Steroid induction of nerve growth factor synthesis in cell culture

Nerve growth factor (NGF) is a peptide hormone which is necessary for the development of sympathetic neurons. Exposing a rat central nervous system glioma cell line (C-6) to the steroid hormone 17β-estradiol increases the amount of NGF secreted by these cells into the surrounding medium. This induction is highly specific to 17β-estradiol in that similar steroids do not increase NGF levels. Both NGF activity and protein levels increase upon estradiol stimulation and there is a parallel increase in NGF $\text{de}$$\text{novo}$ synthesis. The estradiol effect can be blocked with actinomycin D but not with puromycin or cycloheximide. This is the first report demonstrating regulation of NGF synthesis by a steroid hormone in a clonal cell line of glial origin. We propose this system as a model system for the study of the regulation of NGF synthesis and the isolation and analysis of putative precursors to the NGF molecule.     

Chou-Fasman analysis of the secondary structure of F and Le interferons

The Chou-Fasman method for calculating the secondary structure of $\text{F}$ and $\text{Le}$ interferons from their amino acid sequences predicts several regions of homologous structure in the two interferons. Those areas tend to be located in the middle and C- terminal ends of the molecules. Total predicted content of α helix is 55% for $\text{Le}$ interferon and 36% for $\text{F}$ interferon. Predicted β-pleated sheet residues total 33% for $\text{F}$ and 16% for $\text{Le}$.     

Neocarzinostatin chromophore: Presence of a cyclic carbonate subunit and its modification in the structure of other biologically active forms

On the basis of spectroscopic evidence, opening of a five-membered cyclic carbonate ring (1,3-dioxolan-2-one) in the C₁₅-subunit of the previously determined partial structure $\text{1}$ (Fig. 1) of the major neocarzinostatin chromophore (NCS-Chrom $\text{A}$), is proposed to account for its base-catalyzed methanolysis to NCS-Chrom $\text{C}$. NCS-Chrom $\text{B}$, apparently an authentic natural product present as a minor component in all preparations of NCS studied, was found to be formally equivalent to the hydrolysis/decarboxylation product of the cyclic carbonate functionality in NCS-Chrom $\text{A}$. The mercaptan-dependent DNA strand-scission activity, equivalent for NCS-Chrom $\text{A}$, $\text{B}$ and $\text{C}$, is independent of the integrity of the cyclic carbonate ring system and implicates a secondary site in the C₁₅-substructure for mercaptan activation.     

Nuclear Overhauser enhancement evidence for inverse temperature dependence of hydrophobic side chain proximity in the polytetrapeptide of tropoelastin

Previous studies on aqueous solutions of HCO-(Val-Pro-Gly-Gly)₄₀-Val-OMe indicated an increase in secondary structure on increasing the temperature implying a concomitant intramolecular hydrophobic association. Nuclear Overhauser enhancement (NOE) studies are reported which explicitly demonstrate an increase in association of $\text{γ}\text{CH}{}_3$ of Val and $\text{δ}\text{CH}{}_2$ of Pro protons on increasing temperature. The analogue where Ala replaces Val does not show this inverse temperature transition. These results provide direct demonstration of the “hydrophobic effect” responsible for inverse temperature transitions in aqueous systems.     

Action of neocarzinostatin on cell nuclei: release of specific chromatin

We report the first complete sequence of a P450 monoxygenase cytochrome. The P450_CAM from $\text{Pseudomonas}\text{putida}$ is a single polypeptide of 412 residues as determined from the isolated tryptic, clostripain, CNBr, and mild acid cleavage fragments. Significant molecular features, including secondary structure, are discussed.     

