The interaction between bovine serum albumin and surfactants.

1. Potassium n-decyl phosphate binds exothermically to bovine serum albumin at pH 7.0 to form a specific complex containing approx. 60 phosphate anions. 2. The formation of the complex is accompanied by changes in the u.v. difference spectrum of the protein. 3. At higher phosphate concentrations (above 0.4mM) surfactant molecules continue to be bound, and the protein undergoes a gross change in conformation. 4. n-Dodecyltri-methylammonium bromide binds endothermically to bovine serum albumin at pH7.0 but the extent of binding for a given free surfactant concentration is less than for the phosphate surfactant. 5. Binding is accompanied by a small change in the specific viscosity and by changes in the u.v. difference spectrum of the protein. 6. It is suggested that over the surfactant concentration ranges studied n-decyl phosphate ions first bind to the C-terminal part of the protein and then to the more compact N-terminal part whereas n-dodecyltrimethylammonium ions bind only to the C-terminal part of bovine serum albumin.     

Study of the interaction of artemisinin with bovine serum albumin

The study on the interaction of artemisinin with bovine serum albumin (BSA) has been undertaken at three temperatures, 289, 296 and 303 K and investigated the effect of common ions and UV C (253.7 nm) irradiation on the binding of artemisinin with BSA. The binding mode, the binding constant and the protein structure changes in the presence of artemisinin in aqueous solution at pH 7.40 have been evaluated using fluorescence, UV–vis and Fourier transform infrared (FT-IR) spectroscopy. The quenching constant K_q, K_sv and the association constant K were calculated according to Stern–Volmer equation based on the quenching of the fluorescence of BSA. The thermodynamic parameters, the enthalpy (ΔH) and the entropy change (ΔS) were estimated to be −3.625 kJ mol⁻¹ and 107.419 J mol⁻¹ K⁻¹ using the van’t Hoff equation. The displacement experiment shows that artemisinin can bind to the subdomain IIA. The distance between the tryptophan residues in BSA and artemisinin bound to site I was estimated to be 2.22 nm using Föster's equation on the basis of fluorescence energy transfer. The decreased binding constant in the presence of enough common ions and UV C exposure, indicates that common ions and UV C irradiation have effect on artemisinin binding to BSA.     

Spectroscopic study of the interaction of gossypol with bovine serum albumin

The interaction of gossypol with bovine serum albumin (BSA) at pH 7.6 in 0.02 M borax-borate buffer has been followed by circular dichroism (CD) and difference spectroscopy. From the extrinsic CD band at 390 nm, a binding constant of 2.7 X 10(3) M-1 was calculated. At 54 degrees the induced CD spectrum was abolished, suggesting that the interaction is not favoured at that temperature. The effect of various solvents and salts on the interaction has been followed by difference spectroscopy. The modification of epsilon-amino groups of lysine did not affect the interaction. Binding of gossypol to BSA does not cause a change in its secondary structure or sedimentation coefficient.     

Spectroscopic studies on the interaction of riboflavin with bovine serum albumin

The mechanism of interaction of riboflavin (RF) with bovine serum albumin (BSA) using fluorometric and circular dichroism (CD) methods has been reported. The association constant (K) for RF-BSA binding shows that the interaction is non-covalent in nature. Stern-Volmer analysis of fluorescence quenching data shows that the fraction of fluorophore (BSA) accessible to the quencher (RF) is close to unity, indicating that both tryptophan residues of BSA are involved in the interaction. The high magnitude of rate constant for quenching kq (10(13) M(-1) s(-1) indicates that RF binding site is in close proximity to tryptophan residue of BSA. Thermodynamic parameters obtained from data at different temperatures showed that the binding of RF to BSA predominantly involves the formation of hydrophobic bonds. Binding studies in the presence of a hydrophobic probe 8-anilino-1-naphthalene sulphonic acid, sodium salt (ANS) showed that RF and ANS do not share common sites in BSA. The small decrease in critical micellar concentration of anionic surfactant, sodium dodecyl sulphate in the presence of RF shows that ionic character of RF also contributes to binding and is not solubilized inside the micelle. Significant decrease in concentration of free RF has been observed in the presence of paracetamol. The CD spectrum shows the binding of RF leads to a change in the alpha helical structure of BSA.     

