共查询到20条相似文献,搜索用时 15 毫秒
1.
1. Potassium n-decyl phosphate binds exothermically to bovine serum albumin at pH 7.0 to form a specific complex containing approx. 60 phosphate anions. 2. The formation of the complex is accompanied by changes in the u.v. difference spectrum of the protein. 3. At higher phosphate concentrations (above 0.4mM) surfactant molecules continue to be bound, and the protein undergoes a gross change in conformation. 4. n-Dodecyltri-methylammonium bromide binds endothermically to bovine serum albumin at pH7.0 but the extent of binding for a given free surfactant concentration is less than for the phosphate surfactant. 5. Binding is accompanied by a small change in the specific viscosity and by changes in the u.v. difference spectrum of the protein. 6. It is suggested that over the surfactant concentration ranges studied n-decyl phosphate ions first bind to the C-terminal part of the protein and then to the more compact N-terminal part whereas n-dodecyltrimethylammonium ions bind only to the C-terminal part of bovine serum albumin. 相似文献
2.
Bian H Li M Yu Q Chen Z Tian J Liang H 《International journal of biological macromolecules》2006,39(4-5):291-297
The study on the interaction of artemisinin with bovine serum albumin (BSA) has been undertaken at three temperatures, 289, 296 and 303 K and investigated the effect of common ions and UV C (253.7 nm) irradiation on the binding of artemisinin with BSA. The binding mode, the binding constant and the protein structure changes in the presence of artemisinin in aqueous solution at pH 7.40 have been evaluated using fluorescence, UV–vis and Fourier transform infrared (FT-IR) spectroscopy. The quenching constant Kq, Ksv and the association constant K were calculated according to Stern–Volmer equation based on the quenching of the fluorescence of BSA. The thermodynamic parameters, the enthalpy (ΔH) and the entropy change (ΔS) were estimated to be −3.625 kJ mol−1 and 107.419 J mol−1 K−1 using the van’t Hoff equation. The displacement experiment shows that artemisinin can bind to the subdomain IIA. The distance between the tryptophan residues in BSA and artemisinin bound to site I was estimated to be 2.22 nm using Föster's equation on the basis of fluorescence energy transfer. The decreased binding constant in the presence of enough common ions and UV C exposure, indicates that common ions and UV C irradiation have effect on artemisinin binding to BSA. 相似文献
3.
《The International journal of biochemistry》1984,16(10):1095-1098
- 1.1. The binding curves of three surfactants (natrium dodecyl sulphate, Triton X-100 and Slovafol 909) to human serum albumin at protein concentrations of 0.01–10% were measured.
- 2.2. Contrary to other authors' findings, the results showed the courses of the binding curves to be independent of protein concentration.
- 3.3. The present values of the concentration-dependent binding curves require special accuracy in the experimental techniques.
4.
B P Maliwal A G Rao M S Rao 《International journal of peptide and protein research》1985,25(4):382-388
The interaction of gossypol with bovine serum albumin (BSA) at pH 7.6 in 0.02 M borax-borate buffer has been followed by circular dichroism (CD) and difference spectroscopy. From the extrinsic CD band at 390 nm, a binding constant of 2.7 X 10(3) M-1 was calculated. At 54 degrees the induced CD spectrum was abolished, suggesting that the interaction is not favoured at that temperature. The effect of various solvents and salts on the interaction has been followed by difference spectroscopy. The modification of epsilon-amino groups of lysine did not affect the interaction. Binding of gossypol to BSA does not cause a change in its secondary structure or sedimentation coefficient. 相似文献
5.
《Analytical biochemistry》1985,145(2):217-221
An air-driven ultracentrifuge has been used to investigate the calcium-dependent association between calmodulin and bovine serum albumin. Procedures were described which allowed the interaction to be analyzed to yield the equilibrium constant. At low ionic strength (25 mm Tris-HCl, pH 7.5, pCa 6.68, 9°C) the equilibrium constant for the interaction was estimated to be 2.1 × 104m−1, while at high ionic strength (25 mm Tris-HCl, pH 7.5, 150 mm KCl, pCa 6.68, 9°C) the value was 4.5 × 103m−1. Under similar conditions, calmodulin was also found to interact with β-lactoglobulin A and gelatin, but no detectable association was observed with ovalbumin. 相似文献
6.
