共查询到20条相似文献，搜索用时 31 毫秒
1.
Hongbo Chen Hongxia Sun Yahong Chai Suge Zhang Aijiao Guan Qian Li Li Yao Yalin Tang 《Biochimica et Biophysica Acta (BBA)/General Subjects》2019,1863(1):31-38
Background
G-quadruplex has been viewed as a promising therapeutic target in oncology due to its potentially important roles in physiological and pathological processes. Emerging evidence suggests that the biological functions of G-quadruplexes are closely related to the binding of some proteins. Insulin-like growth factor type I (IGF-1), as a significant modulator of cell growth and development, may serve as a quadruplex-binding protein.Methods
The binding affinity and selectivity of IGF-1 to different DNA motifs in solution were measured by using fluorescence spectroscopy, Surface Plasmon Resonance (SPR), and force-induced remnant magnetization (FIRM). The effects of IGF-1 on the formation and stability of G-quadruplex structures were evaluated by circular dichroism (CD) and melting fluorescence resonance energy transfer (FRET) spectroscopy. The influence of quadruplex-specific ligands on the binding of G-quadruplexes with IGF-1 was determined by FIRM.Results
IGF-1 shows a binding specificity for G-quadruplex structures, especially the G-quadruplex structure with a parallel topology. The quadruplex-specific ligands TMPyP4 and PDS (Pyridostatin) can inhibit the interaction between G-quadruplexes and proteins.Conclusions
IGF-1 is demonstrated to selectively bind with G-quadruplex structures. The use of quadruplex-interactive ligands could modulate the binding of IGF-1 to G-quadruplexes.General significance
This study provides us with a new perspective to understand the possible physiological relationship between IGF-1 and G-quadruplexes and also conveys a strategy to regulate the interaction between G-quadruplex DNA and proteins. 相似文献2.
Direct visualization of nucleolar G-quadruplexes in live cells by using a fluorescent light-up probe
Suge Zhang Hongxia Sun Hongbo Chen Qian Li Aijiao Guan Lixia Wang Yunhua Shi Shujuan Xu Meirong Liu Yalin Tang 《Biochimica et Biophysica Acta (BBA)/General Subjects》2018,1862(5):1101-1106
Background
Direct detection of G-quadruplexes in human cells has become an important issue due to the vital role of G-quadruplex related to biological functions. Despite several probes have been developed for detection of the G-quadruplexes in cytoplasm or whole cells, the probe being used to monitor the nucleolar G-quadruplexes is still lacking.Methods
Formation of the nucleolar G-quadruplex structures was confirmed by using circular dichroism (CD) spectroscopy. The binding affinity and selectivity of Thioflavin T (ThT) towards various DNA/RNA motifs in solution and gel system were measured by using fluorescence spectroscopy and polyacrylamide gel electrophoresis (PAGE), respectively. G-quadruplex imaging in live cells was directly captured by using confocal laser scanning microscopy (CLSM).Results
Formation of the rDNA and rRNA G-quadruplex structures is demonstrated in vitro. ThT is found to show much higher affinity and selectivity towards these G-quadruplex structures versus other nucleic acid motifs either in solution or in gel system. The nucleolar G-quadruplexes in living cells are visualized by using ThT as a fluorescent probe. G-quadruplex-ligand treatments in live cells lead to sharp decrease of ThT signal.Conclusions
The natural existence of the G-quadruplexes structure in the nucleoli of living cells is directly visualized by using ThT as an indicator.General significance
The research provides substantive evidence for formation of the rRNA G-quadruplex structures, and also offers an effective probe for direct visualization of the nucleolar G-quadruplexes in living cells. 相似文献3.
4.
