共查询到20条相似文献，搜索用时 15 毫秒
1.
Wataru Yoshida Mizuki Terasaka Saowalak Laddachote Isao Karube 《Biochimica et Biophysica Acta (BBA)/General Subjects》2018,1862(9):1933-1937
Background
DNA methylation at the 5-position of cytosine is an epigenetic modification of CpG dinucleotides. In addition to CpG methylation, the G-quadruplex (G4) structure has been reported as a regulator of gene expression. The identification of G4 forming sequences in CpG islands suggests an involvement of CpG-methylated G4 structures in biological processes; however, few reports have addressed the effects of CpG methylation on G4 structure.Methods
The thermostability of a methylated, 21-mer G4 structure located on the vascular endothelial growth factor (VEGF) gene promoter containing four CpG sites (C1, C6, C11, and C17) were investigated using circular dichroism (CD) spectral analysis.Results
CD melting analysis revealed that VEGF G4 was stabilized by a single CpG methylation on C11 in the presence of Na+ and Mg2+. However, either C1 or C11 methylation enhanced VEGF G4 thermal stability in the presence of K+.Conclusions
Single CpG methylation appears to enhance VEGF G4 thermostability in a manner dependent on both the CpG methylation site and cation type.General significance
These results are expected to contribute to the elucidation of the roles of CpG methylation-stabilized G4 structures in biological processes. 相似文献2.
Annika Wahl Silva Kasela Elena Carnero-Montoro Maarten van Iterson Jerko Štambuk Sapna Sharma Erik van den Akker Lucija Klaric Elisa Benedetti Genadij Razdorov Irena Trbojević-Akmačić Frano Vučković Ivo Ugrina Marian Beekman Joris Deelen Diana van Heemst Bastiaan T. Heijmans Christian Gieger 《Biochimica et Biophysica Acta (BBA)/General Subjects》2018,1862(3):637-648
Background
Glycosylation is one of the most common post-translation modifications with large influences on protein structure and function. The effector function of immunoglobulin G (IgG) alters between pro- and anti-inflammatory, based on its glycosylation. IgG glycan synthesis is highly complex and dynamic.Methods
With the use of two different analytical methods for assessing IgG glycosylation, we aim to elucidate the link between DNA methylation and glycosylation of IgG by means of epigenome-wide association studies. In total, 3000 individuals from 4 cohorts were analyzed.Results
The overlap of the results from the two glycan measurement panels yielded DNA methylation of 7 CpG-sites on 5 genomic locations to be associated with IgG glycosylation: cg25189904 (chr.1, GNG12); cg05951221, cg21566642 and cg01940273 (chr.2, ALPPL2); cg05575921 (chr.5, AHRR); cg06126421 (6p21.33); and cg03636183 (chr.19, F2RL3). Mediation analyses with respect to smoking revealed that the effect of smoking on IgG glycosylation may be at least partially mediated via DNA methylation levels at these 7 CpG-sites.Conclusion
Our results suggest the presence of an indirect link between DNA methylation and IgG glycosylation that may in part capture environmental exposures.General significance
An epigenome-wide analysis conducted in four population-based cohorts revealed an association between DNA methylation and IgG glycosylation patterns. Presumably, DNA methylation mediates the effect of smoking on IgG glycosylation. 相似文献3.