Kamat BP Seetharamappa J Melwanki MB 《Indian journal of biochemistry & biophysics》2004,41(4):173-178
The mechanism of interaction of riboflavin (RF) with bovine serum albumin (BSA) using fluorometric and circular dichroism (CD) methods has been reported. The association constant (K) for RF-BSA binding shows that the interaction is non-covalent in nature. Stern-Volmer analysis of fluorescence quenching data shows that the fraction of fluorophore (BSA) accessible to the quencher (RF) is close to unity, indicating that both tryptophan residues of BSA are involved in the interaction. The high magnitude of rate constant for quenching kq (10(13) M(-1) s(-1) indicates that RF binding site is in close proximity to tryptophan residue of BSA. Thermodynamic parameters obtained from data at different temperatures showed that the binding of RF to BSA predominantly involves the formation of hydrophobic bonds. Binding studies in the presence of a hydrophobic probe 8-anilino-1-naphthalene sulphonic acid, sodium salt (ANS) showed that RF and ANS do not share common sites in BSA. The small decrease in critical micellar concentration of anionic surfactant, sodium dodecyl sulphate in the presence of RF shows that ionic character of RF also contributes to binding and is not solubilized inside the micelle. Significant decrease in concentration of free RF has been observed in the presence of paracetamol. The CD spectrum shows the binding of RF leads to a change in the alpha helical structure of BSA. 相似文献
7.
Reverse micelle extraction is still in the stage of laboratory. Major limitation associated with use of synthetic surfactants in reverse micelle extraction process is the unfolding or denaturation of proteins. Sugar surfactants are thought non-toxic and environmentally benign, and can exhibit interesting interfacial properties, but the application of sugar-based surfactants in protein extraction is still limited. In the present study, we extracted bovine serum albumin (BSA) by using reverse micelles from glucosylammonium (GA) and lactosylammonium (LA) surfactants (with dicarboxylate as counter ion). It was found that under optimum condition, (1) the maximum forward extraction efficiency was ca. 86% with GA, while only around 50% with LA, and (2) almost all BSA solubilized in reverse micelles prepared from GA could be recovered into aqueous phase, while the recovery of BSA from the reverse micelles of LA was lower. In addition, the optimum extraction parameters were closely related to surfactant structure. Therefore, the electrostatic interaction, H-bonding and sugar head size should be important for BSA transfer. 相似文献
8.
The interaction between tamibarotene and bovine serum albumin (BSA) was studied using fluorescence quenching technique and ultraviolet–visible spectrophotometry. The results of experiments showed that tamibarotene could strongly quench the intrinsic fluorescence of BSA by a dynamic quenching mechanism. The apparent binding constant, number of binding site and corresponding thermodynamic parameters at different temperatures were calculated respectively, and the main interaction force between tamibarotene and BSA was proved to be hydrophobic force. Synchronous fluorescence spectra showed that tamibarotene changed the molecular conformation of BSA. When BSA concentration was 1.00 × 10?6 mol L?1, the quenched fluorescence ΔF had a good linear relationship with the concentration of tamibarotene in the range 1.00 × 10?6 to 12.00 × 10?6 mol L?1 with the detection limit of 6.52 × 10?7 mol L?1. Copyright © 2010 John Wiley & Sons, Ltd. 相似文献
9.
The specific binding to bovine serum albumin (BSA) of anionic and non-ionic surfactants with C12 acyl chains has been studied by high sensitivity isothermal titration calorimetry. This method proved particularly effective in resolving the binding of anionic surfactants into separate classes of sites with different affinity. For sodium dodecylsulfate (SDS) the measured binding curves could be rationalized as association to two classes (high affinity/low affinity) of sites comprising, respectively, three and six similar (i.e. thermodynamically equivalent), independent sites. Changes in the thermodynamic functions enthalpy, standard free energy, standard entropy and heat capacity could be discerned for each class of binding site, as well as for micelle formation. These data suggest that binding to low affinity sites (in analogy with micelle formation) exhibits energetic parameters; in particular, a large negative change in heat capacity, which is characteristic of hydrophobic interactions. The thermodynamics of high affinity binding, on the other hand, is indicative of other dominant forces; most likely electrostatic interactions. Other anionic ligands investigated (laurate and dodecyl benzylsulfonate) showed a behavior similar to SDS, the most significant difference being the high affinity binding of the alkylbenzyl sulfonate. For this ligand, the thermodynamic data is indicative of a more loosely associated complex than for SDS and laurate. BSA was found to bind one or two of the non-ionic surfactants (NIS) hepta- or penta(ethylene glycol) monododecyl ether (C12EO7 and C12EO5) with binding constants about three orders of magnitude lower than for SDS. Hence, the free energy of the surfactant in the weakly bound BSA-NIS complex is only slightly favored over the micellar state. The binding process is characterized by very large exothermic enthalpy changes (larger than for the charged surfactants) and a large, positive increment in heat capacity. These observations cannot be reconciled with a molecular picture based on simple hydrophobic condensation onto non-polar patches on the protein surface. 相似文献
10.