Hasan Alniss Bita Zamiri Melisa Khalaj Christopher E. Pearson Robert B. Macgregor 《Biochemical and biophysical research communications》2018,495(4):2410-2417
Background
An expansion of the hexanucleotide repeat (GGGGCC)n·(GGCCCC)n in the C9orf72 promoter has been shown to be the cause of Amyotrophic lateral sclerosis and frontotemporal dementia (ALS-FTD). The C9orf72 repeat can form four-stranded structures; the cationic porphyrin (TMPyP4) binds and distorts these structures.Methods
Isothermal titration calorimetry (ITC), and circular dichroism (CD) were used to study the binding of TMPyP4 to the C-rich and G-rich DNA and RNA oligos containing the hexanucleotide repeat at pH 7.5 and 0.1?M?K+.Results
The CD spectra of G-rich DNA and RNA TMPyP4 complexes showed features of antiparallel and parallel G-quadruplexes, respectively. The shoulder at 260?nm in the CD spectrum becomes more intense upon formation of complexes between TMPyP4 and the C-rich DNA. The peak at 290?nm becomes more intense in the c-rich RNA molecules, suggesting induction of an i-motif structure. The ITC data showed that TMPyP4 binds at two independent sites for all DNA and RNA molecules.Conclusions
For DNA, the data are consistent with TMPyP4 stacking on the terminal tetrads and intercalation. For RNA, the thermodynamics of the two binding modes are consistent with groove binding and intercalation. In both cases, intercalation is the weaker binding mode. These findings are considered with respect to the structural differences of the folded DNA and RNA molecules and the energetics of the processes that drive site-specific recognition by TMPyP4; these data will be helpful in efforts to optimize the specificity and affinity of the binding of porphyrin-like molecules. 相似文献5.
6.
Wataru Yoshida Mizuki Terasaka Saowalak Laddachote Isao Karube 《Biochimica et Biophysica Acta (BBA)/General Subjects》2018,1862(9):1933-1937
Background
DNA methylation at the 5-position of cytosine is an epigenetic modification of CpG dinucleotides. In addition to CpG methylation, the G-quadruplex (G4) structure has been reported as a regulator of gene expression. The identification of G4 forming sequences in CpG islands suggests an involvement of CpG-methylated G4 structures in biological processes; however, few reports have addressed the effects of CpG methylation on G4 structure.Methods
The thermostability of a methylated, 21-mer G4 structure located on the vascular endothelial growth factor (VEGF) gene promoter containing four CpG sites (C1, C6, C11, and C17) were investigated using circular dichroism (CD) spectral analysis.Results
CD melting analysis revealed that VEGF G4 was stabilized by a single CpG methylation on C11 in the presence of Na+ and Mg2+. However, either C1 or C11 methylation enhanced VEGF G4 thermal stability in the presence of K+.Conclusions
Single CpG methylation appears to enhance VEGF G4 thermostability in a manner dependent on both the CpG methylation site and cation type.General significance
These results are expected to contribute to the elucidation of the roles of CpG methylation-stabilized G4 structures in biological processes. 相似文献7.
Veronica Esposito Annapina Russo Valentina Vellecco Mariarosaria Bucci Giulia Russo Luciano Mayol Antonella Virgilio Aldo Galeone 《Biochimica et Biophysica Acta (BBA)/General Subjects》2018,1862(12):2645-2650
Background
Although the thrombin binding aptamer (TBA) is endowed with both anticoagulant and antiproliferative properties, it is possible to reduce the first and enhance the second one by suitable chemical modifications.Methods
Two oligonucleotides (TBA353 and TBA535) based on the TBA sequence (GGTTGGTGTGGTTGG) and containing inversion of polarity sites have been investigated by CD, UV and electrophoretic techniques for their ability to form G-quadruplex structures. Furthermore, their anticoagulant (PT assay), antiproliferative (MTT assay) and anti-motility (wound healing assay) properties against Calu-6 cells have been tested and compared with TBA.Results
CD, UV and electrophoresis data indicate that both ODNs are able to form G-quadruplex structures. Particularly, results suggest that TBA535 adopts a G-quadruplex structure characterized by a loop arrangement different from that of TBA. Both TBA analogues drop the anticoagulant activity. However, TBA535 is endowed with a significant antiproliferative activity against lung cancer Calu-6 cells. Importantly, both TBA and TBA535 possess a remarkable anti-motility property against the same cell line.Conclusions
Both TBA analogues TBA353 and TBA535 are able to form G-quadruplex structures with no anticoagulant activity. However only TBA535 is endowed with noteworthy antiproliferative and anti-motility properties against lung cancer Calu-6 cells.General significance
The switching from the anticoagulant to antiproliferative property can be obtained also in TBA derivatives not adopting the “chair-like” G-quadruplex structure typical of TBA. Furthermore, results have highlighted an unprecedented anti-cell-motility property of TBA and TBA535 reinforcing the potential of these ODNs as anticancer drugs. 相似文献8.
