共查询到20条相似文献，搜索用时 15 毫秒
1.
Hongbo Chen Hongxia Sun Yahong Chai Suge Zhang Aijiao Guan Qian Li Li Yao Yalin Tang 《Biochimica et Biophysica Acta (BBA)/General Subjects》2019,1863(1):31-38
Background
G-quadruplex has been viewed as a promising therapeutic target in oncology due to its potentially important roles in physiological and pathological processes. Emerging evidence suggests that the biological functions of G-quadruplexes are closely related to the binding of some proteins. Insulin-like growth factor type I (IGF-1), as a significant modulator of cell growth and development, may serve as a quadruplex-binding protein.Methods
The binding affinity and selectivity of IGF-1 to different DNA motifs in solution were measured by using fluorescence spectroscopy, Surface Plasmon Resonance (SPR), and force-induced remnant magnetization (FIRM). The effects of IGF-1 on the formation and stability of G-quadruplex structures were evaluated by circular dichroism (CD) and melting fluorescence resonance energy transfer (FRET) spectroscopy. The influence of quadruplex-specific ligands on the binding of G-quadruplexes with IGF-1 was determined by FIRM.Results
IGF-1 shows a binding specificity for G-quadruplex structures, especially the G-quadruplex structure with a parallel topology. The quadruplex-specific ligands TMPyP4 and PDS (Pyridostatin) can inhibit the interaction between G-quadruplexes and proteins.Conclusions
IGF-1 is demonstrated to selectively bind with G-quadruplex structures. The use of quadruplex-interactive ligands could modulate the binding of IGF-1 to G-quadruplexes.General significance
This study provides us with a new perspective to understand the possible physiological relationship between IGF-1 and G-quadruplexes and also conveys a strategy to regulate the interaction between G-quadruplex DNA and proteins. 相似文献2.
3.
4.
Veronica Esposito Annapina Russo Valentina Vellecco Mariarosaria Bucci Giulia Russo Luciano Mayol Antonella Virgilio Aldo Galeone 《Biochimica et Biophysica Acta (BBA)/General Subjects》2018,1862(12):2645-2650
Background
Although the thrombin binding aptamer (TBA) is endowed with both anticoagulant and antiproliferative properties, it is possible to reduce the first and enhance the second one by suitable chemical modifications.Methods
Two oligonucleotides (TBA353 and TBA535) based on the TBA sequence (GGTTGGTGTGGTTGG) and containing inversion of polarity sites have been investigated by CD, UV and electrophoretic techniques for their ability to form G-quadruplex structures. Furthermore, their anticoagulant (PT assay), antiproliferative (MTT assay) and anti-motility (wound healing assay) properties against Calu-6 cells have been tested and compared with TBA.Results
CD, UV and electrophoresis data indicate that both ODNs are able to form G-quadruplex structures. Particularly, results suggest that TBA535 adopts a G-quadruplex structure characterized by a loop arrangement different from that of TBA. Both TBA analogues drop the anticoagulant activity. However, TBA535 is endowed with a significant antiproliferative activity against lung cancer Calu-6 cells. Importantly, both TBA and TBA535 possess a remarkable anti-motility property against the same cell line.Conclusions
Both TBA analogues TBA353 and TBA535 are able to form G-quadruplex structures with no anticoagulant activity. However only TBA535 is endowed with noteworthy antiproliferative and anti-motility properties against lung cancer Calu-6 cells.General significance
The switching from the anticoagulant to antiproliferative property can be obtained also in TBA derivatives not adopting the “chair-like” G-quadruplex structure typical of TBA. Furthermore, results have highlighted an unprecedented anti-cell-motility property of TBA and TBA535 reinforcing the potential of these ODNs as anticancer drugs. 相似文献5.
