Isolation of Z-DNA binding proteins from SV40 minichromosomes: evidence for binding to the viral control region

Proteins dissociated from SV40 minichromosomes by increasing NaCl concentration were tested for their binding to Z-DNA [Br-poly(dG-dC)] and B-DNA [poly (dG-dC)]. Z-DNA binding proteins are largely released in 0.2 M NaCl whereas most B-DNA binding proteins are not released until 0.6 M NaCl. Incubation of SV40 minichromosomes with Z-DNA-Sephadex in low salt solution results in proteins with Z-DNA binding activity (PZ proteins). These proteins bind to negatively supercoiled DNAs containing left-handed Z-DNA but not to relaxed DNAs. They compete with anti-Z-DNA antibodies in binding to negatively supercoiled DNAs. The binding is tighter to negatively supercoiled SV40 DNA than to other plasmids, suggesting sequence-specific Z-DNA binding. PZ proteins binding to negatively supercoiled SV40 DNA interfere with cleavage at the Sph I sites, within the 72 bp repeat sequences of the viral control region, but not with cleavage at the Bgl I site, at the origin of replication. Removal of PZ proteins also exposes the Sph I sites in the SV40 minichromosomes while addition of PZ proteins makes the sites inaccessible.     

Cytosine methylation enhances Z-DNA formation in vivo.

The influence of cytosine methylation on the supercoil-stabilized B-Z equilibrium in Escherichia coli was analyzed by two independent assays. Both the M.EcoRI inhibition assay and the linking-number assay have been used previously to establish that dC-dG segments of sufficient lengths can exist as left-handed helices in vivo. A series of dC-dG plasmid inserts with Z-form potential, ranging in length from 14 to 74 base pairs, was investigated. Complete methylation of cytosine at all HhaI sites, including the inserts, was obtained by coexpression of the HhaI methyltransferase (M.HhaI) in cells also carrying a dC-dG-containing plasmid. Both assays showed that for all lengths of dC-dG inserts, the relative amounts of B and Z helices were shifted to more Z-DNA in the presence of M.HhaI than in the absence of M.HhaI. These results indicate that cytosine methylation enhances the formation of Z-DNA helices at the superhelix density present in E. coli. The B-Z equilibrium, in combination with site-specific base methylation, may constitute a concerted mechanism for the modulation of DNA topology and DNA-protein interactions.     

The effect of anti-Z-DNA antibodies on the B-DNA-Z-DNA equilibrium

Four different preparations of rabbit and goat anti-Z-DNA antibodies were examined to determine the effects of antibody binding on the B-DNA-Z-DNA equilibrium. One of the four antibodies, a goat IgG, caused a marked lowering in the ionic strength required for the B-DNA to Z-DNA transition in poly(dG-dC) X poly(dG-dC), shifting the midpoint from 2.25 to 2.0 M NaCl. This IgG had a more prominent high affinity antibody population than did the other goat IgG, which caused little change in the midpoint of this transition. The presence of anti-Z-DNA antibodies also reduced the degree of negative supercoiling required for the formation of Z-DNA in (dG-dC)n sequences inserted into closed circular plasmid DNA. The goat IgG with the more marked effect on the salt-induced transition also had a greater effect in favoring Z-DNA formation in negatively supercoiled plasmids. A shift toward Z-DNA formation was observed in circular dichroism measurements upon antibody binding to poly(dG-dC) X poly(dG-dC) in very low ionic strength solution as well. We propose that the stabilization of Z-DNA by antibody binding in poly(dG-dC) X poly(dG-dC) occurs cooperatively, several antibody molecules binding to a single polymer molecule and stabilizing the entire molecule in Z-DNA through their combined binding energies. The stabilization of Z-DNA by antibody binding in a supercoiled plasmid can be significant, and failure to consider this effect and to choose appropriate conditions for measurement can lead to errors in estimating when Z-DNA will form in response to negative supercoiling.     