9.
10.
Sara Lago Matteo Nadai Monica Rossetto Sara N. Richter 《Biochimica et Biophysica Acta (BBA)/General Subjects》2018,1862(6):1276-1282
Background
G-quadruplexes (G4s) are nucleic acids secondary structures formed in guanine-rich sequences. Anti-G4 antibodies represent a tool for the direct investigation of G4s in cells. Surface Plasmon Resonance (SPR) is a highly sensitive technology, suitable for assessing the affinity between biomolecules. We here aimed at improving the orientation of an anti-G4 antibody on the SPR sensor chip to optimize detection of binding antigens.Methods
SPR was employed to characterize the anti-G4 antibody interaction with G4 and non-G4 oligonucleotides. Dextran-functionalized sensor chips were used both in covalent coupling and capturing procedures.Results
The use of two leading molecule for orienting the antibody of interest allowed to improve its activity from completely non-functional to 65% active. The specificity of the anti-G4 antobody for G4 structures could thus be assessed with high sensitivity and reliability.Conclusions
Optimization of the immobilization protocol for SPR biosensing, allowed us to determine the anti-G4 antibody affinity and specificity for G4 antigens with higher sensitivity with respect to other in vitro assays such as ELISA. Anti-G4 antibody specificity is a fundamental assumption for the future utilization of this kind of antibodies for monitoring G4s directly in cells.General significance
The heterogeneous orientation of amine-coupling immobilized ligands is a general problem that often leads to partial or complete inactivation of the molecules. Here we describe a new strategy for improving ligand orientation: driving it from two sides. This principle can be virtually applied to every molecule that loses its activity or is poorly immobilized after standard coupling to the SPR chip surface. 相似文献11.
Meenakshi Sharma Dinesh Kumar Krishna Mohan Poluri 《Biochimica et Biophysica Acta (BBA)/General Subjects》2018,1862(4):924-935
Background
Characterization of partially collapsed protein conformations at atomic level is a daunting task due to their inherent flexibility and conformational heterogeneity. T7 bacteriophage endolysin (T7L) is a single-domain amidase that facilitates the lysis of Gram-negative bacteria. T7L exhibits a pH-dependent structural transition from native state to partially folded (PF) conformation. In the pH range 5–3, T7L PF states display differential ANS binding characteristics.Methods
CD, fluorescence, NMR spectroscopy and lysis assays were used to investigate the structure-stability- dynamics relationships of T7L PF conformations.Results
Structural studies indicated a partial loss of secondary/tertiary structures compared to its native state. The loss in the tertiary structure and the hydrophobic core opening increases upon decrease of pH from 5 to 3. Thermal denaturation experiments delineated that the pH?5 conformation is thermally irreversible in contrast to pH?3, depicting that hydrophobic core opening is essential for thermal reversibility. Further, urea dependent unfolding features of PF state at pH?5 and 4 evidenced for a collapsed conformation at intermediate urea concentrations. Residue level studies revealed that α1-helix and β3-β4 segment of T7L are the major contributors for such a structural collapse and inherent dynamics.Conclusions
The results suggested that the low pH PF states of T7L are heterogeneous and exhibits differential structural, unfolding, thermal reversibility, and dynamic features.General significance
Unraveling the structure-stability characteristics of different endolysin conformations is essential for designing novel chimeric and engineered phage endolysins as broadband antimicrobial agents over a varied pH range. 相似文献12.