Thermochemistry of the specific binding of C12 surfactants to bovine serum albumin

The specific binding to bovine serum albumin (BSA) of anionic and non-ionic surfactants with C12 acyl chains has been studied by high sensitivity isothermal titration calorimetry. This method proved particularly effective in resolving the binding of anionic surfactants into separate classes of sites with different affinity. For sodium dodecylsulfate (SDS) the measured binding curves could be rationalized as association to two classes (high affinity/low affinity) of sites comprising, respectively, three and six similar (i.e. thermodynamically equivalent), independent sites. Changes in the thermodynamic functions enthalpy, standard free energy, standard entropy and heat capacity could be discerned for each class of binding site, as well as for micelle formation. These data suggest that binding to low affinity sites (in analogy with micelle formation) exhibits energetic parameters; in particular, a large negative change in heat capacity, which is characteristic of hydrophobic interactions. The thermodynamics of high affinity binding, on the other hand, is indicative of other dominant forces; most likely electrostatic interactions. Other anionic ligands investigated (laurate and dodecyl benzylsulfonate) showed a behavior similar to SDS, the most significant difference being the high affinity binding of the alkylbenzyl sulfonate. For this ligand, the thermodynamic data is indicative of a more loosely associated complex than for SDS and laurate. BSA was found to bind one or two of the non-ionic surfactants (NIS) hepta- or penta(ethylene glycol) monododecyl ether (C12EO7 and C12EO5) with binding constants about three orders of magnitude lower than for SDS. Hence, the free energy of the surfactant in the weakly bound BSA-NIS complex is only slightly favored over the micellar state. The binding process is characterized by very large exothermic enthalpy changes (larger than for the charged surfactants) and a large, positive increment in heat capacity. These observations cannot be reconciled with a molecular picture based on simple hydrophobic condensation onto non-polar patches on the protein surface.     

Analysis of interaction between dendriplexes and bovine serum albumin

Dendrimers are new nanotechnological carriers for gene delivery. Short oligodeoxynucleotides (ODNs) are a new class of antisense therapy drugs for cancer and infectious or metabolic diseases. The interactions between short oligodeoxynucleotides (GEM91, CTCTCGCACCCATCTCTCTCCTTCT; SREV, TCGTCGCTGTCTCCGCTTCTTCCTGCCA; unlabeled or fluorescein-labeled), novel water-soluble carbosilane dendrimers, and bovine serum albumin were studied by fluorescence and gel electrophoresis. The molar ratios of the dendrimer/ODN dendriplexes ranged from 4 to 7. The efficiency of formation and stability of the dendriplexes depended on electrostatic interactions between the dendrimer and the ODNs. Dendriplex formation significantly decreased the interactions between ODNs and albumin. Thus, the formation of dendriplexes between carbosilane dendrimers and ODNs may improve ODN delivery.     

Fatty acids and cholesterol: effect on the interaction of theophylline with bovine serum albumin

The binding of theophylline (Th, 11-840 microM) to bovine serum albumin (BSA, 10 microM) using microdialysis technique in the presence of fatty acids (2.5-50.0 microM) and cholesterol (20-500 nM) indicates that fatty acids and cholesterol inhibit the binding of Th to BSA. The maximum inhibition (90.5%) occurs in presence of acetic acid (AA) followed by lauric acid (LA, 83.3%), palmitic acid (PA, 72.2%), oleic acid (OA, 44.4%) and cholesterol (22.2%). Fatty acids and cholesterol also decrease the number of binding sites and the affinity for the binding of Th to BSA. Such a decrease is maximum in the presence of AA followed by LA, PA, OA and cholesterol. Complete abolition of the low affinity binding site in the presence of AA indicates that the low affinity binding is predominantly ionic in nature while the high affinity binding involves ionic and other type(s) of unidentified force(s). This makes high affinity binding stronger than low affinity binding.     

Study on the interaction of chromate with bovine serum albumin by spectroscopic method

The interaction between two chromates [sodium chromate (Na₂CrO₄) and potassium chromate K₂CrO₄)] and bovine serum albumin (BSA) in physiological buffer (pH 7.4) was investigated by the fluorescence quenching technique. The results of fluorescence titration revealed that two chromates could strongly quench the intrinsic fluorescence of BSA through a static quenching procedure. The apparent binding constants K and number of binding sites n of chromate with BSA were obtained by the fluorescence quenching method. The thermodynamic parameters enthalpy change (ΔH), entropy change (ΔS) were negative, indicating that the interaction of two chromates with BSA was driven mainly by van der Waals forces and hydrogen bonds. The process of binding was a spontaneous process in which Gibbs free energy change was negative. The distance r between donor (BSA) and acceptor (chromate) was calculated based on Forster’s non-radiative energy transfer theory. The results of UV–Vis absorption, synchronous fluorescence, three-dimensional fluorescence and circular dichroism (CD) spectra showed that two chromates induced conformational changes of BSA.     