Shcharbin D Pedziwiatr E Chonco L Bermejo-Martín JF Ortega P de la Mata FJ Eritja R Gómez R Klajnert B Bryszewska M Muñoz-Fernandez MA 《Biomacromolecules》2007,8(7):2059-2062
Dendrimers are new nanotechnological carriers for gene delivery. Short oligodeoxynucleotides (ODNs) are a new class of antisense therapy drugs for cancer and infectious or metabolic diseases. The interactions between short oligodeoxynucleotides (GEM91, CTCTCGCACCCATCTCTCTCCTTCT; SREV, TCGTCGCTGTCTCCGCTTCTTCCTGCCA; unlabeled or fluorescein-labeled), novel water-soluble carbosilane dendrimers, and bovine serum albumin were studied by fluorescence and gel electrophoresis. The molar ratios of the dendrimer/ODN dendriplexes ranged from 4 to 7. The efficiency of formation and stability of the dendriplexes depended on electrostatic interactions between the dendrimer and the ODNs. Dendriplex formation significantly decreased the interactions between ODNs and albumin. Thus, the formation of dendriplexes between carbosilane dendrimers and ODNs may improve ODN delivery. 相似文献
11.
12.
Probing the interaction of cephalosporin with bovine serum albumin: A structural and comparative perspective 下载免费PDF全文
Li‐Yang Cheng Cheng‐Zhang Yang Hui‐Zi Li Min Li Ai‐Min Bai Yu Ouyang Yan‐Jun Hu 《Luminescence》2018,33(1):209-218
Cephalosporins belong the largest class of antibiotics used in the treatment of a wide range of infectious diseases caused by susceptible organisms. In the present study, we chose two typical antibiotics cefalexin/cefixime based on their structure, and investigated the interaction of cephalexin/cefixime with bovine serum albumin (BSA) using UV–vis absorption spectra, fluorescence spectroscopy, circular dichroism (CD) spectroscopy and molecular modeling approaches. Spectroscopic experiments revealed the formation of a BSA ? cefalexin/cefixime complex. The binding parameters calculated using a modified Stern ? Volmer method and the Scatchard method reached 103–104 L·mol?1. Thermodynamic parameter studies revealed that binding characteristics by negative enthalpy and positive entropy changes, and electrostatic interactions play a major role. Site marker competitive displacement experiments and molecular modeling approaches demonstrated that cefalexin and cefixime bind with appropriate affinity to site I (subdomain IIA) of BSA. Furthermore, synchronous fluorescence spectra, CD spectra and molecular modeling results indicated that the secondary structure of BSA was changed in the presence of cefalexin and cefixime. Additionally, the effects of metal ions on the BSA ? cefalexin/cefixime system were also assessed. 相似文献
13.
The binding of theophylline (Th, 11-840 microM) to bovine serum albumin (BSA, 10 microM) using microdialysis technique in the presence of fatty acids (2.5-50.0 microM) and cholesterol (20-500 nM) indicates that fatty acids and cholesterol inhibit the binding of Th to BSA. The maximum inhibition (90.5%) occurs in presence of acetic acid (AA) followed by lauric acid (LA, 83.3%), palmitic acid (PA, 72.2%), oleic acid (OA, 44.4%) and cholesterol (22.2%). Fatty acids and cholesterol also decrease the number of binding sites and the affinity for the binding of Th to BSA. Such a decrease is maximum in the presence of AA followed by LA, PA, OA and cholesterol. Complete abolition of the low affinity binding site in the presence of AA indicates that the low affinity binding is predominantly ionic in nature while the high affinity binding involves ionic and other type(s) of unidentified force(s). This makes high affinity binding stronger than low affinity binding. 相似文献
14.
The interaction between two chromates [sodium chromate (Na2CrO4) and potassium chromate K2CrO4)] and bovine serum albumin (BSA) in physiological buffer (pH 7.4) was investigated by the fluorescence quenching technique. The results of fluorescence titration revealed that two chromates could strongly quench the intrinsic fluorescence of BSA through a static quenching procedure. The apparent binding constants K and number of binding sites n of chromate with BSA were obtained by the fluorescence quenching method. The thermodynamic parameters enthalpy change (ΔH), entropy change (ΔS) were negative, indicating that the interaction of two chromates with BSA was driven mainly by van der Waals forces and hydrogen bonds. The process of binding was a spontaneous process in which Gibbs free energy change was negative. The distance r between donor (BSA) and acceptor (chromate) was calculated based on Forster’s non-radiative energy transfer theory. The results of UV–Vis absorption, synchronous fluorescence, three-dimensional fluorescence and circular dichroism (CD) spectra showed that two chromates induced conformational changes of BSA. 相似文献
15.