M.A. Carrascal M. Silva J.A. Ferreira R. Azevedo D. Ferreira A.M.N. Silva D. Ligeiro L.L. Santos R. Sackstein P.A. Videira 《Biochimica et Biophysica Acta (BBA)/General Subjects》2018,1862(9):2069-2080
Background
The glycan moieties sialyl-Lewis-X and/or -A (sLeX/A) are the primary ligands for E-selectin, regulating subsequent tumor cell extravasation into distant organs. However, the nature of the glycoprotein scaffolds displaying these glycans in breast cancer remains unclear and constitutes the focus of the present investigation.Methods
We isolated glycoproteins that bind E-selectin from the CF1_T breast cancer cell line, derived from a patient with ductal carcinoma. Proteins were identified using bottom-up proteomics approach by nanoLC-orbitrap LTQ-MS/MS. Data were curated using bioinformatics tools to highlight clinically relevant glycoproteins, which were validated by flow cytometry, Western blot, immunohistochemistry and in-situ proximity ligation assays in clinical samples.Results
We observed that the CF1_T cell line expressed sLeX, but not sLeA and the E-selectin reactivity was mainly on N-glycans. MS and bioinformatics analysis of the targeted glycoproteins, when narrowed down to the most clinically relevant species in breast cancer, identified CD44 glycoprotein (HCELL) and CD13 as key E-selectin ligands. Additionally, the co-expression of sLeX-CD44 and sLeX-CD13 was confirmed in clinical breast cancer tissue samples.Conclusions
Both CD44 and CD13 glycoforms display sLeX in breast cancer and bind E-selectin, suggesting a key role in metastasis development. Such observations provide a novel molecular rationale for developing targeted therapeutics.General significance
While HCELL expression in breast cancer has been previously reported, this is the first study indicating that CD13 functions as an E-selectin ligand in breast cancer. This observation supports previous associations of CD13 with metastasis and draws attention to this glycoprotein as an anti-cancer target. 相似文献13.
Bin Zhang Ronne Wee Yeh Yeo Ruenn Chai Lai Eugene Wei Kian Sim Keh Chuang Chin Sai Kiang Lim 《Cytotherapy》2018,20(5):687-696
Background aims
The immunomodulatory property of mesenchymal stromal cell (MSC) exosomes is well documented. On the basis of our previous report that MSC exosomes increased regulatory T-cell (Treg) production in mice with allogenic skin graft but not in ungrafted mice, we hypothesize that an activated immune system is key to exosome-mediated Treg production.Methods
To test our hypothesis, MSC exosomes were incubated with mouse spleen CD4+ T cells that were activated with either anti-CD3/CD28 mAbs or allogenic antigen-presenting cell (APC)-enriched spleen CD11c+ cells to determine whether production of mouse CD4+CD25+ T cells or CD4+CD25+Foxp3+ Tregs could be induced. MSC exosomes were also administered to the lethal chimeric human-SCID mouse model of graft-versus-host disease (GVHD) in which human peripheral blood mononuclear cells were infused into irradiated NSG mice to induce GVHD.Results
We report here that MSC exosome–induced production of CD4+CD25+ T cells or CD4+CD25+Foxp3+ Tregs from CD4+ T cells activated by allogeneic APC-enriched CD11C+ cells but not those activated by anti-CD3/CD28 mAbs. This induction was exosome- and APC dose–dependent. In the mouse GVHD model in which GVHD was induced by transplanted human APC-stimulated human anti-mouse CD4+ T cell effectors, MSC exosome alleviated GVHD symptoms and increased survival. Surviving exosome-treated mice had a significantly higher level of human CD4+CD25+CD127low/– Tregs than surviving mice treated with Etanercept, a tumor necrosis factor inhibitor.Conclusions
MSC exosome enhanced Treg production in vitro and in vivo through an APC-mediated pathway. 相似文献14.
