Minimal DNA requirement for topoisomerase II-mediated cleavage in vitro

The minimal DNA requirement for topoisomerase II-mediated DNA cleavage in vitro was determined by analyzing the interaction of the enzyme with sets of DNA substrates varying successively by single bases at the 5'- or 3'-end of either strand. A 16-base pair double-stranded region was established as the minimal duplex region required for topoisomerase II cleavage activity. The region was located symmetrically around the 4-base staggered cleavage site. Topoisomerase II-mediated cleavage within the 16-base pair core duplex, however, required single-stranded regions flanking the duplex to either the 5'- or 3'-sides, or an extension at both ends of the duplex with 1 or more base pairs.     

A novel bipartite mode of binding of M. smegmatis topoisomerase I to its recognition sequence

We have investigated interaction of Mycobacterium smegmatis topoisomerase I at its specific recognition sequence. DNase I footprinting demonstrates a large region of protection on both the scissile and non-scissile strands of DNA. Methylation protection and interference analyses reveal base-specific contacts within the recognition sequence. Missing contact analyses reveal additional interactions with the residues in both single and double-stranded DNA, and hence underline the role for the functional groups associated with those bases. These interactions are supplemented by phosphate contacts in the scissile strand. Conformation specific probes reveal protein-induced structural distortion of the DNA helix at the T-A-T-A sequence 11 bp upstream to the recognition sequence. Based on these footprinting analyses that define parameters of topoisomerase I-DNA interactions, a model of topoisomerase I binding to its substrate is presented. Within the large protected region of 30 bp, the enzyme makes direct contact at two locations in the scissile strand, one around the cleavage site and the other 8-12 bases upstream. Thus the enzyme makes asymmetric recognition of DNA and could carry out DNA relaxation by either of the two proposed mechanisms: enzyme bridged and restricted rotation.     

Specific DNA cleavage and binding by vaccinia virus DNA topoisomerase I

Cleavage of a defined linear duplex DNA by vaccinia virus DNA topoisomerase I was found to occur nonrandomly and infrequently. Approximately 12 sites of strand scission were detected within the 5372 nucleotides of pUC19 DNA. These sites could be classified as having higher or lower affinity for topoisomerase based on the following criteria. Higher affinity sites were cleaved at low enzyme concentration, were less sensitive to competition, and were most refractory to religation promoted by salt, divalent cations, and elevated temperature. Cleavage at lower affinity sites required higher enzyme concentration and was more sensitive to competition and induced religation. Cleavage site selection correlated with a pentameric sequence motif (C/T)CCTT immediately preceding the site of strand scission. Noncovalent DNA binding by topoisomerase predominated over covalent adduct formation, as revealed by nitrocellulose filter-binding studies. The noncovalent binding affinity of vaccinia topoisomerase for particular subsegments of pUC19 DNA correlated with the strength and/or the number of DNA cleavage sites contained therein. Thus, cleavage site selection is likely to be dictated by specific noncovalent DNA-protein interactions. This was supported by the demonstration that a mutant vaccinia topoisomerase (containing a Tyr----Phe substitution at the active site) that was catalytically inert and did not form the covalent intermediate, nevertheless bound DNA with similar affinity and site selectivity as the wild-type enzyme. Noncovalent binding is therefore independent of competence in transesterification. It is construed that the vaccinia topoisomerase is considerably more stringent in its cleavage and binding specificity for duplex DNA than are the cellular type I enzymes.     

Base mutation analysis of topoisomerase II-idarubicin-DNA ternary complex formation. Evidence for enzyme subunit cooperativity in DNA cleavage.

Antitumor drugs, such as anthracyclines, interfere with mammalian DNA topoisomerase II by forming a ternary complex, DNA-drug-enzyme, in which DNA strands are cleaved and covalently linked to the enzyme. In this work, a synthetic 36-bp DNA oligomer derived from SV40 and mutated variants were used to determine the effects of base mutations on DNA cleavage levels produced by murine topoisomerase II with and without idarubicin. Although site competition could affect cleavage levels, mutation effects were rather similar among several cleavage sites. The major sequence determinants of topoisomerase II DNA cleavage without drugs are up to five base pairs apart from the strand cut, suggesting that DNA protein contacts involving these bases are particularly critical for DNA site recognition. Cleavage sites with adenines at positions -1 were detected without idarubicin only under conditions favouring enzyme binding to DNA, showing that these sites are low affinity sites for topoisomerase II DNA cleavage and/or binding. Moreover, the results indicated that the sequence 5'-(A)TA/(A)-3' (the slash indicates the cleaved bond, parenthesis indicate conditioned preference) from -3 to +1 positions constitutes the complete base sequence preferred by anthracyclines. An important finding was that mutations that improve the fit to the above consensus on one strand can also increase cleavage on the opposite strand, suggesting that a drug molecule may effectively interact with one enzyme subunit only and trap the whole dimeric enzyme. These findings documented that DNA recognition by topoisomerase II may occur at one or the other strand, and not necessarily at both of them, and that the two subunits can act cooperatively to cleave a double helix.     