Effects of 5 cytosine methylation on the B-Z transition in DNA restriction fragments and recombinant plasmids

Alternating (dC-dG)n regions in DNA restriction fragments and recombinant plasmids were methylated at the 5 position of the cytosine residues by the HhaI methylase. Methylation lowers the concentration of NaCl or MgCl2 necessary to cause the B-Z conformational transition in these sequences. Ionic strengths higher than physiological conditions are required to form the Z conformation when the methylated (dC-dG)n tract is contiguous with regions that do not form Z structures, in contrast to the results with the DNA polymer poly(m5dC-dG) . poly(m5dC-dG). In supercoiled plasmids containing (dC-dG)n sequences, methylation reduces the number of negative supercoils necessary to stabilize the Z conformation. Calculations of the observed free energy contributions of the B-Z junction and cytosine methylation suggest that two junctions offset the favorable effect of methylation on the Z conformation in (dC-dG)n sequences (about 29 base-pairs in length). Studies with individual methylated topoisomers demonstrate that increasing Na+ concentration up to approximately 0.2 M inhibits the formation of the Z conformation in the (m5dC-dG)n region of supercoiled plasmids. The results suggest that methylation may serve as a triggering mechanism for Z DNA formation in supercoiled DNAs.     

Isolation and characterization of Z-DNA binding proteins from wheat germ

The preparation of a heterogeneous non-histone protein extract from wheat germ utilizing Br-poly(dG-dC).poly(dG-dC) (Z-DNA) affinity chromatography is described. The binding characteristics of antibodies against Z-DNA are used as a model system to define important criteria that the DNA binding behavior of a Z-DNA binding protein should display. We show that the wheat germ extract contains DNA binding proteins specific for left-handed Z-DNA by these criteria. The affinity of the proteins measured by competition experiments was approximately 10(5) greater for Br-poly(dG-dC).poly(dG-dC) (Z-DNA) than for poly(dG-dC).poly(dG-dC) (B-DNA). The affinity of the proteins for plasmid DNA increases with increasing negative superhelicity which is known to stabilize Z-DNA. The proteins are shown to compete with Z-DNA antibodies for binding to supercoiled plasmids. Finally, the affinity for two plasmids at a given superhelical density is greater for the plasmid containing an insert known to form Z-DNA than for a plasmid without the insert. The proteins exhibit a 2-3-fold greater affinity for stretches of (dC-dA)n.(dT-dG)n over stretches of (dG-dC)n.(dG-dC)n when both sequences are induced to form Z-DNA by supercoiling.     

Topoisomerase mutants and physiological conditions control supercoiling and Z-DNA formation in vivo.

The influence of topoisomerase I and gyrase mutations in Escherichia coli on the supercoiled density of recombinant plasmids and the stability of left-handed Z-DNA was investigated. The formation of Z-DNA in vivo by dC-dG sequences of different lengths was used to determine the effective plasmid supercoil densities in the mutant strains. The presence of Z-DNA in the cells was detected by linking number and EcoRI methylase inhibition assays. A change in the unrestrained superhelical tension in vivo directly effects the B- to Z-DNA transition. Alterations in the internal or external environment of the cells, such as the inactivation of gyrase or topoisomerase I, a gyrase temperature-sensitive mutant, or starvation of cells, have a dramatic influence on the topology of plasmids. Also, E. coli has significantly more superhelical strain than Klebsiella, Morganella, or Enterobacter. These studies indicate that linking deficiency and effective supercoil density are mutually independent variables of plasmid tertiary structure. A variety of factors, such as protein-DNA interactions, activity of topoisomerases, and the resulting supercoil density, contribute to the B to Z transition inside living cells.     