Xuejing Jia Yeer Liang Chao Zhang Kai Wang Yanbei Tu Meiwan Chen Peng Li Jian-Bo Wan Chengwei He 《Biochimica et Biophysica Acta (BBA)/General Subjects》2018,1862(8):1751-1759
Background
Polysaccharides, one of the active ingredients in herbal medicine, are proved to enhance innate immunity against infections. The aim of this study is to explore the immunoregulatory ability of polysaccharides from Rhynchosia minima root in vitro and in vivo.Methods
Polysaccharide fractions of R. minima root were obtained by chromatographic column. The content of NO was measured by spectrophotometry. The levels of cytokines (tumor necrosis factor-α, TNF-α; interleukin-6, IL-6; and monocyte chemoattractant protein-1, MCP-1) were determined by enzyme-linked immuno-sorbent assay (ELISA) kits. The translocation of p65 into the nucleus was imaged by confocal microscopy. The mRNA expression of TNF-α, IL-6, and MCP-1 was determined by quantitative real-time PCR. T-lymphocyte subgroups of spleen from immunosuppressive mouse were evaluated by flow cytometry.Results
PRM3 remarkably enhanced the phagocytic ability of macrophages and promoted the release of NO and the secretion of cytokines (TNF-α, IL-6, and MCP-1) from macrophages. Simultaneously, PRM3 potently activated NF-κB signaling pathway via Toll-like receptor 4 (TLR4). In addition, PRM3 obviously increased the levels of serum cytokines, markedly up-regulated the percentages of CD3+ and CD4+ T lymphocytes and the CD4+/CD8+ ratio of splenocytes, and effectively attenuated cyclophosphamide induced immunosuppression in mice.Conclusions
PRM3 profoundly enhanced the immune function in vitro and in vivo through TLR4-NF-κB pathway and is a promising candidate of immunopotentiator which could be applied in functional foods or drugs.General significance
This study reported a polysaccharide PRM3 from R. minima root exhibited potent immunoenhancing activity and significantly alleviated cyclophosphamide-induced immunosuppression through TLR4-NF-κB pathway. 相似文献15.
I-Te Chu Chia-Chuan Wu Ta-Chau Chang 《Biochimica et Biophysica Acta (BBA)/General Subjects》2019,1863(2):418-425
Background
Mitochondrial DNA (mtDNA) mutations could lead to mitochondrial dysfunction, which plays a major role in aging, neurodegeneration, and cancer. Recently, we have highlighted G-quadruplex (G4) formation of putative G4-forming (PQF) mtDNA sequences in cells. Herein, we examine structural variation of G4 formation due to mutation of mtDNA sequences in vitro.Methods
The combined circular dichroism (CD), nuclear magnetic resonance (NMR), and polyacrylamide gel electrophoresis (PAGE) results provide complementary insights into the structural variation of the studied G-rich sequence and its mutants.Results
This study illustrates the structural diversity of mt10251, a G-rich mtDNA sequence with a 16-nt loop, (GGGTGGGAGTAGTTCCCTGCTAAGGGAGGG), including the coexistence of a hairpin structure and monomeric, dimeric, and tetrameric G4 structures of mt10251 in 20?mM K+ solution. Moreover, a single-base mutation of mt10251 can cause significant changes in terms of structural populations and polymorphism. In addition, single-base mutations of near-but-not-PQF sequences can potentially change not-G4 to G4 structures. We further found 124 modified PQF sequences due to single-base mutations of near-but-not-PQF sequences in mtDNA.Conclusions
Single-base mutations of mt10251 could make significant changes in its structural variation and some single-base mutated sequences in mtDNA could form G4 structures in vitro.General significance
We illustrate the importance of single-base mutations of DNA sequences to the change of G4 formation in vitro. The use of single-base mutations by generating the fourth G-tract and followed by selection in shortening the longest loop size in the near-but-not-PQF sequences was conducted for the G4 formation. 相似文献16.