Minimal DNA duplex requirements for topoisomerase I-mediated cleavage in vitro

The minimal DNA duplex requirements for topoisomerase I-mediated cleavage at a specific binding sequence were determined by analyzing the interaction of the enzyme with sets of DNA substrates varying successively by single nucleotides at the 5'- or 3' end of either strand. Topoisomerase I cleavage experiments showed a minimal region of nine nucleotides on the scissile strand and five nucleotides on the noncleaved strand. On the scissile strand, seven of the nine nucleotides were situated upstream to the cleavage site, while all five nucleotides required on the non-cleaved strand were located to this side. The results suggested that topoisomerase I bound tightly to this region, stabilizing the DNA duplex extensively. On minimal substrates which were partially single-stranded downstream to the cleavage site, cleavage was suicidal, that is, the enzyme was able to cleave the substrates, but unable to perform the final religation.     

Mechanism of strand passage by Escherichia coli topoisomerase I. The role of the required nick in catenation and knotting of duplex DNA

We studied the interaction between topoisomerase I and a nicked DNA substrate to determine how the nick permits Escherichia coli topoisomerase I to catenate and knot duplex DNA rings. The presence of just a single nick in a 6600-base pair DNA increased the amount of DNA bound to topoisomerase I by 6-fold. The enzyme acts at the nick, as shown by linearization of nicked circles and covalent attachment of an enzyme molecule opposite the nick. DNA breaks are also introduced by the enzyme at sites not opposite to a nick, but three orders of magnitude less efficiently. The break induced by the enzyme is within several base pairs of the nick and on the complementary strand, but the exact site cut is dictated by DNA sequence requirements. Because these sequence requirements are identical to those for cutting of single-stranded DNA, we conclude that the enzyme stabilizes a denatured region at the nick. Breaks in single-stranded DNA occur 98% of the time when a C residue is four bases to the 5' side unless G is adjacent and 5' to the break. For a DNA circle nicked at a unique location, the efficiency of DNA breakage opposite the nick correlates with the rate of catenation. We present a unified model for the relaxation, catenation, and knotting reactions of topoisomerase I in which the enzyme induces a break in a single-stranded region, but bridges that break with covalent and noncovalent interactions and allows passage of one duplex or single-stranded DNA segment.     

Site-specific interaction of vaccinia virus topoisomerase I with duplex DNA. Minimal DNA substrate for strand cleavage in vitro.

Purified vaccinia virus DNA topoisomerase I forms a cleavable complex with duplex DNA at a conserved sequence element 5'(C/T)CCTTdecreases in the incised DNA strand. DNase I footprint studies show that vaccinia topoisomerase protects the region around the site of covalent adduct formation from nuclease digestion. On the cleaved DNA strand, the protected region extends from +13 to -13 (+1 being the site of cleavage). On the noncleaved strand, the protected region extends from +13 to -9. Similar nuclease protection is observed for a mutant topoisomerase (containing a Tyr ---- Phe substitution at the active site amino acid 274) that is catalytically inert and does not form the covalent intermediate. Thus, vaccinia topoisomerase is a specific DNA binding protein independent of its competence in transesterification. By studying the cleavage of a series of 12-mer DNA duplexes in which the position of the CCCTTdecreases motif within the substrate is systematically phased, the "minimal" substrate for cleavage has been defined; cleavage requires six nucleotides upstream of the cleavage site and two nucleotides downstream of the site. An analysis of the cleavage of oligomer substrates mutated singly in the CCCTT sequence reveals a hierarchy of mutational effects based on position within the pentamer motif and the nature of the sequence alteration.     

DNA sequence recognition by a eukaryotic sequence-specific endonuclease, Endo.SceI, from Saccharomyces cerevisiae

A eukaryotic sequence-specific endonuclease, Endo.SceI, causes sequence-specific double-stranded scission of double-stranded DNA to produce cohesive ends with four bases protruding at the 3' termini. Unlike in the case of restriction enzymes, an asymmetric 26-base pair consensus sequence was found around the cleavage site for Endo.SceI instead of a common sequence. We analyzed the base pairs that interacted with Endo.SceI on the recognition of its cleavage sites. A region comprising -10 through +16 base pairs from the center of the cleavage site was shown to be essential and sufficient for the sequence-specific cutting with Endo.SceI by experiments involving synthesized DNAs. Methylation interference experiments indicate that bases in the region comprising the +7 through +14 base pairs is involved in close contact with Endo.SceI in its recognition of the cleavage site. This +7 through +14-base pair region overlaps the most stringently conserved sequence in the consensus sequence for the cleavage site, suggesting that this region constitutes the core for the recognition by Endo.SceI.     