Chemical footprinting of the interaction between left-handed Z-DNA and anti-Z-DNA antibodies by diethylpyrocarbonate carbethoxylation

Diethylpyrocarbonate (DEPC) carbethoxylates Z-DNA to an increased extent because the reactive N-7 atoms of purine residues appear structurally more accessible on Z-DNA as opposed to B-DNA. This chemical probe was used in DEPC footprinting experiments, which confirm the specificity of binding of anti-Z-DNA monoclonal antibodies and which probe regions of close contact in this DNA-protein complex. Antibody binding to segments of Z-DNA existing in supercoiled plasmids resulted in specific protection from DEPC hyper-reactivity within the Z-DNA segment and induction of hyper-reactivity in purines lying adjacent to the Z-segment. Two different monoclonal immunoglobulin preparations, Z22 and Z44, are shown to generate specific and distinct footprint patterns when bound to the Z-helix. Binding of these antibodies was also found to affect DNA conformation within the Z-DNA segment by influencing the equilibrium between the B- and Z-helical conformations.     

Chemical probes of DNA conformation: detection of Z-DNA at nucleotide resolution

Chemical probes sensitive to alterations in DNA conformation, especially Z-DNA, have been identified. These permit cleavage of DNA at sites of unusual structure, the results of which can be displayed on a sequencing gel. Using supercoiled plasmids containing inserts of d(C-G)16 and d(C-A)31 X d(T-G)31, it was found that hydroxylamine and osmium tetraoxide react preferentially with cytosines and thymines, respectively, near B-DNA-Z-DNA junctions; diethylpyrocarbonate reacts more strongly with purines within Z-DNA regions; and dimethylsulfate and diethylsulfate react more strongly with guanines in Z-DNA that are out of phase with the usual pattern of purine-pyrimidine alternation. Our results show that B-Z boundaries are mobile and that with increasing torsional strain, the Z-DNA regions can expand to include nonalternating nucleotide sequences.     

Reduced 4,5',8-trimethylpsoralen cross-linking of left-handed Z-DNA stabilized by DNA supercoiling

Z-DNA-forming sequences, (GT)21, (GT)12ATGT, and (CG)6TA(CG)6, were cloned into plasmids. These sequences formed left-handed Z-DNA conformations under torsional tension from negative supercoiling of DNA. 4,5',8-Trimethylpsoralen, on absorption of 360-nm light, forms monoadducts and interstrand cross-links in DNA that exists in the B-helical conformation. Trimethylpsoralen cross-links were introduced into the potential Z-DNA-forming sequences in relaxed DNA when these sequences existed as B-form DNA. In supercoiled DNA when these sequences existed in the Z conformation, the rate of cross-linking was greatly reduced, and trimethylpsoralen did not form monoadducts appreciably to Z-DNA. As an internal control in these experiments, the rates of cross-linking of the Z-DNA-forming sequences were measured relative to that of an adjacent, cloned sequence that could not adopt a Z conformation. The initial relative rates of cross-linking to Z-DNA-forming sequences were dependent on the superhelical density of the DNA, and the rates were ultimately reduced by factors of 10-15 for Z-DNA in highly supercoiled plasmids. This differential rate of cross-linking provides a novel assay for Z-DNA. Initial application of this assay in vivo suggests that a substantial fraction of (CG)6TA(CG)6, which existed as Z-DNA in plasmid molecules purified from cells, existed in the B conformation in vivo.     

The interaction between Z-DNA and the Zab domain of double-stranded RNA adenosine deaminase characterized using fusion nucleases.

