Sequence of the 3''-terminal 21 nucleotides of yeast 17S ribosomal RNA.

The sequence of the 3'-terminal 21 nucleotides of 17S ribosomal RNA from the yeast Saccharomyces carlsbergensis has been determined to be (Y)G-m62A-m62A-C-U-C-G-C-G-G-A-A-G-G-A-U-C-A-U-U-AOH. This sequence shows extensive homology with the 3'-terminal sequence of 16S rRNA from Escherichia coli including the presence of the two adjacent N6-,N6-dimethyladenosines observed in the small subunit rRNA of eukaryotes as well as of many prokaryotes.     

Nucleotide sequence of the 3''-terminal region of rat 18S ribosomal DNA

Summary The 3-terminal 230 base-pairs (bp) of the gene for 18S rRNA and 40 bp of the adjoining spacer have been sequenced for the Sprague-Dawley rat. This mammalian sequence has been compared with the known sequences of yeast, fruit fly, silkworm, and frog. This study has shown that the nucleotide-sequence differences between rat and frog are the smallest among the five species, probably reflecting their evolutionary closeness and longer maturation time compared to the others. There is little similarity in the nucleotide sequences of the transcribed spacer regions of the five species compared.     

Interaction of unfolded tRNA with the 3''-terminal region of E. coli 16S ribosomal RNA.

Fragments of tRNA possessing a free TpsiC-loop or a free D-loop form stable complexes with the colicin fragment (1494-1542) of 16S ribosomal RNA from E. coli. The colicin fragment does not bind to tRNA in which the T-loop and the D-loop are involved in tertiary interactions. Colicin cleavage of the 16S rRNA from E. coli is inhibited by aminoacyl-tRNA or tRNA fragments, indicating that a similar interaction may take place on the intact 70S ribosomes. The oligonucleotide d(G-T-T-C-G-A)homologous to the conserved sequence G-T-psi-C-Pu-(m1)A in the TpsiC-region of many elongator tRNAs binds to the conserved sequence U-C-G-mU-A-A-C (1495-1501) of the 16S rRNA. It is suggested that the 3'-end of the 16S rRNA may provide the part of the binding site for the elongator tRNAs on bacterial ribosomes.     

The topography of the 3''-terminal region of Escherichia coli 16S ribosomal RNA; an intra-RNA cross-linking study.

30S ribosomal subunits, 70S ribosomes or polysomes from E. coli were subjected to mild ultraviolet irradiation, and the 3'-terminal region of the 16S RNA was excised by 'addressed cleavage' using ribonuclease H in the presence of suitable complementary oligodeoxynucleotides. RNA fragments from this region containing intra-RNA cross-links were separated by two-dimensional gel electrophoresis and the cross-link sites identified by our standard procedures. Five new cross-links were found in the 30S subunit, which were localized at positions 1393-1401 linked to 1531-1532, 1393-1401 linked to 1506, 1393-1401 to 1502-1504, 1402-1403 to 1498-1501, and 1432 to 1465-69, respectively. In 70S ribosomes or polysomes the first four of these were absent, but instead two cross-links between the 1400-region and tRNA were observed. These results are discussed in the context of the tertiary folding of the 3'-terminal region of the 16S RNA and its known functional significance as part of the ribosomal decoding centre.     

The 3''-terminal region of bacterial 23S ribosomal RNA: structure and homology with the 3''-terminal region of eukaryotic 28S rRNA and with chloroplast 4.5s rRNA.