Cristina Pérez-Arnaiz Natalia Busto Javier Santolaya José M. Leal Giampaolo Barone Begoña García 《Biochimica et Biophysica Acta (BBA)/General Subjects》2018,1862(3):522-531
Background
Stabilization of G-quadruplex helices by small ligands has attracted growing attention because they inhibit the activity of the enzyme telomerase, which is overexpressed in > 80% cancer cells. TMPyP4, one of the most studied G-quadruplex ligands, is used as a model to show that the ligands can exhibit different binding features with different conformations of a human telomeric specific sequence.Methods
UV–Vis, FRET melting Assay, Isothermal Titration Calorimetry, Time-resolved Fluorescence lifetime, T-Jump and Molecular Dynamics.Results
TMPyP4 yields two different complexes with two Tel22 telomeric conformations in the presence of Na+ or K+. T-Jump kinetic experiments show that the rates of formation and dissociation of these complexes in the ms time scale differ by one order of magnitude. MD simulations reveal that, in K+ buffer, “hybrid 1” conformation yields kinetic constants on interaction with TMPyP4 one order lower than “hybrid 2”. The binding involves π–π stacking with external loop bases.Conclusions
For the first time we show that for a particular buffer TMPyP4 interacts in a kinetically different way with the two Tel22 conformations even if the complexes formed are thermodynamically indistinguishable.General significance
G-quadruplexes, endowed with technological applications and potential impact on regulation mechanisms, define a new research field. The possibility of building different conformations from same sequence is a complex issue that confers G-quadruplexes very interesting features. The obtaining of reliable kinetic data constitutes an efficient tool to determine reaction mechanisms between conformations and small molecules. 相似文献6.
7.
Sara Lago Matteo Nadai Monica Rossetto Sara N. Richter 《Biochimica et Biophysica Acta (BBA)/General Subjects》2018,1862(6):1276-1282
Background
G-quadruplexes (G4s) are nucleic acids secondary structures formed in guanine-rich sequences. Anti-G4 antibodies represent a tool for the direct investigation of G4s in cells. Surface Plasmon Resonance (SPR) is a highly sensitive technology, suitable for assessing the affinity between biomolecules. We here aimed at improving the orientation of an anti-G4 antibody on the SPR sensor chip to optimize detection of binding antigens.Methods
SPR was employed to characterize the anti-G4 antibody interaction with G4 and non-G4 oligonucleotides. Dextran-functionalized sensor chips were used both in covalent coupling and capturing procedures.Results
The use of two leading molecule for orienting the antibody of interest allowed to improve its activity from completely non-functional to 65% active. The specificity of the anti-G4 antobody for G4 structures could thus be assessed with high sensitivity and reliability.Conclusions
Optimization of the immobilization protocol for SPR biosensing, allowed us to determine the anti-G4 antibody affinity and specificity for G4 antigens with higher sensitivity with respect to other in vitro assays such as ELISA. Anti-G4 antibody specificity is a fundamental assumption for the future utilization of this kind of antibodies for monitoring G4s directly in cells.General significance
The heterogeneous orientation of amine-coupling immobilized ligands is a general problem that often leads to partial or complete inactivation of the molecules. Here we describe a new strategy for improving ligand orientation: driving it from two sides. This principle can be virtually applied to every molecule that loses its activity or is poorly immobilized after standard coupling to the SPR chip surface. 相似文献8.