Alex Ferrandi Federica Castani Mauro Pitaro Sara Tagliaferri Claire Bouthier de la Tour Rosa Alduina Suzanne Sommer Mauro Fasano Paola Barbieri Monica Mancini Ian Marc Bonapace 《Biochimica et Biophysica Acta (BBA)/General Subjects》2019,1863(1):118-129
Background
Deinococcus radiodurans R1 (DR) survives conditions of extreme desiccation, irradiation and exposure to genotoxic chemicals, due to efficient DNA breaks repair, also through Mn2+ protection of DNA repair enzymes.Methods
Possible annotated domains of the DR1533 locus protein (Shp) were searched by bioinformatic analysis. The gene was cloned and expressed as fusion protein. Band-shift assays of Shp or the SRA and HNH domains were performed on oligonucleotides, genomic DNA from E. coli and DR. shp knock-out mutant was generated by homologous recombination with a kanamycin resistance cassette.Results
DR1533 contains an N-terminal SRA domain and a C-terminal HNH motif (SRA-HNH Protein, Shp). Through its SRA domain, Shp binds double-strand oligonucleotides containing 5mC and 5hmC, but also unmethylated and mismatched cytosines in presence of Mn2+. Shp also binds to Escherichia coli dcm+ genomic DNA, and to cytosine unmethylated DR and E. coli dcm? genomic DNAs, but only in presence of Mn2+. Under these binding conditions, Shp displays DNAse activity through its HNH domain. Shp KO enhanced >100 fold the number of spontaneous mutants, whilst the treatment with DNA double strand break inducing agents enhanced up to 3-log the number of survivors.Conclusions
The SRA-HNH containing protein Shp binds to and cuts 5mC DNA, and unmethylated DNA in a Mn2+ dependent manner, and might be involved in faithful genome inheritance maintenance following DNA damage.General significance
Our results provide evidence for a potential role of DR Shp protein for genome integrity maintenance, following DNA double strand breaks induced by genotoxic agents. 相似文献4.
5.
I-Te Chu Chia-Chuan Wu Ta-Chau Chang 《Biochimica et Biophysica Acta (BBA)/General Subjects》2019,1863(2):418-425
Background
Mitochondrial DNA (mtDNA) mutations could lead to mitochondrial dysfunction, which plays a major role in aging, neurodegeneration, and cancer. Recently, we have highlighted G-quadruplex (G4) formation of putative G4-forming (PQF) mtDNA sequences in cells. Herein, we examine structural variation of G4 formation due to mutation of mtDNA sequences in vitro.Methods
The combined circular dichroism (CD), nuclear magnetic resonance (NMR), and polyacrylamide gel electrophoresis (PAGE) results provide complementary insights into the structural variation of the studied G-rich sequence and its mutants.Results
This study illustrates the structural diversity of mt10251, a G-rich mtDNA sequence with a 16-nt loop, (GGGTGGGAGTAGTTCCCTGCTAAGGGAGGG), including the coexistence of a hairpin structure and monomeric, dimeric, and tetrameric G4 structures of mt10251 in 20?mM K+ solution. Moreover, a single-base mutation of mt10251 can cause significant changes in terms of structural populations and polymorphism. In addition, single-base mutations of near-but-not-PQF sequences can potentially change not-G4 to G4 structures. We further found 124 modified PQF sequences due to single-base mutations of near-but-not-PQF sequences in mtDNA.Conclusions
Single-base mutations of mt10251 could make significant changes in its structural variation and some single-base mutated sequences in mtDNA could form G4 structures in vitro.General significance
We illustrate the importance of single-base mutations of DNA sequences to the change of G4 formation in vitro. The use of single-base mutations by generating the fourth G-tract and followed by selection in shortening the longest loop size in the near-but-not-PQF sequences was conducted for the G4 formation. 相似文献6.