Characterization of the interaction between reserpine and bovine serum albumin: spectroscopic approaches

The characteristics of the interaction between reserpine and bovine serum albumin (BSA) were studied by fluorescence, UV-vis absorption and Fourier transform infrared (FT-IR) spectroscopy. Spectroscopic analysis revealed that fluorescence quenching of BSA by reserpine was through a static quenching procedure. The binding constant K(A) of reserpine with BSA at 293, 301 and 309 K was 1.63, 1.78 and 2.35 x 10(5) moL(-1) L respectively, which indicated degree of binding force between reserpine and BSA. There was one binding site between reserpine and BSA. The entropy and enthalpy changes were positive, indicating that interaction of reserpine and BSA was driven mainly by hydrophobic forces. The average binding distance between the donor (BSA) and the acceptor (reserpine) was about 3.84 nm based on the Forster non-radiation energy transfer theory. Results of synchronous fluorescence and FT-IR spectra indicated that the conformation and microenvironment of BSA were changed by the binding of reserpine. The results may provide important insights into the physiological activity of reserpine.     

Determination of the specific interaction between palmatine and bovine serum albumin

The binding of palmatine to bovine serum albumin (BSA) was studied under physiological conditions (pH = 7.40) by molecular spectroscopic approach. It was proved that the fluorescence quenching of BSA by palmatine is a result of the formation of palmatine–BSA complex. Binding parameters were determined using the modified Stern–Volmer equation and Scatchard equation, to measure the specific binding between palmatine and BSA. The thermodynamic parameters calculated, ∆G°, ∆H° and ∆S° indicate that the electrostatic interactions play a major role in the palmatine–BSA association. Site marker competitive displacement experiments demonstrated that palmatine binds with specific affinity to site II (subdomain IIIA) of BSA. Furthermore, the specific binding distance r (3.36 nm) was obtained according to fluorescence resonance energy transfer. The results of synchronous fluorescence spectra and UV–Visible absorption spectra show that the conformation of bovine serum albumin has been changed.     

The interaction of folate-modified Bletilla striata polysaccharide-based micelle with bovine serum albumin

Glycoconjugate Journal - We fabricated an amphiphilic folate-modified Bletilla striata polysaccharide (FA-BSP-SA) copolymer that exhibited good biocompatibility and superior antitumor effects. This...     

Binding characteristics of bovine serum albumin encapsulated in sol-gel glasses: an alternative for protein interaction studies

Silica glasses doped with 500-700 microg of bovine serum albumin were prepared by the sol-gel method; two pH conditions (pH 5 and 7) were assayed for protein encapsulation. Both biomaterials showed a highly porous structure, with pore sizes in the range 5-28 nm. Columns packed with the ground biogels were on-line coupled to a C18 HPLC column for evaluation of the entrapped protein binding properties using propranolol. Binding capacities (at saturation) were approximately 3.7 and 7.1 microg of propranolol (drug-protein molar ratios 1.4 and 2.7) for the biogels prepared at pH 5 and 7, respectively. The significant difference indicates increased albumin denaturation upon encapsulation at pH 5. A frontal analysis study was then performed in cartridges packed with biogel prepared at pH 7 to evaluate the protein interaction with naproxen at low concentrations (相似文献   

Spectroscopic studies on the comparative interaction of cationic single-chain and gemini surfactants with human serum albumin