Danfeng Shi Shuangyan Zhou Xuewei Liu Chenxi Zhao Huanxiang Liu Xiaojun Yao 《Biochimica et Biophysica Acta (BBA)/General Subjects》2018,1862(3):576-588
Background
The inhibitors blocking the interaction between programmed cell death protein 1(PD-1) and programmed death-ligand 1(PD-L1) can activate the immune response of T cell and eliminate cancer cells. The crystallographic studies have provided structural insights of the interactive interfaces between PD-L1 and its protein ligands. However, the hotspot residues on PD-L1 as well as structural and energetic basis for different protein ligands still need to be further investigated.Methods
Molecular modeling methods including molecular dynamics simulation, per-residue free energy decomposition, virtual alanine scanning mutagenesis and residue-residue contact analysis were used to qualitatively and quantitatively analyze the interactions between PD-L1 and different protein ligands.Results
The results of virtual alanine scanning mutagenesis suggest that Y56, Q66, M115, D122, Y123, R125 are the hotspot residues on PD-L1. The residue-residue contact analysis further shows that PD-1 interacts with PD-L1 mainly by F and G strands while monoclonal antibodies like avelumab and BMS-936559 mainly interact with PD-L1 by CDR2 and CDR3 loops of the heavy chain.Conclusions
A structurally similar β-hairpin peptide with 13 or 14 residues was extracted from each protein ligand and these β-hairpin peptides were found tightly binding to the putative hotspot residues on PD-L1.General significance
This study recognizes the hotspot residues on PD-L1 and uncovers the common structural and energetic basis of different protein ligands binding to PD-L1. These results will be valuable for the design of small molecule or peptide inhibitors targeting on PD-L1. 相似文献17.
Eduard V. Bocharov Dmitry M. Lesovoy Olga V. Bocharova Anatoly S. Urban Konstantin V. Pavlov Pavel E. Volynsky Roman G. Efremov Alexander S. Arseniev 《Biochimica et Biophysica Acta (BBA)/General Subjects》2018,1862(6):1410-1420
Background
Prior studies of the human growth hormone receptor (GHR) revealed a distinct role of spatial rearrangements of its dimeric transmembrane domain in signal transduction across membrane. Detailed structural information obtained in the present study allowed elucidating the bases of such rearrangement and provided novel insights into receptor functioning.Methods
We investigated the dimerization of recombinant TMD fragment GHR254–294 by means of high-resolution NMR in DPC micelles and molecular dynamics in explicit POPC membrane.Results
We resolved two distinct dimeric structures of GHR TMD coexisting in membrane-mimicking micellar environment and providing left- and right-handed helix-helix association via different dimerization motifs. Based on the available mutagenesis data, the conformations correspond to the dormant and active receptor states and are distinguished by cis-trans isomerization of Phe-Pro266 bond in the transmembrane helix entry. Molecular dynamic relaxations of the structures in lipid bilayer revealed the role of the proline residue in functionally significant rearrangements of the adjacent juxtamembrane region supporting alternation between protein-protein and protein-lipid interactions of this region that can be triggered by ligand binding. Also, the importance of juxtamembrane SS bonding for signal persistency, and somewhat unusual aspects of transmembrane region interaction with water molecules were demonstrated.Conclusions
Two alternative dimeric structures of GHR TMD attributed to dormant and active receptor states interchange via allosteric rearrangements of transmembrane helices and extracellular juxtamembrane regions that support coordination between protein-protein and protein-lipid interactions.General significance
This study provides a holistic vision of GHR signal transduction across the membrane emphasizing the role of protein-lipid interactions. 相似文献18.