Tae Sup Lee Young Kim Weiqi Zhang In Ho Song Ching-Hsuan Tung 《Biochimica et Biophysica Acta (BBA)/General Subjects》2018,1862(5):1091-1100
Background
Exosomes are nano-sized vesicles derived from the fusion of multivesicular bodies with the surrounding plasma membrane. Exosomes have various diagnostic and therapeutic potentials in cancer and other diseases, thus tracking exosomes is an important issue.Methods
Here, we report a facile exosome labeling strategy using a natural metabolic incorporation of an azido-sugar into the glycan, and a strain-promoted azide-alkyne click reaction. In culture, tetra-acetylated N-azidoacetyl-D-mannosamine (Ac4ManNAz) was spontaneously incorporated into glycans within the cells and later redistributed onto their exosomes. These azido-containing exosomes were then labeled with azadibenzylcyclooctyne (ADIBO)-fluorescent dyes by a bioorthogonal click reaction.Results
Cellular uptake and the in vivo tracking of fluorescent labeled exosomes were evaluated in various cells and tumor bearing mice. Highly metastatic cancer-derived exosomes showed an increased self-homing in vitro and selective organ distribution in vivo.Conclusion
Our metabolic exosome labeling strategy could be a promising tool in studying the biology and distribution of exosomes, and optimizing exosome based therapeutic approaches.General significant
A facile and effective exosome labeling strategy was introduced by presenting azido moiety on the surface of exosome through metabolic glycan synthesis, and then conjugating a strain-promoted fluorescent dye. 相似文献7.
Najeh Krayem Goetz Parsiegla Hélène Gaussier Hanen Louati Raida Jallouli Pascal Mansuelle Frédéric Carrière Youssef Gargouri 《Biochimica et Biophysica Acta (BBA)/General Subjects》2018,1862(5):1247-1261
Background
Heterodimeric phospholipase A2 from venom glands of Tunisian scorpion Scorpio maurus (Sm-PLGV) had been purified. It contains long and short chains linked by a disulfide bridge. Sm-PLGV exhibits hemolytic activity towards human erythrocytes and interacts with phospholipid monolayers at high surface pressure. The investigation of structure-function relationships should provide new clues to understand its activity.Methods
Molecular cloning of Sm-PLGV and heterologous expression in Escherichia coli of three recombinant forms was used to determine the role of the short chain on enzymatic activity. Infrared spectroscopy assisted 3D model building of the three recombinant constructs (phospholipases with and without the penta-peptide and Long chain only) allowed us to propose an explanation of the differences in specific activities and their interaction with various phospholipids.Results
Nucleotide sequence of Sm-PLGV encodes 129 residues corresponding to the Long chain, the penta-peptide and the short chain. Although recombinant phospholipases without and with the penta-peptide have different specific activities, they display a similar substrate specificity on various phospholipid monolayers and similar bell-shaped activity profiles with maxima at high surface pressure. The absence of the short chain reduces significantly enzymatic and hemolytic activities. The 3D models pointed to an interaction of the short chain with the catalytic residues, what might explain the difference in activities of our constructs.Conclusion
Infrared spectroscopy data and 3D modeling confirm the experimental findings that highlight the importance of the short chain for the Sm-PLGV activity.General significance
New informations are given to further establish the structure-function relationships of the Sm-PLGV. 相似文献8.
Bita Zamiri Mila Mirceta Rashid Abu-Ghazalah Marc S. Wold Christopher E. Pearson Robert B. Macgregor 《Biochimica et Biophysica Acta (BBA)/General Subjects》2018,1862(6):1482-1491
Background
Expansion of the C9orf72 hexanucleotide repeat (GGGGCC)n·(GGCCCC)n is the most common cause of amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD). Both strands of the C9orf72 repeat have been shown to form unusual DNA and RNA structures that are thought to be involved in mutagenesis and/or pathogenesis. We previously showed that the C-rich DNA strands from the C9orf72 repeat can form four-stranded quadruplexes at neutral pH. The cytosine residues become protonated under slightly acidic pH (pH?4.5–6.2), facilitating the formation of intercalated i-motif structures.Methods
Using CD spectroscopy, UV melting, and gel electrophoresis, we demonstrate a pH-induced structural transition of the C-rich DNA strand of the C9orf72 repeat at pHs reported to exist in living cells under stress, including during neurodegeneration and cancer.Results
We show that the repeats with lengths of 4, 6, and 8?units, form intercalated quadruplex i-motifs at low pH (pH?<?5) and monomolecular hairpins and monomolecular quadruplexes under neutral-basic conditions (pH?≥?8). Furthermore, we show that the human replication protein A (RPA) binds to the G-rich and C-rich DNA strands under acidic conditions, suggesting that it can bind to i-motif structures.Conclusions
In the proper sequence context, i-motif structures can form at pH values found in some cells in vivo.General significance
DNA conformational plasticity exists over broad range of solution conditions. 相似文献9.
