPI staining probably due to cell membrane permeation and better and DAPI diffusion. At chlorine concentrations greater than 25 mg liter-1, DAPI-stained bacteria had only a low fluorescence. Stronger chlorine doses altered the DNA structure, preventing the DAPI from complexing with the DNA. When calf thymus DNA was exposed to sodium hypochlorite (from 15 to 50 mg of chlorine liter-1 for 90 min), the DNA lost the ability to complex with DAPI. Exposure to monochloramine did not have a similar effect. Treatment of drinking water with sodium hypochlorite (about 0.5 mg of chlorine liter-1) caused a significant increase in the percentage of poorly fluorescent bacteria, from 5% in unchlorinated waters (40 samples), to 35 to 39% in chlorinated waters (40 samples). The presence of the poorly fluorescent bacteria could explain the underestimation of the real number of bacteria after DAPI staining. Microscopic counting of both poorly and highly fluorescent bacteria is essential under these conditions to obtain the total number of bacteria. A similar effect of chlorination on acridine orange-stained bacteria was observed in treated drinking waters. The presence of the poorly fluorescent bacteria after DAPI staining could be interpreted as a sign of dead cells.     

DNA-binding geometry dependent energy transfer from 4′,6-diamidino-2-phenylindole to cationic porphyrins

The circular and linear dichroism (CD and LD) spectral properties of the meso-tetrakis(N-methylpyridinium-4-yl)porphyrin (TMPyP)–DNA complex at a [porphyrin]/[DNA] ratio below 0.015 showed that TMPyP intercalates between DNA base pairs. Contrarily, when cis–bis(N-methylpyridinium-4-yl)porphyrin (BMPyP) is associated with DNA, no CD spectrum was induced and a bisignate LD spectrum was observed. These spectral properties of both the TMPyP and BMPyP were essentially retained when the minor groove of the DNA was saturated with 4′,6-diamidino-2-phenylindole (DAPI). The fluorescence of the DNA-bound DAPI was effectively quenched by BMPyP and TMPyP. The quenching by BMPyP can be described through a pure static mechanism while TMPyP quenching produced an upward bending curve in the Stern–Volmer plot. Quenching efficiency was by far greater than predicted by the “sphere of action model”, suggesting that the DNA provides some additional processes for an effective energy transfer.     

Rapid and simple method for double staining of bacteria with 4',6-diamidino-2-phenylindole and fluorescein isothiocyanate-labeled antibodies

Bacteria were either heat fixed on microscope slides or filtered with 0.2 micron-pore-size Nuclepore filters. The samples were stained with 4',6-diamidino-2-phenylindole (DAPI) for total staining and with polyvalent rabbit antibodies and fluorescein isothiocyanate-conjugated swine anti-rabbit antibodies for specific staining. By switching between two different optical filter packages in the microscope, only one sample was needed for determining both total and specific counts of bacteria. False-positive counts and other artifacts that occur with antibody staining were easily distinguished when individual fluorescent particles were checked for DAPI fluorescence. The method for applying the general stain to membrane filters was performed quickly and simply by using a DAPI-soaked polypropylene filter that lay beneath the Nuclepore filter which collected the sample.     

Mithramycin- and 4'-6-diamidino-2-phenylindole (DAPI)-DNA staining for fluorescence microspectrophotometric measurement of DNA in nuclei, plastids, and virus particles

The properties of two DNA-specific fluorochromes, 4'-6-diamidino-2-phenylindole (DAPI) and mithramycin, have been analyzed as reagents to quantitate cellular DNA by fluorescence microspectrophotometry. Optimal staining conditions and concentrations, and the effects of other cellular materials to which the dyes bind, have been evaluated in measurements of the DNA of rat, chick, and yeast nuclei, Gonyostomum chloroplasts, and T4 particles. Use of either fluorochrome permits a high degree of resolution of different DNA quantities in nuclei and in cell organelles, and the DAPI-DNA complex is sufficiently fluorescent to permit quantitation of the DNA content in genomes as small as those of individual T4 bacteriophage particles. Fluorescence of mithramycin- or DAPI-stained DNA is proportional to DNA quantity when DNA of the same has composition is compared. Quantitation does not appear to be affected discernably by the state of the DNA, whether in different stages of the cell cycle, in condensed chromosomes, or in noncycling, differentiated nuclei. The use of chicken red blood cells is recommended as an internal monitor for variations in staining conditions.     