Yijuan Wei Yi Lu Yanlin Zhu Weili Zheng Fusheng Guo Benqiang Yao Shuangshuang Xu Yumeng Wang Lihua Jin Yong Li 《Biochimica et Biophysica Acta (BBA)/General Subjects》2018,1862(10):2261-2270
Background
The 1,4-dihydropyridines (DHPs) are one of the most frequently prescribed classes of antihypertensive monotherapeutic agents worldwide. In addition to treating hypertension, DHPs also exert other beneficial effects, including hepatoprotective effects. However, the mechanism underlying the hepatoprotection remains unclear.Methods
Biochemical AlphaScreen and cell-based reporter assays were employed to detect the activities of DHPs towards FXR. A crystallographic analysis was adopted to study the binding modes of four DHPs in complex with FXR. Acetaminophen (APAP)-treated wild-type and FXR knockout mice were used to investigate the functional dependence of the effects of the selected DHPs on FXR.Results
A series of DHPs were uncovered as FXR ligands with different activities for FXR, suggesting FXR might serve as an alternative drug target for DHPs. The structural analysis illustrated the specific three-blade propeller binding modes of four DHPs to FXR and explained the detailed mechanisms by which DHPs bind to and are recognized by FXR. The results in mice demonstrated that cilnidipine protected the liver from APAP-induced injury in an FXR-dependent manner.Conclusions
This study reports the crystal structures of FXR in complex with four DHPs, and confirms that DHPs exert hepatoprotection by targeting FXR.General significance
Our research not only reveals valuable insight for the design and development of next-generation Ca2+ blocker drugs to provide safer and more effective treatments for cardiovascular disorders but also provides a novel and safe structural template for the development of drugs targeting FXR. Moreover, DHPs might be potentially repurposed to treat FXR-mediated diseases other than hypertension. 相似文献19.
Huaidong Zhang Qin Li Lina Wang Yan Chen 《Biochimica et Biophysica Acta (BBA)/General Subjects》2018,1862(5):1199-1208
Background
Alcohol dehydrogenases (ADHs) catalyze the reversible oxidation of alcohol using NAD+ or NADP+ as cofactor. Three ADH homologues have been identified in Komagataella phaffii GS115 (also named Pichia pastoris GS115), ADH1, ADH2 and ADH3, among which adh3 is the only gene responsible for consumption of ethanol in Komagataella phaffii GS115. However, the relationship between structure and function of mitochondrial alcohol dehydrogenase isozyme III from Komagataella phaffii GS115 (KpADH3) is still not clear yet.Methods
KpADH3 was purified, identified and characterized by multiple biophysical techniques (Nano LC-MS/MS, Enzymatic activity assay, X-ray crystallography).Results
The crystal structure of KpADH3, which was the first ADH structure from Komagataella phaffii GS115, was solved at 1.745?Å resolution. Structural analysis indicated that KpADH3 was the sole dimeric ADH structure with face-to-face orientation quaternary structure from yeast. The major structural different conformations located on residues 100–114 (the structural zinc binding loop) and residues 337–344 (the loop between α12 and β15 which covered the catalytic domain). In addition, three channels were observed in KpADH3 crystal structure, channel 2 and channel 3 may be essential for substrate specific recognition, ingress and egress, channel 1 may be the pass-through for cofactor.Conclusions
KpADH3 plays an important role in the metabolism of alcohols in Komagataella phaffii GS115, and its crystal structure is the only dimeric medium-chain ADH from yeast described so far.General significance
Knowledge of the relationship between structure and function of KpADH3 is crucial for understanding the role of KpADH3 in Komagataella phaffii GS115 mitochondrial metabolism. 相似文献20.
Qingkun Song Jun Ren Xinna Zhou Xiaoli Wang Guohong Song Amy Hobeika Yanhua Yuan Herbert Kim Lyerly 《Cytotherapy》2018,20(1):126-133