Secondary structure of peptides: 8. 13C n.m.r. CP/MAS investigation of solid poly(l-leucines) and poly(d-norvalines) prepared from N-carboxyanhydrides

¹³C n.m.r. CP/MAS spectra (50.3 and 75.4 MHz) of solid poly(l-lleucines) and poly(d-norvalines) measured with suitable acquisition parameters allow quantification of the composition of the secondary structure. The optimum acquisition parameters were found by systematic variation of the contact time by means of samples containing 5?0% α-helix structure. The polypeptides were prepared by primary or tertiary amine-initiated polymerizations of the corresponding amino acid NCAs and the average degrees of polymerization ($\text{DP}$) were determined by ¹H n.m.r. endgroup analysis. The mole fraction of α-helices increases with increasing $\text{DP}$; it depends on the nature of the solvent and to a lesser degree on the polymerization temperature. When prepared under identical conditions, poly(d-norvaline) samples contain more β-sheet structure than poly(l-leucine. Reprecipitation increases the α-helix content, demonstrating that a part of the original β-sheet structure is thermodynamically unstable. The presence of oligomers of $\text{DP}$ ?10 is mainly responsible for the thermodynamically stable part of the β-sheet structure. The chain growth mechanism is discussed.     

The repetitive sequence structure of component alpha DNA and its relationship to the nucleosomes of the African green monkey.

An analysis of the repeat structure of the highly repetitive sequence, component α DNA of the African green monkey, shows that the DNA contains restriction sites for EcoRI, $\text{Eco}\text{RI}{}^1$, HindIII and HaeIII. All four restriction enzyme activities indicate a basic repeat length of 176 ± 4 base-pairs. In addition to primary $\text{Eco}\text{RI}{}^1$ and HindIII sites, about 59% of the repeat sequences contain secondary $\text{Eco}\text{RI}{}^1$ sites and about 36% of the repeat sequences contain secondary HindIII sites. The secondary sites are located less than 176 base-pairs from the primary sites and their cleavage yields several complex series of minor, intermediate segments in gels of the partial $\text{Eco}\text{RI}{}^1$ or HindIII digests. Cleavage at the secondary sites yields segments shorter than the unit monomer in the limit digests. The sites for EcoRI, $\text{Eco}\text{RI}{}^1$, HindIII and HaeIII have been mapped within the repeat unit.Treatment of the monkey nuclei with micrococcal nuclease at 2 °C and in the presence of 80 mm-NaCl reveals two distinct populations of nucleosomes. One population contains bulk DNA sequences, and after cleavage with micrococcal nuclease this population yields heterogeneous segments of DNA spanning 180 to 200 base-pairs in length. The other population contains component α sequences and after cleavage with micrococcal nuclease yields homogeneous segments of component α DNA that are exact multiples of the basic sequence repeat unit of 176 base-pairs. Thus, the cleavage by micrococcal nuclease of nucleosomal arrays containing component α sequences is as regular and precise as the cleavage of the purified DNA by the restriction enzymes. The resolution of the two distinct subsets of nucleosomes in the monkey nuclei is dependent upon the conditions of ionic strength and temperature employed during the nuclear isolation and the micrococcal nuclease digestion.These observations are consistent with a phase relation between the component α repeat sequences and the associated nucleosomal proteins (Musich et al., 1977b). They are also in accord with the hypothesis that the subunit structure of constitutive heterochromatin modulates or determines the repeat sequence structure and hence, the evolution of many highly repetitive mammalian DNAs (Maio et al., 1977).     

Structure of a ribosomal 5S RNA from a mushroom, Coprinus cinereus

The nucleotide sequence of the 5S rRNA from a mushroom, $\text{Coprinus cinereus}$, was determined to be: pAUCCACGGCCAUACGACUCUGAAAGCACCGCACCGCAUCCCGUCCGAUCUGCGCAGUUAACCAGAGUGCCGCUCAGUUAGUACCACGGUGGGGGACCACGCGGGAAUCCUGGGUGCUGUGGUU. This sequence is consistent with current models for the secondary structure of 5S RNAs and indicates a very high degree of sequence conservation among the most highly evolved fungi. Sequence heterogeneity was not evident in this fungus suggesting that the more highly evolved fungi may not contain the dispersed pattern of 5S rRNA genes which have been observed in intermediate fungi such as $\text{Neurospora}$ (Selker, E.U., and Yanofsky, C. (1981) Cell $\text{24}$, 819–828.)     