Zab is a structurally defined protein domain that binds specifically to DNA in the Z conformation. It consists of amino acids 133-368 from the N terminus of human double-stranded RNA adenosine deaminase, which is implicated in RNA editing. Zab contains two motifs with related sequence, Zalpha and Zbeta. Zalpha alone is capable of binding Z-DNA with high affinity, whereas Zbeta alone has little DNA binding activity. Instead, Zbeta modulates Zalpha binding, resulting in increased sequence specificity for alternating (dCdG)n as compared with (dCdA/dTdG)n. This relative specificity has previously been demonstrated with short oligonucleotides. Here we demonstrate that Zab can also bind tightly to (dCdG)n stabilized in the Z form in supercoiled plasmids. Binding was assayed by monitoring cleavage of the plasmids using fusion nucleases, in which Z-DNA-binding peptides from the N terminus of double-stranded RNA adenosine deaminase are linked to the nuclease domain of FokI. A fusion nuclease containing Zalpha shows less sequence specificity, as well as less conformation specificity, than one containing Zab. Further, a construct in which Zbeta has been replaced in Zab with Zalpha, cleaves Z-DNA regions in supercoiled plasmids more efficiently than the wild type but with little sequence specificity. We conclude that in the Zab domain, both Zalpha and Zbeta contact DNA. Zalpha contributes contacts that produce conformation specificity but not sequence specificity. In contrast, Zbeta contributes weakly to binding affinity but discriminates between sequences of Z-DNAs.     

Potassium permanganate as an in situ probe for B-Z and Z-Z junctions.

The availability of DNA structural probes that can be applied to living cells is essential for the analysis of biological functions of unusual DNA structures adopted in vivo. We have developed a chemical probe assay to detect and quantitate left-handed Z-DNA structures in recombinant plasmids in growing E. coli cells. Potassium permanganate selectively reacts with B-Z or Z-Z junction regions in supercoiled plasmids harbored in the cells. Restriction enzyme recognition sites located at these junctions are not cleaved by the corresponding endonuclease after modification with KMnO4. This inhibition of cleavage allows the determination of the relative amounts of B- and Z-forms of the cloned inserts inside the cell. We have successfully applied this method to monitor the extent of Z-DNA formation in E. coli as a function of the growth phase and mutated topoisomerase or gyrase activities. The assay can in principle be used for any unusual DNA structure that contains a restriction recognition site inside or near the structural alteration. It can be a useful tool to analyze in vivo correlations between DNA structure and gene regulatory events.     

Sequences near the origin of replication of the DHFR locus of Chinese hamster ovary cells adopt left-handed Z-DNA and triplex structures

The earliest replicating portion of the Chinese hamster dihydrofolate reductase domain contains a cluster of simple repeated sequences 180 base pairs long composed of 5'-(GC)5(AC)18(AG)21(G)9(CAGA)4GAGGGAGAGAGGCAGAGAGGG(AG)27-3 '. Previous nuclease sensitivity and intermolecular hybridization studies suggested that the two long (AG) repeats in this tract formed intramolecular DNA triplexes in negatively supercoiled plasmids at pH 5.2 (Caddle, M. S., Lussier, R. L., and Heintz, N. H. (1990) J. Mol. Biol. 211, 19-33). To further characterize the structural organization, supercoiled plasmids containing this region were analyzed in vitro with OsO4 and diethyl pyrocarbonate probes as well as with two-dimensional gel electrophoresis under different conditions. In pMCG, which contains the sequence in a 1.6-kilobase pair insert, the preferred conformation at neutral pH and at the native superhelical density is a Z-DNA structure for the (GC)5(AC)18 tract. Under mildly acidic conditions and at the native superhelical density, both (AG) tracts form intramolecular triplexes to the exclusion of the Z-DNA structure. Chemical probing of topoisomers of pMCG indicates that the (AG)27 tract forms a triplex more readily than the (AG)21 motif. Also, analysis of the reactivity obtained on a larger plasmid, pMCD, which contains the cluster of repeated sequences in a 4.75-kilobase pair insert, shows that at the native superhelical density the formation of intramolecular triplexes is limited to the (AG)27 tract. Finally, experiments conducted on different populations of topoisomers of pMCG show the existence, at pH 5.0 and highly negative superhelical density (greater than or equal to 0.080), of both the left-handed and the two triple-stranded structures in the same DNA. Therefore, one triplex is located immediately adjacent to the Z helix. Companion studies revealed that this region of the DHFR replicon modulates fork translocation during the replication of recombinant plasmids in mammalian cells.     