Localization of polyphosphates in Saccharomyces fragilis, as revealed by 4′,6-diamidino-2-phenylindole fluorescence

The fluorescent dye 4′,6-diamidino-2-phenylindole has its emission maximum at 456 nm. Fluorescence intensity at this wavelength is significantly increased by various negatively-charged polyelectrolytes. Among several polyelectrolytes tested, polyphosphates appeared to be unique in the sense that they shifted the emission maximum from 456 to 526 nm. Addition of Saccharomyces fragilis cells to a diamidinophenylindole solution caused an immediate shift of the emission maximum to 526 nm, followed by a gradual increase of fluorescence at 456 nm. The 526 nm, but not the 456 nm fluorescence was instantly quenched by non-penetrating cations, like UO²⁺₂. These results suggest a momentary interaction of diamidinophenylindole with polyphosphate, localized outside the plasma membrane, followed by a slow penetration of the dye into the cells, yielding increased fluorescence at 456 nm by interaction of the dye with e.g., nucleic acids. This was confirmed by fluorescence microscopy. After addition of diamidinophenylindole the yeast cells exhibited an immediate green-yellow fluorescence of the membrane, that was suppressed by UO²⁺₂. After longer incubation times the cytoplasm and nucleus developed a blue fluorescence.     

Dual staining of natural bacterioplankton with 4',6-diamidino-2-phenylindole and fluorescent oligonucleotide probes targeting kingdom-level 16S rRNA sequences.

A method for quantifying eubacterial cell densities in dilute communities of small bacterioplankton is presented. Cells in water samples were stained with 4',6-diamidino-2-phenylindole (DAPI), transferred to gelatin-coated slides, and hybridized with rhodamine-labeled oligonucleotide probes specific for kingdom-level 16S rRNA sequences. Between 48 and 69% of the cells captured on membrane filters were transferred to gelatin-coated slides. The number of DAPI-stained cells that were visualized with eubacterial probes varied from 35 to 67%. Only 2 to 4% of these cells also fluoresced following hybridization with a probe designed to target a eukaryotic 16S rRNA sequence. Between 0.1 and 6% of the bacterioplankton in these samples were autofluorescent and may have been mistaken as cells that hybridized with fluorescent oligonucleotide probes. Dual staining allows precise estimates of the efficiency of transfers of cells to gelatin films and can be used to measure the percentage of the total bacterioplankton that also hybridize with fluorescent oligonucleotide probes, indicating specific phylogenetic groups.     

DNA binding properties of DAPI (4',6-diamidino-2-phenylindole) analogs having an imidazoline ring or a tetrahydropyrimidine ring: groove-binding and intercalation.

DAPI analogs containing an imidazoline ring or a tetrahydropyrimidine ring have been synthesized to study DNA binding properties. Spectroscopic (absorption, CD, flow dichroism and fluorescence) and viscosity measurements indicate that DAPI analogs interact with DNA both by intercalation and by groove binding. The solution structures of complexes between DAPI analog and DNA oligomers have been characterized by proton NMR spectroscopy.     

Dual staining of natural bacterioplankton with 4',6-diamidino-2-phenylindole and fluorescent oligonucleotide probes targeting kingdom-level 16S rRNA sequences.

A method for quantifying eubacterial cell densities in dilute communities of small bacterioplankton is presented. Cells in water samples were stained with 4',6-diamidino-2-phenylindole (DAPI), transferred to gelatin-coated slides, and hybridized with rhodamine-labeled oligonucleotide probes specific for kingdom-level 16S rRNA sequences. Between 48 and 69% of the cells captured on membrane filters were transferred to gelatin-coated slides. The number of DAPI-stained cells that were visualized with eubacterial probes varied from 35 to 67%. Only 2 to 4% of these cells also fluoresced following hybridization with a probe designed to target a eukaryotic 16S rRNA sequence. Between 0.1 and 6% of the bacterioplankton in these samples were autofluorescent and may have been mistaken as cells that hybridized with fluorescent oligonucleotide probes. Dual staining allows precise estimates of the efficiency of transfers of cells to gelatin films and can be used to measure the percentage of the total bacterioplankton that also hybridize with fluorescent oligonucleotide probes, indicating specific phylogenetic groups.     

Binding of netropsin and 4,6-diamidino-2-phenylindole to an A2T2 DNA hairpin: a comparison of biophysical techniques

Isothermal titration calorimetry (ITC), differential scanning calorimetry (DSC), and biosensor-surface plasmon resonance (SPR) are evaluated for their accuracy in determining equilibrium constants, ease of use, and range of application. Systems chosen for comparison of the three techniques were the formation of complexes between two minor groove binding compounds, netropsin and 4,6-diamidino-2-phenylindole (DAPI), and a DNA hairpin having the sequence 5'-d(CGAATTCGTCTCCGAATTCG)-3'. These systems were chosen for their structural differences, simplicity (1:1 binding), and binding affinity in the range of interest (K approximately 10(8) M(-1)). The binding affinities determined from all three techniques were in excellent agreement; for example, netropsin/DNA formation constants were determined to be K = 1.7x10(8) M(-1) (ITC), K = 2.4x10(8) M(-1) (DSC), and K = 2.9x10(8) M(-1) (SPR). DSC and SPR techniques have an advantage over ITC in studies of ligands that bind with affinities greater than 10(8) M(-1). The ITC technique has the advantage of determining a full set of thermodynamic parameters, including deltaH, TdeltaS, and deltaC(p) in addition to deltaG (or K). The ITC data revealed complex binding behavior in these minor groove binding systems not detected in the other methods. All three techniques provide accurate estimates of binding affinity, and each has unique benefits for drug binding studies.     