Flexibility at Gly-194 is required for DNA cleavage and relaxation activity of Escherichia coli DNA topoisomerase I

The proposed mechanism of type IA DNA topoisomerase I includes conformational changes by the single enzyme polypeptide to allow binding of the G strand of the DNA substrate at the active site, and the opening or closing of the "gate" created on the G strand of DNA to the passing single or double DNA strand(s) through the cleaved G strand DNA. The shifting of an alpha helix upon G strand DNA binding has been observed from the comparison of the type IA DNA topoisomerase crystal structures. Site-directed mutagenesis of the strictly conserved Gly-194 at the N terminus of this alpha helix in Escherichia coli DNA topoisomerase I showed that flexibility around this glycine residue is required for DNA cleavage and relaxation activity and supports a functional role for this hinge region in the enzyme conformational change.     

Site-specific DNA cleavage by vaccinia virus DNA topoisomerase I. Role of nucleotide sequence and DNA secondary structure.

Cleavage of linear duplex DNA by purified vaccinia virus DNA topoisomerase I occurs at a conserved sequence element (5'-C/T)CCTT decreases) in the incised DNA strand. Oligonucleotides spanning the high affinity cleavage site CCCTT at nucleotide 2457 in pUC19 DNA are cleaved efficiently in vitro, but only when hybridized to a complementary DNA molecule. As few as 6 nucleotides proximal to the cleavage site and 6 nucleotides downstream of the site are sufficient to support exclusive cleavage at the high affinity site (position +1). Single nucleotide substitutions within the consensus pentamer have deleterious effects on the equilibria of the topoisomerase binding and DNA cleavage reactions. The effects of base mismatch within the pentamer are more dramatic than are the effects of mutations that preserve base complementarity. Competition experiments indicate that topoisomerase binds preferentially to DNA sites containing the wild-type pentamer element. Single-stranded DNA containing the sequence CCCTT in the cleaved stand is a more effective competitor than is single-stranded DNA containing the complementary sequence in the noncleaved strand.     

Nuclease protection by Drosophila DNA topoisomerase II. Enzyme/DNA contacts at the strong topoisomerase II cleavage sites

A DNA consensus sequence for topoisomerase II cleavage sites was derived previously based on a statistical analysis of the nucleotide sequences around 16 sites that can be efficiently cleaved by Drosophila topoisomerase II (Sander, M., and Hsieh, T. (1985) Nucleic Acids Res. 13, 1057-1072). A synthetic 21-mer DNA sequence containing this cleavage consensus sequence was cloned into a plasmid vector, and DNA topoisomerase II can cleave this sequence at the position predicted by the cleavage consensus sequence. DNase I footprint analysis showed that topoisomerase II can protect a region of approximately 25 nucleotides in both strands of the duplex DNA, with the cleavage site located near the center of the protected region. Similar correlation between the DNase I footprints and strong topoisomerase II cleavage sites has been observed in the intergenic region of the divergent HSP70 genes. This analysis therefore suggests that the strong DNA cleavage sites of Drosophila topoisomerase II likely correspond to specific DNA-binding sites of this enzyme. Furthermore, the extent of DNA contacts made by this enzyme suggests that eucaryotic topoisomerase II, in contrast to bacterial DNA bacterial DNA gyrase, cannot form a complex with extensive DNA wrapping around the enzyme. The absence of DNA wrapping is probably the mechanistic basis for the lack of DNA supercoiling action for eucaryotic topoisomerase II.     

Local base sequence preferences for DNA cleavage by mammalian topoisomerase II in the presence of amsacrine or teniposide.