Ignacio Fernández Jorge M.O. Fernandes Vânia P. Roberto Martina Kopp Catarina Oliveira Marta F. Riesco Jorge Dias Cymon J. Cox M. Leonor Cancela Elsa Cabrita Paulo Gavaia 《Biochimica et Biophysica Acta (BBA)/General Subjects》2019,1863(1):39-51
Background
Vitamin K (VK) is a fat-soluble vitamin known for its essential role in blood coagulation, but also on other biological processes (e.g. reproduction, brain and bone development) have been recently suggested. Nevertheless, the molecular mechanisms behind its particular function on reproduction are not yet fully understood.Methods
The potential role of VK on reproduction through nutritional supplementation in Senegalese sole (Solea senegalensis) was assessed by gonadal maturation and 11-ketosterone, testosterone and estriol plasma levels when fed with control or VK supplemented (1250?mg?kg?1 of VK1) diets along a six month trial. At the end, sperm production and quality (viability and DNA fragmentation) were evaluated. Circulating small non-coding RNAs (sncRNAs) in blood plasma from males were also studied through RNA-Seq.Results
Fish fed with dietary VK supplementation had increased testosterone levels and lower sperm DNA fragmentation. SncRNAs from blood plasma were found differentially expressed when nutritional and sperm quality conditions were compared. PiR-675//676//4794//5462 and piR-74614 were found up-regulated in males fed with dietary VK supplementation. Let-7g, let-7e(18nt), let-7a-1, let-7a-3//7a-2//7a-1, let-7e(23nt) and piR-675//676//4794//5462 were found to be up-regulated and miR-146a and miR-146a-1//146a-2//146a-3 down-regulated when fish with low and high sperm DNA fragmentation were compared. Bioinformatic analyses of predicted mRNAs targeted by sncRNAs revealed the potential underlying pathways.Conclusions
VK supplementation improves fish gonad maturation and sperm quality, suggesting an unexpected and complex regulation of the nutritional status and reproductive performance through circulating sncRNAs.General significance
The use of circulating sncRNAs as reliable and less-invasive physiological biomarkers in fish nutrition and reproduction has been unveiled. 相似文献10.
Seong-Cheol Park Il Ryong Kim Jin-Young Kim Yongjae Lee Eun-Ji Kim Ji Hyun Jung Young Jun Jung Mi-Kyeong Jang Jung Ro Lee 《Biochimica et Biophysica Acta (BBA)/General Subjects》2018,1862(12):2545-2554
Background
It remains an open question whether plant phloem sap proteins are functionally involved in plant defense mechanisms.Methods
The antifungal effects of two profilin proteins from Arabidopsis thaliana, AtPFN1 and AtPFN2, were tested against 11 molds and 4 yeast fungal strains. Fluorescence profiling, biophysical, and biochemical analyses were employed to investigate their antifungal mechanism.Results
Recombinant AtPFN1 and AtPFN2 proteins, expressed in Escherichia coli, inhibited the cell growth of various pathogenic fungal strains at concentrations ranging from 10 to 160?μg/mL. The proteins showed significant intracellular accumulation and cell-binding affinity for fungal cells. Interestingly, the AtPFN proteins could penetrate the fungal cell wall and membrane and act as inhibitors of fungal growth via generation of cellular reactive oxygen species and mitochondrial superoxide. This triggered the AtPFN variant-induced cell apoptosis, resulting in morphological changes in the cells.Conclusion
PFNs may play a critical role as antifungal proteins in the Arabidopsis defense system against fungal pathogen attacks.General significance
The present study indicates that two profilin proteins, AtPFN1 and AtPFN2, can act as natural antimicrobial agents in the plant defense system. 相似文献11.