I-Te Chu Chia-Chuan Wu Ta-Chau Chang 《Biochimica et Biophysica Acta (BBA)/General Subjects》2019,1863(2):418-425
Background
Mitochondrial DNA (mtDNA) mutations could lead to mitochondrial dysfunction, which plays a major role in aging, neurodegeneration, and cancer. Recently, we have highlighted G-quadruplex (G4) formation of putative G4-forming (PQF) mtDNA sequences in cells. Herein, we examine structural variation of G4 formation due to mutation of mtDNA sequences in vitro.Methods
The combined circular dichroism (CD), nuclear magnetic resonance (NMR), and polyacrylamide gel electrophoresis (PAGE) results provide complementary insights into the structural variation of the studied G-rich sequence and its mutants.Results
This study illustrates the structural diversity of mt10251, a G-rich mtDNA sequence with a 16-nt loop, (GGGTGGGAGTAGTTCCCTGCTAAGGGAGGG), including the coexistence of a hairpin structure and monomeric, dimeric, and tetrameric G4 structures of mt10251 in 20?mM K+ solution. Moreover, a single-base mutation of mt10251 can cause significant changes in terms of structural populations and polymorphism. In addition, single-base mutations of near-but-not-PQF sequences can potentially change not-G4 to G4 structures. We further found 124 modified PQF sequences due to single-base mutations of near-but-not-PQF sequences in mtDNA.Conclusions
Single-base mutations of mt10251 could make significant changes in its structural variation and some single-base mutated sequences in mtDNA could form G4 structures in vitro.General significance
We illustrate the importance of single-base mutations of DNA sequences to the change of G4 formation in vitro. The use of single-base mutations by generating the fourth G-tract and followed by selection in shortening the longest loop size in the near-but-not-PQF sequences was conducted for the G4 formation. 相似文献9.
Bita Zamiri Mila Mirceta Rashid Abu-Ghazalah Marc S. Wold Christopher E. Pearson Robert B. Macgregor 《Biochimica et Biophysica Acta (BBA)/General Subjects》2018,1862(6):1482-1491
Background
Expansion of the C9orf72 hexanucleotide repeat (GGGGCC)n·(GGCCCC)n is the most common cause of amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD). Both strands of the C9orf72 repeat have been shown to form unusual DNA and RNA structures that are thought to be involved in mutagenesis and/or pathogenesis. We previously showed that the C-rich DNA strands from the C9orf72 repeat can form four-stranded quadruplexes at neutral pH. The cytosine residues become protonated under slightly acidic pH (pH?4.5–6.2), facilitating the formation of intercalated i-motif structures.Methods
Using CD spectroscopy, UV melting, and gel electrophoresis, we demonstrate a pH-induced structural transition of the C-rich DNA strand of the C9orf72 repeat at pHs reported to exist in living cells under stress, including during neurodegeneration and cancer.Results
We show that the repeats with lengths of 4, 6, and 8?units, form intercalated quadruplex i-motifs at low pH (pH?<?5) and monomolecular hairpins and monomolecular quadruplexes under neutral-basic conditions (pH?≥?8). Furthermore, we show that the human replication protein A (RPA) binds to the G-rich and C-rich DNA strands under acidic conditions, suggesting that it can bind to i-motif structures.Conclusions
In the proper sequence context, i-motif structures can form at pH values found in some cells in vivo.General significance
DNA conformational plasticity exists over broad range of solution conditions. 相似文献10.
Jing Xing Gaoxin Zhou Chunlong Sun Huanqing Zhang Bo Chen Xi Zong Jin Cai Min Ji 《Biotechnology letters》2016,38(11):1851-1856
Objective
To design and synthesize a novel near-infrared (NIR) fluorescent probe based on indocyanine Green (ICG), that can be applied in imaging living cells.Results
A highly fluorescent novel NIR fluorescent probe (IR-793) was synthesized in two steps. IR-793 had better fluorescence and optical stability than ICG. In addition, no obvious cytotoxicity effect of IR-793 was observed and cell viability was above 75% at the maximum concentration (120 nM). IR-793 also exhibited good performance in imaging living A549 cells.Conclusion
IR-793, a novel NIR fluorescent probe that is stable, low-cost, highly fluorescent and low cytotoxicity, has been designed and synthesized for imaging living cells.11.
12.