The characteristics of the interaction between reserpine and bovine serum albumin (BSA) were studied by fluorescence, UV-vis absorption and Fourier transform infrared (FT-IR) spectroscopy. Spectroscopic analysis revealed that fluorescence quenching of BSA by reserpine was through a static quenching procedure. The binding constant K(A) of reserpine with BSA at 293, 301 and 309 K was 1.63, 1.78 and 2.35 x 10(5) moL(-1) L respectively, which indicated degree of binding force between reserpine and BSA. There was one binding site between reserpine and BSA. The entropy and enthalpy changes were positive, indicating that interaction of reserpine and BSA was driven mainly by hydrophobic forces. The average binding distance between the donor (BSA) and the acceptor (reserpine) was about 3.84 nm based on the Forster non-radiation energy transfer theory. Results of synchronous fluorescence and FT-IR spectra indicated that the conformation and microenvironment of BSA were changed by the binding of reserpine. The results may provide important insights into the physiological activity of reserpine. 相似文献
16.
Wang Xinying Zhang Guangyuan Yu Di Wang Ning Guan Qingxiang 《Glycoconjugate journal》2021,38(5):585-597
Glycoconjugate Journal - We fabricated an amphiphilic folate-modified Bletilla striata polysaccharide (FA-BSP-SA) copolymer that exhibited good biocompatibility and superior antitumor effects. This... 相似文献
17.
Beatriz Rodríguez Galdón Carmen Pinto Corraliza Juan J. Cestero Carrillo Pedro Macías Laso 《Luminescence》2013,28(5):765-770
The interaction of lycopene with bovine serum albumin (BSA) in aqueous solution was studied by fluorescence quenching, three‐dimensional fluorescence and circular dichroism spectroscopy. The data showed that the fluorescence of BSA was quenched by lycopene at different temperatures through a dynamic mechanism. The evaluation of three‐dimensional fluorescence spectra revealed a conformational modification of BSA induced by coupling with lycopene and an increase in protein diameter as a consequence of the ligand–protein interaction. Moreover, the information obtained from evaluation of the effect of lycopene on BSA conformation by circular dichroism strongly supported the existence of a slight unfolding of BSA induced by coupling to lycopene. Copyright © 2012 John Wiley & Sons, Ltd. 相似文献
18.
The binding of palmatine to bovine serum albumin (BSA) was studied under physiological conditions (pH = 7.40) by molecular
spectroscopic approach. It was proved that the fluorescence quenching of BSA by palmatine is a result of the formation of
palmatine–BSA complex. Binding parameters were determined using the modified Stern–Volmer equation and Scatchard equation,
to measure the specific binding between palmatine and BSA. The thermodynamic parameters calculated, ∆G°, ∆H° and ∆S° indicate that the electrostatic interactions play a major role in the palmatine–BSA association. Site marker competitive
displacement experiments demonstrated that palmatine binds with specific affinity to site II (subdomain IIIA) of BSA. Furthermore,
the specific binding distance r (3.36 nm) was obtained according to fluorescence resonance energy transfer. The results of synchronous fluorescence spectra
and UV–Visible absorption spectra show that the conformation of bovine serum albumin has been changed. 相似文献
19.
Vera-Avila LE García-Salgado E García de Llasera MP Peña-Alvarez A 《Analytical biochemistry》2008,373(2):272-280
Silica glasses doped with 500-700 microg of bovine serum albumin were prepared by the sol-gel method; two pH conditions (pH 5 and 7) were assayed for protein encapsulation. Both biomaterials showed a highly porous structure, with pore sizes in the range 5-28 nm. Columns packed with the ground biogels were on-line coupled to a C18 HPLC column for evaluation of the entrapped protein binding properties using propranolol. Binding capacities (at saturation) were approximately 3.7 and 7.1 microg of propranolol (drug-protein molar ratios 1.4 and 2.7) for the biogels prepared at pH 5 and 7, respectively. The significant difference indicates increased albumin denaturation upon encapsulation at pH 5. A frontal analysis study was then performed in cartridges packed with biogel prepared at pH 7 to evaluate the protein interaction with naproxen at low concentrations (相似文献