Prashanth Kumar Koochana Abhinav Mohanty Suman Das Biswamaitree Subhadarshanee Suresh Satpati Anshuman Dixit Surendra Chandra Sabat Rabindra K. Behera 《Biochimica et Biophysica Acta (BBA)/General Subjects》2018,1862(5):1190-1198
Background
Ferritin detoxifies excess of free Fe(II) and concentrates it in the form of ferrihydrite (Fe2O3·xH2O) mineral. When in need, ferritin iron is released for cellular metabolic activities. However, the low solubility of Fe(III) at neutral pH, its encapsulation by stable protein nanocage and presence of dissolved O2 limits in vitro ferritin iron release.Methods
Physiological reducing agent, NADH (E1/2?=??330?mV) was inefficient in releasing the ferritin iron (E1/2?=?+183?mV), when used alone. Thus, current work investigates the role of low concentration (5–50?μM) of phenazine based electron transfer (ET) mediators such as FMN, PYO - a redox active virulence factor secreted by Pseudomonas aeruginosa and PMS towards iron mobilization from recombinant frog M ferritin.Results
The presence of dissolved O2, resulting in initial lag phase and low iron release in FMN, had little impact in case of PMS and PYO, reflecting their better ET relay ability that facilitates iron mobilization. The molecular modeling as well as fluorescence studies provided further structural insight towards interaction of redox mediators on ferritin surface for electron relay.Conclusions
Reductive mobilization of iron from ferritin is dependent on the relative rate of NADH oxidation, dissolved O2 consumption and mineral core reduction, which in turn depends on E1/2 of these mediators and their interaction with ferritin.General significance
The current mechanism of in vitro iron mobilization from ferritin by using redox mediators involves different ET steps, which may help to understand the iron release pathway in vivo and to check microbial growth. 相似文献12.
Sophie Debs Amy Cohen Elham Hosseini-Beheshti Giovanna Chimini Nicholas H. Hunt Georges E.R. Grau 《Biochimica et Biophysica Acta (BBA)/General Subjects》2019,1863(2):325-331
Background
Malaria is a serious parasitic infection affecting millions of people worldwide each year. Cerebral malaria is the most severe complication of Plasmodium infections, predominantly affecting children. Extracellular vesicles are essential mediators of intercellular communication and include apoptotic bodies, microvesicles and exosomes. Microvesicle numbers increase during disease pathogenesis and inhibition of their release can prevent brain pathology and mortality.Scope of review
We explore the current knowledge on microvesicles and exosomes in cerebral malaria pathogenesis.Major conclusions
Microvesicles and exosomes are implicated in cerebral malaria pathogenesis, in the modulation of host immunity to Plasmodium, and in cell-cell communication. Blocking their production is protective in models of cerebral malaria, both in vivo and in vitro.General significance
While anti-malarial treatments exist to combat Plasmodium infections, increasing drug resistance presents a major challenge. In order to improve diagnosis and treatment outcomes, further research is required to better appreciate extracellular vesicle involvement in cerebral malaria. 相似文献13.