Wataru Yoshida Mizuki Terasaka Saowalak Laddachote Isao Karube 《Biochimica et Biophysica Acta (BBA)/General Subjects》2018,1862(9):1933-1937
Background
DNA methylation at the 5-position of cytosine is an epigenetic modification of CpG dinucleotides. In addition to CpG methylation, the G-quadruplex (G4) structure has been reported as a regulator of gene expression. The identification of G4 forming sequences in CpG islands suggests an involvement of CpG-methylated G4 structures in biological processes; however, few reports have addressed the effects of CpG methylation on G4 structure.Methods
The thermostability of a methylated, 21-mer G4 structure located on the vascular endothelial growth factor (VEGF) gene promoter containing four CpG sites (C1, C6, C11, and C17) were investigated using circular dichroism (CD) spectral analysis.Results
CD melting analysis revealed that VEGF G4 was stabilized by a single CpG methylation on C11 in the presence of Na+ and Mg2+. However, either C1 or C11 methylation enhanced VEGF G4 thermal stability in the presence of K+.Conclusions
Single CpG methylation appears to enhance VEGF G4 thermostability in a manner dependent on both the CpG methylation site and cation type.General significance
These results are expected to contribute to the elucidation of the roles of CpG methylation-stabilized G4 structures in biological processes. 相似文献13.
Andrea Pica Serena Leone Rocco Di Girolamo Federica Donnarumma Alessandro Emendato Michele Fortunato Rega Antonello Merlino Delia Picone 《Biochimica et Biophysica Acta (BBA)/General Subjects》2018,1862(4):808-815
Background
MNEI and its variant Y65R-MNEI are sweet proteins with potential applications as sweeteners in food industry. Also, they are often used as model systems for folding and aggregation studies.Methods
X-ray crystallography was used to structurally characterize Y65R-MNEI at five different pHs, while circular dichroism and fluorescence spectroscopy were used to study their thermal and chemical stability. ThT assay and AFM were used for studying the kinetics of aggregation and morphology of the aggregates.Results
Crystal structures of Y65R-MNEI revealed the existence of a dimer in the asymmetric unit, which, depending on the pH, assumes either an open or a closed conformation. The pH dramatically affects kinetics of formation and morphology of the aggregates: both MNEI and Y65R-MNEI form fibrils at acidic pH while amorphous aggregates are observed at neutral pH.Conclusions
The mutation Y65R induces structural modifications at the C-terminal region of the protein, which account for the decreased stability of the mutant when compared to MNEI. Furthermore, the pH-dependent conformation of the Y65R-MNEI dimer may explain the different type of aggregates formed as a function of pH.General significance
The investigation of the structural bases of aggregation gets us closer to the possibility of controlling such process, either by tuning the physicochemical environmental parameters or by site directed mutagenesis. This knowledge is helpful to expand the range of stability of proteins with potential industrial applications, such as MNEI and its mutant Y65R-MNEI, which should ideally preserve their structure and soluble state through a wide array of conditions. 相似文献14.
Lina Li Mei Li Khong Eric L.H. Lui Saida Mebarek David Magne Rene Buchet Julian A. Tanner 《Biochimica et Biophysica Acta (BBA)/General Subjects》2019,1863(1):199-209
Background
Inorganic polyphosphate (polyP) is a fundamental and ubiquitous molecule in prokaryotes and eukaryotes. PolyP has been found in mammalian tissues with particularly high levels of long-chain polyP in bone and cartilage where critical questions remain as to its localization and function. Here, we investigated polyP presence and function in osteoblast-like SaOS-2 cells and cell-derived matrix vesicles (MVs), the initial sites of bone mineral formation.Methods
PolyP was quantified by 4′,6-diamidino-2-phenylindole (DAPI) fluorescence and characterized by enzymatic methods coupled to urea polyacrylamide gel electrophoresis. Transmission electron microscopy and confocal microscopy were used to investigate polyP localization. A chicken embryo cartilage model was used to investigate the effect of polyP on mineralization.Results
PolyP increased in concentration as SaOS-2 cells matured and mineralized. Particularly high levels of polyP were observed in MVs. The average length of MV polyP was determined to be longer than 196 Pi residues by gel chromatography. Electron micrographs of MVs, stained by two polyP-specific staining approaches, revealed polyP localization in the vicinity of the MV membrane. Additional extracellular polyP binds to MVs and inhibits MV-induced hydroxyapatite formation.Conclusion
PolyP is highly enriched in matrix vesicles and can inhibit apatite formation. PolyP may be hydrolysed to phosphate for further mineralization in the extracellular matrix.General significance
PolyP is a unique yet underappreciated macromolecule which plays a critical role in extracellular mineralization in matrix vesicles. 相似文献15.