Cytometry and flow cytometry of 4',6-diamidino-2-phenylindole (DAPI)-stained suspensions of nuclei released from fresh and fixed tissues of plants

Cytometry and flow cytometry were used to study characteristics of fluorescence of the DNA-DAPI complex in nuclei released from different fresh and formaldehyde-fixed pea ( Pisum sativum L. cv. Lincoln) tissues. The two methods of isolation are compared and discussed as well as their possible use for quantitative analysis of DNA in plant tissues. With fixed tissues it is possible to obtain a number of nuclei sufficient for the flow cytometric analysis, even using small amounts of plant tissue.     

Localization of DNA in Mature and Young Wheat Chloroplasts Using the Fluorescent Probe 4'-6-Diamidino-2-phenylindole

The spatial organization of chloroplast DNA in developing and dividing wheat chloroplasts was studied in the light microscope using the fluorescent probe 4′-6-diamidino-2-phenylindole, which binds specifically to DNA.     

Phosphorescence and optically detected magnetic resonance of 4',6-diamidino-2-phenylindole (DAPI) and its complexes with [d(CGACGTCG)]2 and [d(GGCCAATTGG)]2

Phosphorescence and optical detection of magnetic resonance (ODMR) is used to study the excited triplet state of 4',6-diamidino-2-phenyl indole (DAPI) and its complexes with the oligonucleotides [d(CGACGTCG)](2) and [d(GGCCAATTGG)](2), where binding occurs by intercalation between GC base pairs and by minor groove insertion, respectively. Weaker binding of DAPI to phosphate is also detected, and the triplet state of this complex is characterized. Intercalation with [d(CGACGTCG)](2) produces a phosphorescence redshift, while groove binding with [d(GGCCAATTGG)](2) leads to a blueshift. Both binding modes give rise to a small decrease in the zero-field splitting (zfs) of the DAPI triplet state. The largest redshift and zfs decrease are found for the phosphate complex. The phosphorescence lifetimes are shorter by an order of magnitude than that of indole or tryptophan as expected for the lower triplet state energy, E(00), of DAPI. The lifetimes agree well with a correlation with E(00) introduced by Siebrand [Siebrand, W. (1966) J. Chem. Phys. 44, 4055-4057] except for the [d(GGCCAATTGG)](2) minor groove complex with a lifetime that is about 20% too long. The longer lifetime is attributed to distortion of the amidino groups in this complex, resulting in less efficient intersystem crossing.     

Determination of abundance and biovolume of bacteria in sediments by dual staining with 4',6-diamidino-2-phenylindole and acridine orange: relationship to dispersion treatment and sediment characteristics.

We measured the abundance and biovolume of bacteria in intertidal sediments from Tokyo Bay, Japan, by using a dual-staining technique (4',6-diamidino-2-phenylindole and acridine orange) and several dispersion techniques (ultrasonic cleaner, ultrasonic sonicator, and tissue homogenizer). Dual staining reduced serious background fluorescence, particularly when used for silt-, clay-, and detritus-rich sediments, and allowed us to distinguish bacteria from other objects during both counting and sizing. Within the studied samples, the number of bacterial cells ranged from 0.20 x 10(9) to 3. 54 x 10(9) g of wet sediment(-1). With the cleaner and sonicator treatments, the bacterial numbers for all of the sites initially increased with dispersion time and then became constant. For the homogenizer treatments, the highest bacterial numbers were observed with the shortest (0.5- to 2-min) treatments, and the counts then declined steeply as the homogenization time increased, indicating that cell destruction occurred. The cleaner treatment had the possibility of insufficient dispersion of bacteria for fine-grain sediments. Within the studied samples, the bacterial biovolume ranged from 0.07 to 0.22 microm(3). With the cleaner and sonicator treatments, the biovolume peaked during the shorter dispersion time. This pattern was caused not by cell destruction but by the incremental portion of dispersed small cells. We concluded that with the cleaner and sonicator treatments, the longer dispersion time reflected the real size spectrum and was preferable for accurate estimation of mean bacterial biovolumes.     

Associations between a fluorescent DNA ligand, 4',6-diamidine-2-phenylindole.2HCl (DAPI), and RNA

The experiments performed in vitro have shown that DAPI and RNA form insoluble and indigestible complexes. This seems to explain the earlier observed retardation of drug accumulation in the nucleus of a living cell in the presence of RNA.