Manel B. Hammouda Ichrak Riahi-Chebbi Soumaya Souid Houcemeddine Othman Zohra Aloui Najet Srairi-Abid Habib Karoui Ammar Gasmi Edith M. Magnenat Timothy N.C. Wells Kenneth J. Clemetson José Neptuno Rodríguez-López Khadija Essafi-Benkhadir 《Biochimica et Biophysica Acta (BBA)/General Subjects》2018,1862(3):600-614
Background
The resistance of melanoma cells to cisplatin restricts its clinical use. Therefore, the search for novel tumor inhibitors and effective combination treatments that sensitize tumor cells to this drug are still needed. We purified macrovipecetin, a novel heterodimeric C-type lectin, from Macrovipera lebetina snake venom and investigated its anti-tumoral effect on its own or combined with cisplatin, in human melanoma cells.Methods
Biochemical characterization, in vitro cells assays such as viability, apoptosis, adhesion, migration, invasion, Western blotting and in silico analysis were used in this study.Results
Macrovipecetin decreased melanoma cell viability 100 times more than cisplatin. Interestingly, when combined with the drug, macrovipecetin enhanced the sensitivity of SK-MEL-28 cells by augmenting their apoptosis through increased expression of the apoptosis inducing factor (AIF) and activation of ERK1/2, p38, AKT and NF-κB. Moreover, macrovipecetin alone or combined with cisplatin induced the expression of TRADD, p53, Bax, Bim and Bad and down-regulated the Bcl-2 expression and ROS levels in SK-MEL-28 cells. Interestingly, these treatments impaired SK-MEL-28 cell adhesion, migration and invasion through modulating the function and expression of αvβ3 integrin along with regulating E-cadherin, vimentin, β-catenin, c-Src and RhoA expression. In silico study suggested that only the α chain of macrovipecetin interacts with a region overlapping the RGD motif binding site on this integrin.Conclusions
We validated the antitumor effect of macrovipecetin when combined, or not, with cisplatin on SK-MEL-28 cells.General significance
The presented work proposes the potential use of macrovipecetin and cisplatin in combination as an effective anti-melanoma treatment. 相似文献14.
15.
Yue Liu James Clement Ross Grant Perminder Sachdev Nady Braidy 《Biochimica et Biophysica Acta (BBA)/General Subjects》2018,1862(12):2527-2532
Background
Nicotinamide adenine dinucleotide (NAD+) is an essential pyridine nucleotide that is currently investigated as an important target to extend lifespan and health span. Age-related NAD+ depletion due to the accumulation of oxidative stress is associated with reduced energy production, impaired DNA repair and genomic instability.Scope of review
NAD+ levels can be elevated therapeutically using NAD+ precursors or through lifestyle modifications including exercise and caloric restriction. However, high amounts of NAD+ may be detrimental in cancer progression and may have deleterious immunogenic roles.Major conclusions
Standardized quantitation of NAD+ and related metabolites may therefore represent an important component of NAD+ therapy.General significance
Quantitation of NAD+ may serve dual roles not only as an ageing biomarker, but also as a diagnostic tool for the prevention of malignant disorders. 相似文献16.
Esraa Haj Yelena Losev V. Guru KrishnaKumar Edward Pichinuk Hamutal Engel Avi Raveh Ehud Gazit Daniel Segal 《Biochimica et Biophysica Acta (BBA)/General Subjects》2018,1862(7):1565-1575
Background
Alzheimer's disease (AD) is the most common neurodegenerative disorder which is characterized by the deposits of intra-cellular tau protein and extra-cellular amyloid-β (Aβ) peptides in the human brain. Understanding the mechanism of protein aggregation and finding compounds that are capable of inhibiting its aggregation is considered to be highly important for disease therapy.Methods
We used an in vitro High-Throughput Screening for the identification of potent inhibitors of tau aggregation using a proxy model; a highly aggregation-prone hexapeptide fragment 306VQIVYK311 derived from tau. Using ThS fluorescence assay we screened a library of 2401 FDA approved, bio-active and natural compounds in attempt to find molecules which can efficiently modulate tau aggregation.Results
Among the screened compounds, palmatine chloride (PC) alkaloid was able to dramatically reduce the aggregation propensity of PHF6 at sub-molar concentrations. PC was also able to disassemble preformed aggregates of PHF6 and reduce the amyloid content in a dose-dependent manner. Insights obtained from MD simulation showed that PC interacted with the key residues of PHF6 responsible for β-sheet formation, which could likely be the mechanism of inhibition and disassembly. Furthermore, PC could effectively inhibit the aggregation of full-length tau and disassemble preformed aggregates.Conclusions
We found that PC possesses “dual functionality” towards PHF6 and full-length tau, i.e. inhibit their aggregation and disassemble pre-formed fibrils.General significance
The “dual functionality” of PC is valuable as a disease modifying strategy for AD, and other tauopathies, by inhibiting their progress and reducing the effect of fibrils already present in the brain. 相似文献17.