O. Gsib M. Deneufchatel M. Goczkowski M. Trouillas M. Resche-Guigon S. Bencherif O. Fichet J.-J. Lataillade V. Larreta-Garde C. Egles 《IRBM》2018,39(2):103-108
Context
The FibriDerm project aims at the development and usage of fibrin-based biomaterials, with mechanical properties adapted to new applications.Methods
These materials are elaborated from interpenetrating polymer networks in which a fibrin-based gel, obtained through enzymatic hydrolysis of fibrinogen, is associated with a synthetic polymeric network, synthesized by photochemistry. These materials are self-supported and not retractable, properties which open new fields of application for these biomaterials as mechanical support for cellular growth, and particularly relevant for tissue regeneration.Results
The main goal of this project is to optimize already elaborated biomaterials to create Human Dermal Equivalents (HDE) solely made of cells and proteins from human origin. An intermediate material, capable of being colonized by surrounding cells and biodegradable in the long-term, will be first developed.Conclusion
The FibriDerm project has the ambition to lead to the development of new materials for tissue regeneration, from the initial research developments and optimizations up to pre-clinical stages, via an interdisciplinary approach. 相似文献16.
Ryota Iino Tatsuya Iida Akihiko Nakamura Ei-ichiro Saita Huijuan You Yasushi Sako 《Biochimica et Biophysica Acta (BBA)/General Subjects》2018,1862(2):241-252
Background
Biological molecular machines support various activities and behaviors of cells, such as energy production, signal transduction, growth, differentiation, and migration.Scope of review
We provide an overview of single-molecule imaging methods involving both small and large probes used to monitor the dynamic motions of molecular machines in vitro (purified proteins) and in living cells, and single-molecule manipulation methods used to measure the forces, mechanical properties and responses of biomolecules. We also introduce several examples of single-molecule analysis, focusing primarily on motor proteins and signal transduction systems.Major conclusions
Single-molecule analysis is a powerful approach to unveil the operational mechanisms both of individual molecular machines and of systems consisting of many molecular machines.General significance
Quantitative, high-resolution single-molecule analyses of biomolecular systems at the various hierarchies of life will help to answer our fundamental question: “What is life?” This article is part of a Special Issue entitled "Biophysical Exploration of Dynamical Ordering of Biomolecular Systems" edited by Dr. Koichi Kato. 相似文献17.
Simone A. Douglas Sarah E. Lamothe Tatiyanna S. Singleton Rodney D. Averett Manu O. Platt 《Biochimica et Biophysica Acta (BBA)/General Subjects》2018,1862(9):1925-1932
Background
Fibrin formation and dissolution are attributed to cascades of protease activation concluding with thrombin activation, and plasmin proteolysis for fibrin breakdown. Cysteine cathepsins are powerful proteases secreted by endothelial cells and others during cardiovascular disease and diabetes. Their fibrinolytic activity and putative role in hemostasis has not been well described.Methods
Fibrin gels were polymerized and incubated with recombinant human cathepsins (cat) K, L, or S, or plasmin, for dose-dependent and time-dependent studies. Dissolution of fibrin gels was imaged. SDS-PAGE was used to resolve cleaved fragments released from fibrin gels and remnant insoluble fibrin gel that was solubilized prior to electrophoresis to assess fibrin α, β, and γ polypeptide hydrolysis by cathepsins. Multiplex cathepsin zymography determined active amounts of cathepsins remaining.Results
There was significant loss of α and β fibrin polypeptides after incubation with cathepsins, with catS completely dissolving fibrin gel by 24?h. Binding to fibrin stabilized catL active time; it associated with cleaved fibrin fragments of multiple sizes. This was not observed for catK or S. CatS also remained active for longer times during fibrin incubation, but its association/binding did not withstand SDS-PAGE preparation.Conclusions
Human cathepsins K, L, and S are fibrinolytic, and specifically can degrade the α and β fibrin polypeptide chains, generating fragments unique from plasmin.General significance
Demonstration of cathepsins K, L, and S fibrinolytic activity leads to further investigation of contributory roles in disrupting vascular hemostasis, or breakdown of fibrin-based engineered vascular constructs where non-plasmin mediated fibrinolysis must be considered. 相似文献18.