Proton and carbon magnetic resonance studies of the synthetic polypentapeptide of elastin.

Proton and ¹³C magnetic resonance studies are reported on the synthetic polypentapeptide of elastin, HCO-(Val₍₁₎-Pro₍₂₎-Gly₍₃₎-Val₍₄₎-Gly₍₅₎)_n-Val-OMe, where n ∼- 18. Temperature and solvent dependence of peptide N$\text{H}$ chemical shift and solvent dependence of peptide carbonyl chemical shift were used to delineate these moieties preliminary to identification of secondary structure.Based on these studies it is proposed, for the organic solvents of dimethyl sulfoxide, methanol, and low-temperature trifluoroethanol, that dynamic hydrogen bonds form in order of decreasing frequency of occurrence between the Val₍₁₎$\text{C}$O and the Val₍₄₎ N$\text{H}$ (a β-turn), between the Gly₍₃₎ N$\text{H}$ and the Gly₍₅₎$\text{C}$O (an 11-atom, hydrogen-bonded ring), and a more limited interaction between the Gly₍₃₎$\text{C}$O and the Gly₍₅₎ N$\text{H}$ (a γ-turn).Arguments are presented that relate the conformational features proposed above to the coacervate, which is a filamentous state.     

Interchain disulfide bridges in ribonuclease BS-1

RNAase BS-1, a dimeric ribonuclease isolated from bovine seminal plasma, is made up of two identical subunits whose amino acid sequence is homologous to the sequence of bovine pancreatic RNAase A. The dimeric structure, resistant to denaturating agents, is sensitive to thiol reagents even in the absence of denaturants. The isolation and characterization of a cystine peptide containing two adjacent $\text{1}\text{2}\text{cystine}$ residues is reported. As the peptide molecular weight is halved after reductive cleavage with dithiothreitol, a structure based on two interchain disulfide bonds between the two adjacent $\text{1}\text{2}\text{cystine}$ of each subunit is proposed. The singularity of such a structure for a small enzymatic protein is discussed.     

Terbium(3 +) as a probe of nucleic acids structure. Does it alter the DNA conformation in solution?

At low ionic strength, Tb³⁺ binding strongly alters the secondary structure of DNA. Circular dichroism and electro-optical techniques are more sensitive than fluorescence to study these alterations in double-stranded DNA, at low Tb³⁺/DNA phosphate ($\text{I}\text{P}$) ratios. Both techniques yield the following conclusion: as $\text{I}\text{P}$ is increased, native and sonicated DNA undergo a transition from the B- to ψ-form, the latter being a compact structure characteristic of aggregated DNA. Our study of alkylated DNA establishes that the accessibility of N-7 guanine to Tb³⁺ is clearly required for structural alterations in an aggregated state to occur. The chelation of the phosphate group and of the N-7 guanine by Tb³⁺ simultaneously alters the geometry of the sugar-phosphate backbone and the stacking interaction between the bases in double-stranded DNA.     

The secondary attachment site for bacteriophage lambda in the proA/B gene of Escherichia coli

We have determined the nucleotide sequence of a secondary λ attachment site in $\text{pro}\text{A}\text{B}$, a site that accounts for 3% of lysogens isolated from Escherichia coli strains deleted for the primary site. Direct sequence analysis of the transducing bacteriophages carrying the left and right att junctions, as well as the recombinant pro⁺ phage reveals that the $\text{pro}\text{A}\text{B}$ site shares an 11-nucleotide interrupted homology with the core sequence of the primary site. We have compared the $\text{pro}\text{A}\text{B}$att site with other secondary attachment sites to gain insights into the structural features important for λ integration.     