18.
Joel Tellinghuisen 《Biochimica et Biophysica Acta (BBA)/General Subjects》2018,1862(4):886-894
Background
Questions about the reliability of parametric standard errors (SEs) from nonlinear least squares (LS) algorithms have led to a general mistrust of these precision estimators that is often unwarranted.Methods
The importance of non-Gaussian parameter distributions is illustrated by converting linear models to nonlinear by substituting eA, ln A, and 1/A for a linear parameter a. Monte Carlo (MC) simulations characterize parameter distributions in more complex cases, including when data have varying uncertainty and should be weighted, but weights are neglected. This situation leads to loss of precision and erroneous parametric SEs, as is illustrated for the Lineweaver-Burk analysis of enzyme kinetics data and the analysis of isothermal titration calorimetry data.Results
Non-Gaussian parameter distributions are generally asymmetric and biased. However, when the parametric SE is < 10% of the magnitude of the parameter, both the bias and the asymmetry can usually be ignored. Sometimes nonlinear estimators can be redefined to give more normal distributions and better convergence properties.Conclusion
Variable data uncertainty, or heteroscedasticity, can sometimes be handled by data transforms but more generally requires weighted LS, which in turn require knowledge of the data variance.General significance
Parametric SEs are rigorously correct in linear LS under the usual assumptions, and are a trustworthy approximation in nonlinear LS provided they are sufficiently small — a condition favored by the abundant, precise data routinely collected in many modern instrumental methods. 相似文献19.
Shruti Chakraborty Sayak Ganguli Aritra Chowdhury Michael Ibba Rajat Banerjee 《Biochimica et Biophysica Acta (BBA)/General Subjects》2018,1862(8):1801-1809
Background
Under oxidative stress cytoplasmic aminoacyl-tRNA synthetase (aaRSs) substrate specificity can be compromised, leading to tRNA mischarging and mistranslation of the proteome. Whether similar processes occur in mitochondria, which are major cellular sources of reactive oxygen species (ROS), is unknown. However, relaxed substrate specificity in yeast mitochondrial phenylalanyl-tRNA synthetase (ScmitPheRS) has been reported to increase tRNA mischarging and blocks mitochondrial biogenesis.Methods
Non-reducing denaturing PAGE, cysteine reactivity studies, MALDI-TOF mass spectrometry, enzyme assay, western blot, growth assay, circular dichroism, dynamic light scattering and fluorescence spectroscopy were used to study the effect of oxidative stress on ScmitPheRS activity.Results
ScmitPheRS is reversibly inactivated under oxidative stress. The targets for oxidative inactivation are two conserved cysteine residues resulting in reversible intra-molecular disulfide bridge formation. Replacement of either conserved cysteine residue increased viability during growth under oxidative stress.Conclusion
Formation of intra-molecular disulfide bridge under oxidative stress hinders the tRNAPhe binding of the enzyme, thus inactivating ScmitPheRS reversibly.General significance
The ScmitPheRS activity is compromised under oxidative stress due to formation of intra-molecular disulfide bridge. The sensitivity of ScmitPheRS to oxidation may provide a protective mechanism against error-prone translation under oxidative stress. 相似文献20.
Beata Gąsowska-Bajger Yuki Nishigaya Krystyna Hirsz-Wiktorzak Anna Rybczyńska Toshimasa Yamazaki Hubert Wojtasek 《Biochimica et Biophysica Acta (BBA)/General Subjects》2018,1862(7):1626-1634