Several classes of antitumor drugs are known to stabilize topoisomerase complexes in which the enzyme is covalently bound to a terminus of a DNA strand break. The DNA cleavage sites generally are different for each class of drugs. We have determined the DNA sequence locations of a large number of drug-stimulated cleavage sites of topoisomerase II, and find that the results provide a clue to the possible structure of the complexes and the origin of the drug-specific differences. Cleavage enhancements by VM-26 and amsacrine (m-AMSA), which are representative of different classes of topoisomerase II inhibitors, have strong dependence on bases directly at the sites of cleavage. The preferred bases were C at the 3' terminus for VM-26 and A at the 5' terminus for m-AMSA. Also, a region of dyad symmetry of 12 to 16 base pairs was detected about the enzyme cleavage positions. These results are consistent with those obtained with doxorubicin, although in the case of doxorubicin, cleavage requires the presence of an A at the 3' terminus of at least one the pair of breaks that constitute a double-strand cleavage (Capranico et al., Nucleic Acids Res., 1990, 18: 6611). These findings suggest that topoisomerase II inhibitors may stack with one or the other base pair flanking the enzyme cleavage sites.     

Characterization of an altered DNA catalysis of a camptothecin-resistant eukaryotic topoisomerase I.

We investigated topoisomerase I activity at a specific camptothecin-enhanced cleavage site by use of a partly double-stranded DNA substrate. The cleavage site belongs to a group of DNA topoisomerase I sites which is only efficiently cleaved by wild-type topoisomerase I (topo I-wt) in the presence of camptothecin. With a mutated camptothecin-resistant form of topoisomerase I (topo I-K5) previous attempts to reveal cleavage activity at this site have failed. On this basis it was questioned whether the mutant enzyme has an altered DNA sequence recognition or a changed rate of catalysis at the site. Utilizing a newly developed assay system we demonstrate that topo I-K5 not only recognizes and binds to the strongly camptothecin-enhanced cleavage site but also has considerable cleavage/religation activity at this particular DNA site. Thus, topo I-K5 has a 10-fold higher rate of catalysis and a 10-fold higher affinity for DNA relative to topo I-wt. Our data indicate that the higher cleavage/religation activity of topo I-K5 is a result of improved DNA binding and a concomitant shift in the equilibrium between cleavage and religation towards the religation step. Thus, a recently identified point mutation which characterizes the camptothecin-resistant topo I-K5 has altered the enzymatic catalysis without disturbing the DNA sequence specificity of the enzyme.     

Sequence specificity of DNA topoisomerase I in the presence and absence of camptothecin.

Previously, we have demonstrated that in Tetrahymena DNA topoisomerase I has a strong preference in situ for a hexadecameric sequence motif AAGACTTAGAAGAAAAAATTT present in the non-transcribed spacers of r-chromatin. Here we characterize more extensively the interaction of purified topoisomerase I with specific hexadecameric sequences in cloned DNA. Treatment of topoisomerase I-DNA complexes with strong protein denaturants results in single strand breaks and covalent linkage of DNA to the 3' end of the broken strand. By mapping the position of the resulting nicks, we have analysed the sequence-specific interaction of topoisomerase I with the DNA. The experiments demonstrate that: the enzyme cleaves specifically between the sixth and seventh bases in the hexadecameric sequence; a single base substitution in the recognition sequence may reduce the cleavage extent by 95%; the sequence specific cleavage is stimulated 8-fold by divalent cations; 30% of the DNA molecules are cleaved at the hexadecameric sequence while no other cleavages can be detected in the 1.6-kb fragment investigated; the sequence specific cleavage is increased 2- to 3-fold in the presence of the antitumor drug camptothecin; at high concentrations of topoisomerase I, the cleavage pattern is altered by camptothecin; the equilibrium dissociation constant for interaction of topoisomerase I and the hexadecameric sequence can be estimated as approximately 10(-10) M.     

Eukaryotic topoisomerase I-DNA interaction is stabilized by helix curvature.

The influence of DNA structure on topoisomerase I-DNA interaction has been investigated using a high affinity binding site and mutant derivatives thereof. Parallel determinations of complex formation and helix structure in the absence of superhelical stress suggest that the interaction is intensified by stable helix curvature. Previous work showed that a topoisomerase I binding site consists of two functionally distinct subdomains. A region located 5' to the topoisomerase I cleavage site is essential for binding. The region 3' to the cleavage site is covered by the enzyme, but not essential. We report here that the helix conformation of the latter region is an important modulator of complex formation. Thus, complex formation is markedly stimulated, when an intrinsically bent DNA segment is installed in this region. A unique pattern of phosphate ethylation interferences in the 3'-part of the binding site indicates that sensing of curvature involves backbone contacts. Since dynamic curvature in supercoiled DNA may substitute for stable curvature, our findings suggest that topoisomerase I is able to probe DNA topology by assessment of writhe, rather than twist.     