Structural properties of mojave toxin of crotalus scutulatus (Mojave rattlesnake) determined by laser Raman spectroscopy.

Laser Raman Spectra were obtained on aqueous and solid samples of Mojave toxin isolated from the venom of the Mojave rattlesnake ($\text{Crotalus}\text{scutulatus}$). The Raman spectra reveal that the Mojave toxin, an acidic protein of molecular weight about 22,000, contains a predominantly α-helical secondary structure and that the tyrosyl residues, on the basis of the Raman frequencies and intensities, are exposed to the solvent. These features of the Mojave toxin distinguish it structurally from the neurotoxins of sea snake venoms. However, like the sea snake venom toxins, Mojave toxin contains four disulfide bridges and is not greatly altered in structure by removal of the aqueous solvent.     

Specific and potent inhibition of spermidine synthase by the transition-state analog,S-adenosyl-3-thio-1,8-diaminooctane

The title compound ($\text{1}\text{c}$), was designed and synthesized based on mechanistic data concerning enzyme-catalyzed alkyl transfer reactions, applied in this case to aminopropyl transferases. The inhibition by $\text{1}\text{c}$ of one such enzyme, spermidine synthase, was both potent (I₅₀ = 4 × 10^?7M) and specific. A closely related aminopropyltransferase, spermine synthase was only minimally affected by high concentrations of $\text{1}\text{c}$. Similar, although not as marked, specifity between the two aminopropyltransferases was observed with the corresponding methyl sulfonium salt, $\text{2}\text{c}$. Studies with structurally related compounds support the hypothesis that the strong inhibition of spermidine synthase by $\text{1}\text{c}$ derives from the incorporation in this compound of important features of the transition-state structure of this enzyme-catalyzed reaction.     

Specificity of human histocompatibility antigen reactive cells in vitro. Separate cell populations responsive to the products of each major histocompatibility system (MHS) haplotype

One-way mixed lymphocyte cultures were established between related cell donors A (haplotype designated $\text{a}\text{b}$) and B ($\text{a}\text{c}$). The cells from A, proliferating in response to stimulation by mitomycin treated cells from B, were eliminated from the culture by a hot pulse of ³H-thymidine. A marginal response was observed when the remaining cells from A reencountered additional stimulating cells from B, or cells from an HL-A identical sibling to B. In addition, the remaining responding cells were virtually incapable of responding to secondary stimulation by family member C ($\text{b}\text{c}$), who shared one haplotype (b) with individual A and the other haplotype (c) with the individual stimulating cell donor B. The MLC secondary stimulation response to family member D ($\text{c}\text{d}$), who differed from A by both haplotypes, but shared one haplotype with B, was reduced to approximately 50% of control values. In other experiments it was found possible to completely eliminate the response of A ($\text{a}\text{b}$) to D ($\text{c}\text{d}$) by using a combination of stimulating cells from related donors B ($\text{a}\text{b}$) and C ($\text{b}\text{c}$) in the initial hot pulse MLC.Separate populations of responding cells reactive to antigenic products of each major histocompatibility system haplotype is a likely explanation of these observations.     

Conformational studies of the α-helical proteins from wool keratin by c.d.

The conformation and conformational change of wool keratin $\text{S-}\text{carboxymethylated}$ low-sulphur proteins (SCMKA), which are α-helical fibrous proteins, have been investigated in aqueous solution by means of c.d. Comparisons of various methods proposed for c.d. analysis of protein secondary structure are made using least-squares curve-fitting of the observed c.d. spectra of SCMKA with a linear combination of the corresponding reference spectra of secondary structures. It has been found that (i) the most satisfactory results are obtained with the method¹³ which takes into account the β-turn contribution: (ii) SCMKA is 52–54% α-helical in water and has little β-form, (iii) the addition of n-propanol produces, even at higher concentrations of n-propanol, little chnage in spectra with respect to helical character in water; (iv) SCMKA undergoes a thermally-induced conformational transition from α-helix to random coil around 50 C; and (v) $\text{S-}\text{aminoethylated}$ low-sulphur proteins with positively charged protecting groups are /_~50% α-helical in water, which is similar to SCMKA, showing that the protecting groups introduced in the low-sulphur proteins are little effect upon their conformation in water     