The sequence of the 110 nucleotide fragment located at the 3'-end of E.coli, P.vulgaris and A.punctata 23S rRNAs has been determined. The homology between the E.coli and P.vulgaris fragments is 90%, whereas that between the E.coli and A.punctate fragments is only 60%. The three rRNA fragments have sequences compatible with a secondary structure consisting of two hairpins. Using chemical and enzymatic methods recently developed for the study of the secondary structure of RNA, we demonstrated that one of these hairpins and part of the other are actually present in the three 3'-terminal fragments in solution. This supports the existence of these two hairpins in the intact molecule. Indeed, results obtained upon limited digestion of intact 23S RNA with T1 RNase were in good agreement with the existence of these two hairpins. We observed that the primary structures of the 3'-terminal regions of yeast 26S rRNA and X.laevis 28S rRNA are both compatible with a secondary structure similar to that found at the 3'-end of bacterial 23S rRNAs. Furthermore, both tobacco and wheat chloroplast 4.5S rRNAs can also be folded in a similar way as the 3'-terminal region of bacterial 23S rRNA, the 3'-end of chloroplast 4.5S rRNAs being complementary to the 5'-end of chloroplast 23S rRNA. This strongly reinforces the hypothesis that chloroplast 4.5S rRNA originates from the 3'-end of bacterial 23S rRNA and suggests that this rRNA may be base-paired with the 5'-end of chloroplast 23S rRNA. Invariant oligonucleotides are present at identical positions in the homologous secondary structures of E.coli 23S, yeast 26S, X.laevis 28S and wheat and tobacco 4.5S rRNAs. Surprisingly, the sequences of these oligonucleotides are not all conserved in the 3'-terminal regions of A.punctata or even P.vulgaris 23S rRNAs. Results obtained upon mild methylation of E.coli 50S subunits with dimethylsulfate strongly suggest that these invariant oligonucleotides are involved in RNA tertiary structure or in RNA-protein interactions.     

Human 28S ribosomal RNA sequence heterogeneity.

DNA sequencing of several cloned human 28S ribosomal RNA gene fragments has revealed sequence heterogeneity (1) but it was not clear whether these are inactive pseudogenes or are active genes that are transcribed and represented in ribosomes. S1 nuclease analysis allowed us to examine the population of ribosomal RNA molecules of a cell, and we found that 28S rRNA is a heterogeneous assortment of molecules in both mono- and polysomal preparations. Sequence variation, although largely concentrated in variable regions of the molecule, apparently also occurs in the conserved regions.     

3'-Terminal sequence of wheat mitochondrial 18S ribosomal RNA: further evidence of a eubacterial evolutionary origin.

We have determined the sequences of the 3'-terminal approximately 100 nucleotides of [5' -32P]pCp-labeled wheat mitochondrial, wheat cytosol, and E. coli small sub-unit rRNAs. Sequence comparison demonstrates that within this region, there is a substantially greater degree of homology between wheat mitochondrial 18S and E. coli 16S rRNAs than between either of these and wheat cytosol 18S rRNA. Moreover, at a position occupied by 3-methyluridine in E. coli 16S rRNA, the same (or a very similar) modified nucleoside is present in wheat mitochondrial 18S rRNA but not in wheat cytosol 18S rRNA. Further, E. coli 16S and 23S rRNAs hybridize extensively to wheat mitochondrial 18S and 26S rRNA genes, respectively, but wheat cytosol 18S and 26S rRNAs do not. No other mitochondrial system studies to date has provided comparable evidence that a mitochondrial rRNA is more closely related to its eubacterial homolog than is its counterpart in the cytoplasmic compartment of the same cell. The results reported here provide additional support for the view that plant mitochondria are of endosymbiotic, specifically eubacterial, origin.     

Inserted sequence in the mitochondrial 23S ribosomal RNA gene of the yeast Saccharomyces cerevisiae.

Summary The sequence organization of the yeast mit-DNA region carrying the large ribosomal RNA gene and the polar locus was examined. Hybridization studies using rho^- deletion mutants and electron microscopy of the heteroduplexes formed between 23S rRNA and the appropriate restriction fragments, lead to the conclusion that the 23S rRNA¹ gene of the ⁺ strains is split by an insertion sequence of 1,000–1,100 bp. In contrast, no detactable insertion was found in the 23S rRNA gene of the ^- strains. The size and the location of the insert found in the 23S rRNA gene of the ⁺ strains appear to be identical to those of the sequence which had previously been found to characterize the difference (at the locus) between the mitDNA of the wild type strains carrying the ⁺ or ^- alleles (Jacq et al., 1977).     