Bacteriophage P1 Cre-loxP site-specific recombination. Site-specific DNA topoisomerase activity of the Cre recombination protein

Site-specific recombination in bacteriophage P1 occurs between two loxP sites in the presence of the Cre recombination protein. The structure of the 34-base pair loxP site consists of two 13-base pair inverted repeats separated by an 8-base pair spacer region. A mutation in the loxP site has been constructed which deletes one of the internal bases of the spacer region at the axis of dyad symmetry. This mutant loxP site shows a 10-fold reduction in recombination activity with a wild-type site both in vivo and in vitro. This low level of intramolecular recombination between a wild-type loxP site and the mutant loxP501 site is observed in vitro only when the DNA substrate is supercoiled. The majority of the supercoiled substrate is relaxed by the Cre protein, and on longer incubations, single-stranded nicks accumulate in the DNA. We have determined that these nicks occur in both the wild-type and the mutant sites. The positions of these nicks correspond to the positions of cleavage found during recombination of two wild-type sites, suggesting that the Cre protein is attempting to carry out recombination with the mutant site but most of the time this reaction is abortive. We have determined that the Cre protein relaxes a supercoiled topoisomer of a DNA substrate containing one wild-type site and one mutant site to yield a distribution of topoisomers whose linking numbers differ by steps of one, indicating that Cre can act as a type I topoisomerase.     

Requirements for noncovalent binding of vaccinia topoisomerase I to duplex DNA.

Vaccinia DNA topoisomerase binds duplex DNA and forms a covalent adduct at sites containing a conserved sequence element 5'(C/T)CCTT decreases in the scissile strand. Distinctive aspects of noncovalent versus covalent interaction emerge from analysis of the binding properties of Topo(Phe-274), a mutated protein which is unable to cleave DNA, but which binds DNA noncovalently. Whereas DNA cleavage by wild type enzyme is most efficient with 'suicide' substrates containing fewer than 10 base pairs distal to the scissile bond, optimal noncovalent binding by Topo(Phe-274) requires at least 10-bp of DNA 3' of the cleavage site. Thus, the region of DNA flanking the pentamer motif serves to stabilize the noncovalent topoisomerase-DNA complex. This result is consistent with the downstream dimensions of the DNA binding site deduced from nuclease footprinting. Topo(Phe-274) binds to duplex DNA lacking the consensus pentamer with 7-10-fold lower affinity than to CCCTT-containing DNA.     

Sequence specific interaction of Mycobacterium smegmatis topoisomerase I with duplex DNA.

We have identified strong topoisomerase sites (STS) for Mycobacteruim smegmatis topoisomerase I in double-stranded DNA context using electrophoretic mobility shift assay of enzyme-DNA covalent complexes. Mg2+, an essential component for DNA relaxation activity of the enzyme, is not required for binding to DNA. The enzyme makes single-stranded nicks, with transient covalent interaction at the 5'-end of the broken DNA strand, a characteristic akin to prokaryotic topoisomerases. More importantly, the enzyme binds to duplex DNA having a preferred site with high affinity, a property similar to the eukaryotic type I topoisomerases. The preferred cleavage site is mapped on a 65 bp duplex DNA and found to be CG/TCTT. Thus, the enzyme resembles other prokaryotic type I topoisomerases in mechanistics of the reaction, but is similar to eukaryotic enzymes in DNA recognition properties.     

DNA topoisomerase III from the hyperthermophilic archaeon Sulfolobus solfataricus with specific DNA cleavage activity

We report the production, purification, and characterization of a type IA DNA topoisomerase, previously designated topoisomerase I, from the hyperthermophilic archaeon Sulfolobus solfataricus. The protein was capable of relaxing negatively supercoiled DNA at 75 degrees C in the presence of Mg2+. Mutation of the putative active site Tyr318 to Phe318 led to the inactivation of the protein. The S. solfataricus enzyme cleaved oligonucleotides in a sequence-specific fashion. The cleavage occurred only in the presence of a divalent cation, preferably Mg2+. The cofactor requirement of the enzyme was partially satisfied by Cu2+, Co2+, Mn2+, Ca2+, or Ni2+. It appears that the enzyme is active with a broader spectrum of metal cofactors in DNA cleavage than in DNA relaxation (Mg2+ and Ca2+). The enzyme-catalyzed oligonucleotide cleavage required at least 7 bases upstream and 2 bases downstream of the cleavage site. Analysis of cleavage by the S. solfataricus enzyme on a set of oligonucleotides revealed a consensus cleavage sequence of the enzyme: 5'-G(A/T)CA(T)AG(T)G(A)X / XX-3'. This sequence bears more resemblance to the preferred cleavage sites of topoisomerases III than to those of topoisomerases I. Based on these data and sequence analysis, we designate the enzyme S. solfataricus topoisomerase III.