To gain insights into the comparative effect of single-chain/gemini surfactants on proteins and the possible implications, the interaction of human serum albumin (HSA) with cationic single-chain surfactant cetyltrimethylammonium bromide (CTAB) and its gemini counterpart bis(cetyldimethylammonium)butane dibromide with spacer -(CH(2))(4)- (designated as G4) using turbidity measurements, far-UV and near-UV circular dichroism (CD), intrinsic fluorescence and extrinsic fluorescence spectroscopy at pH 7.0 are reported in this contribution. A decrease of 33.5% alpha-helical content at 22.5 microM G4 was monitored compared to a 15% decrease at 2,250 microM CTAB. Against a 3.5% increase at 11,250 microM CTAB, a rise of 21.1% in the alpha-helical content was observed 375 microM G4. The result is related to the stronger electrostatic and hydrophobic forces in G4, owing to the presence of two charged headgroups and two hydrophobic hydrocarbon tails that make it to bind strongly to the protein compared to its single chain counterpart, CTAB, resulting in larger unfolding. The stabilization at higher concentrations is attributed to the highly hydrophobic microdomain of the G4 aggregates formed at such concentrations. The results of the multi-technique approach are consistent with the fact that the gemini surfactants are more efficient than their conventional single-chain counterparts and hence may be used more effectively in the renaturation of proteins produced in the genetically engineered cells via the artificial chaperone protocol, as solubilizing agents to recover proteins from insoluble inclusion bodies and in drug delivery.     

Underlying molecular interaction of bovine serum albumin and linezolid: a biophysical outlook

Linezolid, one of the reserve antibiotic of oxazolidinone class has wide range of antimicrobial activity. Here we have conducted a fundamental study concerning the dynamics of its interaction with bovine serum albumin (BSA), and the post binding modification of the later by employing different spectroscopic (absorption, fluorescence and circular dichroism (CD) spectroscopy) and molecular docking tools. Gradual quenching of the tryptophan (Trp) fluorescence upon addition of linezolid to BSA confirms their interaction. Analysis of fluorescence quenching at different temperature indicates that the interaction is made by static complex formation and the BSA has one binding site for the drug. The negative Gibbs energy change (ΔG⁰), and positive values of enthalpy change (ΔH⁰) and entropy change (ΔS⁰) strongly suggest that it is an entropy driven spontaneous and endothermic reaction. The reaction involves hydrophobic pocket of the protein, which is further stabilized by hydrogen bonding and electrostatic interactions as evidenced from 8-anilino-1-napthalene sulfonic acid, sucrose and NaCl binding studies. These findings also support the molecular docking study using AutoDock 4.2. The influence of this interaction on the secondary structure of the protein is negligible as evidenced by CD spectroscopy. So, from these findings, we conclude that linezolid interacts with BSA in 1:1 ratio through hydrophobic, hydrogen bonding and ionic interactions, and this may not affect the secondary structure of the protein.     

Thermal aggregation of bovine serum albumin at different pH: comparison with human serum albumin

We report here a study on thermal aggregation of BSA at two different pH values selected to be close to the isoelectric point (pI) of this protein. Our aim is to better understand the several steps and mechanisms accompanying the aggregation process. For this purpose we have performed kinetics of integrated intensity emission of intrinsic and extrinsic dyes, tryptophans and ANS respectively, kinetics of Rayleigh scattering and of turbidity. The results confirm the important role played by conformational changes in the tertiary structure, especially in the exposure of internal hydrophobic regions that promote intermolecular interactions. We also confirm that the absence of electrostatic repulsion favours the disordered non-specific interactions between molecules and consequently affects the aggregation rate. Finally, the comparison between BSA and another relative protein, HSA, allows us to clarify the role of different domains involved in the aggregation process. Proceedings of the XVIII Congress of the Italian Society of Pure and Applied Biophysics (SIBPA), Palermo, Sicily, September 2006.     

Interactions of cannabinoids with bovine serum albumin

There is no shift of emission maximum (F₄₇₀nm) of bovine serum albumin (BSA)-l-anilino-8-naphthatene sulphonic acid (ANS) complex in the pesence of delta-9-tetrahydrocannabinol (delta-9-THC) alone and cannabidiol (CBD) or cannabinol (CBN) in the presence and absence of delta-9-THC. Delta-9-THC (1.66–13.33 M) and CBD at higher concentrations (13.33–20.0 M) produce a concentration-dependent significant quenching of fluorescence of BSA-ANS complex, but CBN (l.66–20.0 M) as well as CBD at lower concentrations (1.66–6.66 M) fails to produce any significant change in Iluorescence intensity under similar conditions. Furthermore, neither CBD nor CBN is able to affect the delta-9-THC-induced quenching of fluorescence intensity of BSA-ANS complex. These results indicate that the binding of cannabinoids to the ANS binding sites of BSA molecule are in the order detta-9-THC > CBr3 > CBN, and CBD or CBN does not have any influence on the binding of delta-9-THC to BSA molecules under these conditions.