The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria.     

The nucleotide sequence of 4.5S ribosomal RNA from tobacco chloroplasts.

The nucleotide sequence of tobacco chloroplast 4.5S ribosomal RNA has been determined to be: OHG-A-A-G-G-U-C-A-C-G-G-C-G-A-G-A-C-G-A-G-C-C-G-U-U-U-A-U-C-A-U-U-A-C-G-A-U-A-G-G-U-G-U-C-A-A-G-U-G-G-A-A-G-U-G-C-A-G-U-G-A-U-G-U-A-U-G-C-(G-A)-C-U-G-A-G-G-C-A-U-C-C-U-A-A-C-A-G-A-C-C-G-G-U-A-G-A-C-U-U-G-A-A-COH. The 4.5S RNA is 103 nucleotides long and its 5'-terminus is not phosphorylated.     

Nucleotide sequence study of mouse 5.8S ribosomal RNA.

The primary structure of 5.8S mouse ribosomal RNA has been studied and compared to the structures previously established for other animal species. The results obtained show that mouse 5.8S ribosomal RNA yields pancreatic oligonucleotides with the same nucleotide sequence as the homologous oligonucleotides from rat cells. Furthermore T1 oligonucleotides of 5.8S ribosomal RNA from rat, mouse and human cells behave identically on fingerprinting fractionation and have the same composition as judged by pancreatic digestion. These results strongly suggest that the primary structures of 5.8S ribosomal RNA from rat, mouse and human cells are identical. This identity of structure is also found when the presence of several modified bases (psi and methylated bases) is considered. The findings emphasize the remarkable evolutionary stability of ribosomal gene structure. Comparison of the terminal regional of 5.8S RNA with those of 18S RNA reveals differences which imply a more complex mechanism underlying the maturation of 45S precursor RNA than the finding of identical structure would have suggested.     

The nucleotide sequence of the chloroplast 5S ribosomal RNA from spinach.

Spinacia oleracia cholorplast 5S ribosomal RNA was end-labeled with [32P] and the complete nucleotide sequence was determined. The sequence is: pUAUUCUGGUGUCCUAGGCGUAGAGGAACCACACCAAUCCAUCCCGAACUUGGUGGUUAAACUCUACUGCGGUGACGAU ACUGUAGGGGAGGUCCUGCGGAAAAAUAGCUCGACGCCAGGAUGOH. This sequence can be fitted to the secondary structural model proposed for prokaryotic 5S ribosomal RNAs by Fox and Woese (1). However, the lengths of several single- and double-stranded regions differ from those common to prokaryotes. The spinach chloroplast 5S ribosomal RNA is homologous to the 5S ribosomal RNA of Lemna chloroplasts with the exception that the spinach RNA is longer by one nucleotide at the 3' end and has a purine base substitution at position 119. The sequence of spinach chloroplast 5S RNA is identical to the chloroplast 5S ribosomal RNA gene of tobacco. Thus the structures of the chloroplast 5S ribosomal RNAs from some of the higher plants appear to be almost totally conserved. This does not appear to be the case for the higher plant cytoplasmic 5S ribosomal RNAs.     

Nucleotide sequence of a mosquito 18S ribosomal RNA gene.

We have sequenced an 18S ribosomal RNA gene from the mosquito, Aedes albopictus. Computer alignment of the 1950 nucleotide coding region (56% A + T) with 18S rRNA sequences from two insect and three vertebrate species revealed greater sequence divergence among the insects than among the vertebrates. Sequence alignments showed that variable region V4, which has been considered to be the most poorly conserved domain in the 18S rRNA gene, was better conserved among insects and vertebrates than was the V6 domain.