Searching for potential Z-DNA in genomic Escherichia coli DNA

The Clarke-Carbon library with Escherichia coli DNA cloned into plasmid ColE1 was partially screened for Z-DNA with the monoclonal antibody Z-D11 using the retardation of the covalently closed circular DNA-protein complex by nitrocellulose filters. About 85% of the plasmids tested at "natural" supercoil density bound to the filter. Together with binding studies of the iodinated antibody, one Z-DNA segment per about 18,000 base-pairs of E. coli DNA is observed. One clone containing the region around the lactose operon, pLC20-30, was studied in detail. Subcloning a partial Sau3A digest and selection with antibodies gave three different Z-forming sites. They were mapped to within about +/- 20 base-pairs by preparing unidirectional deletion clones, selection of protein binding plasmids on nitrocellulose filters and subsequent sizing on agarose gels. The size of the Z-DNA-forming segments was estimated from two-dimensional gels of topoisomer mixtures. Together with results from sequencing of the plasmid DNA using exonuclease III to create single-stranded templates, stretches of alternating purine-pyrimidine tracts of 12 to 15 base-pairs were found to be responsible for Z-DNA formation. One of the sites was found in the middle of the lacZ gene, where it might be an obstacle for RNA polymerase. The methods used here should also be helpful for studying other DNA-protein sites, especially if they exist only in supercoiled DNA.     

Competing B-Z and helix-coil conformational transitions in supercoiled plasmid DNA.

The formation of melted regions from A + T-rich sequences and left-handed Z-DNA by alternating purine-pyrimidine sequences will both be facilitated by negative supercoiling, and thus if the sequences are present within the same plasmid molecule they will compete for the free energy of supercoiling. We have studied a series of plasmids that contain either (CG)8 or (TG)12 sequences in either G + C or A + T-rich contexts, by means of two-dimensional gel electrophoresis and chemical modification. We observe both B-Z and helix-coil transitions in all plasmids at elevated temperatures and low ionic strength. The plasmids fall into a number of different classes, in terms of the conformational behavior. As the superhelix density is increased, pCG8/vec ((CG)8 in G + C-rich context) undergoes an initial B-Z transition, followed by melting transitions in sequences remote from the (CG)8 sequence. The two transitions are coupled through the topology of the molecule but are otherwise independent. When the (CG)8 sequence was placed in an A + T-rich context (pCG8/col), the helix-coil transition was perturbed by the presence of the Z-DNA segment. Replacement of the (CG)8 tracts by (TG)12 sequences resulted in a further level of interaction between the transitions. Statistical mechanical modeling of the transitions suggested that at intermediate levels of negative supercoiling the Z-DNA formed by the (TG)12 sequence has a lowered probability due to the helix-coil transition in the A + T-rich sequences. These studies illustrate the complexities of competing conformational equilibria in supercoiled DNA molecules.     

The Zalpha domain from human ADAR1 binds to the Z-DNA conformer of many different sequences.

Z-DNA, the left-handed conformer of DNA, is stabilized by the negative supercoiling generated during the movement of an RNA polymerase through a gene. Recently, we have shown that the editing enzyme ADAR1 (double-stranded RNA adenosine deaminase, type 1) has two Z-DNA binding motifs, Zalpha and Zbeta, the function of which is currently unknown. Here we show that a peptide containing the Zalpha motif binds with high affinity to Z-DNA as a dimer, that the binding site is no larger than 6 bp and that the Zalpha domain can flip a range of sequences, including d(TA)3, into the Z-DNAconformation. Evidence is also presented to show that Zalpha and Zbeta interact to form a functional DNA binding site. Studies with atomic force microscopy reveal that binding of Zalpha to supercoiled plasmids is associated with relaxation of the plasmid. Pronounced kinking of DNA is observed, and appears to be induced by binding of Zalpha. The results reported here support a model where the Z-DNA binding motifs target ADAR1 to regions of negative supercoiling in actively transcribing genes. In this situation, binding by Zalpha would be dependent upon the local level of negative superhelicity rather than the presence of any particular sequence.     