Neocarzinostatin: Chemical characterization and partial structure of the non-protein chromophore

The molecular formula C₃₅H₃₅NO₁₂ (mol.wt. 661) is proposed for the biologically active chromophoric component of neocarzinostatin. The partial structure $\text{2}$ is proposed based on ${}^1\text{H}$ NMR and mass spectral data and consists, in part, of a 2,6-dideoxy-2-methylamino-galactose moiety and a naphthoic acid derivative. Special treatments required to obtain spectral data of the labile chromophore are described.     

Analysis and prediction of the packing of α-helices against a β-sheet in the tertiary structure of globular proteins

The packing of α-helices and β-sheets in six $\text{α}\text{β}$ proteins (e.g. flavodoxin) has been analysed. The results provide the basis for a computer algorithm to predict the tertiary structure of an $\text{α}\text{β}$ protein from its amino acid sequence and actual assignment of secondary structure.The packing of an individual α-helix against a β-sheet generally involves two adjacent ± 4 rows of non-polar residues on the α-helix at the positions i, i + 4, i + 8, i + 1, i + 5, i + 9. The pattern of interacting β-sheet residues results from the twisted nature of the sheet surface and the attendant rotation of the side-chains. At a more detailed level, four of the α-helical residues (i + 1, i + 4, i + 5 and i + 8) form a diamond that surrounds one particular β-sheet residue, generally isoleucine, leucine or valine. In general, the α-helix sits 10 Å above the sheet and lies parallel to the strand direction.The prediction follows a combinational approach. First, a list of possible β-sheet structures (10⁶ to 10¹⁴) is constructed by the generation of all β-sheet topologies and β-strand alignments. This list is reduced by constraints on topology and the location of non-polar residues to mediate the sheet/helix packing, and then rank-ordered on the extent of hydrogen bonding. This algorithm was uniformly applied to 16 $\text{α}\text{β}$ domains in 13 proteins. For every structure, one member of the reduced list was close to the crystal structure; the root-mean-square deviation between equivalenced C^α atoms averaged 5.6 Å for 100 residues. For the $\text{α}\text{β}$ proteins with pure parallel β-sheets, the total number of structures comparable to or better than the native in terms of hydrogen bonds was between 1 and 148. For proteins with mixed β-sheets, the worst case is glyceraldehyde-3-phosphate dehydrogenase, where as many as 3800 structures would have to be sampled. The evolutionary significance of these results as well as the potential use of a combinatorial approach to the protein folding problem are discussed.     

Three-dimensional structure at 5 Å resolution of cytosolic aspartate transaminase from chicken heart

An X-ray study of orthorhombic crystals of cytosolic aspartate transaminase from chicken heart has been carried out at 5 Å resolution. The crystals belong to space group P2₁2₁2₁, with unit cell dimensions $\text{a = 62.7}\text{A}\text{?}\text{, b = 118.1}\text{A}\text{?}\text{, c = 124.5}\text{A}\text{?}$. The electron density map has been calculated on the basis of five heavy-atom derivatives. The model of the molecule derived from this map revealed clearly two subunits of similar structure related by a non-crystallographic dyad. The secondary structure of the protein comprises nine helical segments per subunit.The enzyme has been shown to be catalytically active in the crystal form. Removal of the coenzyme from the crystals made it possible to derive from the difference Fourier map the position of the active site in the enzyme molecule.Significant conformational changes have been observed which accompany the interconversion of intermediates of the enzymic reaction.