Viacheslav V. Senichkin Gelina S. Kopeina Eugeniia A. Prokhorova Alexey V. Zamaraev Inna N. Lavrik Boris Zhivotovsky 《Biochimica et Biophysica Acta (BBA)/General Subjects》2018,1862(3):557-566
Background
The development of approaches that increase therapeutic effects of anti-cancer drugs is one of the most important tasks of oncology. Caloric restriction in vivo or serum deprivation (SD) in vitro has been shown to be an effective tool for sensitizing cancer cells to chemotherapeutic drugs. However, the detailed mechanisms underlying the enhancement of apoptosis in cancer cells by SD remain to be elucidated.Methods
Flow cytometry, caspase activity assay and western blotting were used for cell death rate evaluation. Western blotting, gel-filtration, siRNA approach and qRT-PCR were used to elucidate the mechanism underlying cell death potentiation upon SD.Results
We demonstrated that SD sensitizes cancer cells to treatment with chemotherapeutic agent cisplatin. This effect is independent on activation of caspases-2 and -8, apical caspases triggering apoptosis in response to genotoxic stress. SD potentiates cell death via downregulation of the anti-apoptotic protein Mcl-1. In fact, SD reduces the Mcl-1 mRNA level, which consequently decreases the Mcl-1 protein level and renders cells more susceptible to apoptosis induction via the formation of apoptosome.Conclusions
Mcl-1 protein is an important regulator of sensitivity of cancer cells to apoptotic stimuli upon SD.General significance
This study identifies Mcl-1 as a new target for the sensitization of human cancer cells to cell death by SD, which is of great significance for the development of efficient anti-cancer therapies. 相似文献19.
Seong-Cheol Park Il Ryong Kim Jin-Young Kim Yongjae Lee Eun-Ji Kim Ji Hyun Jung Young Jun Jung Mi-Kyeong Jang Jung Ro Lee 《Biochimica et Biophysica Acta (BBA)/General Subjects》2018,1862(12):2545-2554
Background
It remains an open question whether plant phloem sap proteins are functionally involved in plant defense mechanisms.Methods
The antifungal effects of two profilin proteins from Arabidopsis thaliana, AtPFN1 and AtPFN2, were tested against 11 molds and 4 yeast fungal strains. Fluorescence profiling, biophysical, and biochemical analyses were employed to investigate their antifungal mechanism.Results
Recombinant AtPFN1 and AtPFN2 proteins, expressed in Escherichia coli, inhibited the cell growth of various pathogenic fungal strains at concentrations ranging from 10 to 160?μg/mL. The proteins showed significant intracellular accumulation and cell-binding affinity for fungal cells. Interestingly, the AtPFN proteins could penetrate the fungal cell wall and membrane and act as inhibitors of fungal growth via generation of cellular reactive oxygen species and mitochondrial superoxide. This triggered the AtPFN variant-induced cell apoptosis, resulting in morphological changes in the cells.Conclusion
PFNs may play a critical role as antifungal proteins in the Arabidopsis defense system against fungal pathogen attacks.General significance
The present study indicates that two profilin proteins, AtPFN1 and AtPFN2, can act as natural antimicrobial agents in the plant defense system. 相似文献20.
Natalia V. Dolgova Susan Nehzati Sanjukta Choudhury Tracy C. MacDonald Nathan R. Regnier Andrew M. Crawford Olena Ponomarenko Graham N. George Ingrid J. Pickering 《Biochimica et Biophysica Acta (BBA)/General Subjects》2018,1862(11):2383-2392