The inhibition of restriction endonucleases due to Z-DNA in negatively supercoiled plasmid.

Plasmid pGC20 containing the (dGC)9 insert in SmaI recognition site has been used to study the inhibition of cleavage by different restriction endonuclease due to Z-DNA formation in (dCG)10 sequence of the negatively supercoiled plasmid. Data obtained indicate the different sensitivity of restriction endonucleases to DNA conformational perturbations resulted from the Z-DNA formation. Therefore, the inhibition of DNA cleavage by a particular restriction endonuclease cannot serve as a criterion for the estimation of the length of B-Z junctions in circular supercoiled DNAs.     

Diepoxybutane forms a monoadduct with B-form (dG-dC)n.(dG-dC)n and a crosslinked diadduct with the left-handed Z-form.

The characteristics of the reactions of DL-diepoxybutane (DEB) with (dG-dC)n.(dG-dC)n in the right-handed B-form or the left-handed Z-form were investigated. DEB does react with right-handed B-DNA since less salt is required to convert the modified B-form to Z-form than for the unmodified DNA. However, the product appears to be a monoadduct rather than the crosslinked diadduct formed with the Z-form. The modified B-form can be isolated, converted to a Z-form with l mM MnCl2, and then this activated complex further reacts intramolecularly to give the crosslinked Z-product. This modified Z-form cannot be reverted to the B-form unless the crosslink is cleaved with periodate. Only MnCl2, and to a lesser extent ZnCl2, was effective in facilitating the intramolecular conversion of the B-DNA monoadduct to the Z-DNA diadduct; lmM MgCl2 and 4M NaCl were ineffective suggesting that somewhat different types of modified left-handed conformations were generated by the different salts. DEB also cleaves DNA under our reaction conditions thus precluding studies with supercoiled recombinant plasmids harboring segments that adopt Z-structures.     

Analysis of Z-DNA in fixed polytene chromosomes with monoclonal antibodies that show base sequence-dependent selectivity in reactions with supercoiled plasmids and polynucleotides

Five monoclonal anti-Z-DNA antibodies were characterized with respect to their binding of synthetic nucleic acid polymers and of supercoiled circular plasmid DNA. All of the antibodies reacted only with DNA in the Z-conformation; however, they fell into two classes on the basis of sequence specificity. One class, with broad specificity, reacted well with all sequences in the Z-form, including poly(dG-dC), poly(dG-dm5C), and poly (dG-dBr5C) in linear polymers and poly(dG-dC)n and poly[(dC-dA)n.(dT-dG)n] sequences in supercoiled plasmids. The other class bound only Z-DNA formed by poly(dG-dC). Binding of the monoclonal antibodies specifically to inserts of Z-DNA-forming sequences in plasmids was mapped directly by cross-linking of antibody to the DNA, digestion with restriction nuclease, and electrophoretic analysis of both the unbound fragments and the bound fragments recovered from immune complexes. The monoclonal antibodies were used for indirect immunofluorescence staining of Drosophila polytene chromosomes fixed by two procedures. One procedure yielded chromosomes with Z-specific antibody binding in many interbands, a few specific bands, and parts of some puffs. On chromosomes fixed by the second procedure, antibody staining appeared to follow the DNA concentration, staining all bands brightly. For each fixation procedure, chromosomes showed the same staining pattern with each of the broad specificity monoclonal antibodies that had been seen with polyclonal antibodies. The antibodies that reacted only with poly(dG-dC) and poly (dG-dC)n plasmid inserts did not stain chromosomes fixed by either protocol. We conclude that stretches of poly(dG-dC)n sequences do not contribute significantly to the presence of Z-DNA in fixed polytene chromosomes of Drosophila melanogaster.