Is a single nucleotide polymorphism a risk factor for lung cancer in the matrix metalloproteinase-2 promoter?

We aimed to investigate the association of polymorphism frequencies of MMP-2 C1306T and MMP-2 plasma enzyme activity in lung cancer patients. In this study 300 genomic DNA (200 lung cancer patients + 100 no lung cancer) were analyzed. Polymorphisms were determined by using polymerase chain reaction-restriction fragment length polymorphism (RFLP) and electrophoresis. Plasma MMP-2 enzyme activity levels were measured by using ELISA. Sex, asbestos expose and smoking might be risk factors for lung cancer. The frequencies of C1306T genotypes in controls CC 65%, CT 32%, TT 3% and in patients CC 61%, CT 37%, TT2 % were found. It was determined that CC genotype frequency increase significantly in patients and controls. Plasma MMP-2 enzyme activity levels were increased in lung cancer patients according to controls. Finally, we claimed that determining of MMP-2 enzyme level can be used as a marker in lung cancer.     

Modifying risk of developing lung cancer by changing habits of cigarette smoking.

Data from a hospital based case-control study of lung cancer in Western Europe were used to examine changes in the risk of developing lung cancer after changes in habits of cigarette smoking. Only data for subjects who had smoked regularly at some time in their lives were included. The large size of the study population (7181 patients and 11 006 controls) permitted precise estimates of the effect of giving up smoking. Risks of developing lung cancer for people who had given up smoking 10 or more years before interview were less than half of those for people who continued to smoke. The reduction in risk was seen in men and women and in former smokers of both filter and non-filter cigarettes but varied by duration of smoking habit before giving up. The protective effect of giving up became progressively greater with shorter duration of smoking habit. The risks after not smoking for 10 years for both men and women who had previously smoked for less than 20 years were roughly the same as those for lifelong non-smokers. Reducing the number of cigarettes smoked a day or switching from non-filter to filter cigarettes also lowered the risk of developing lung cancer but not to the extent associated with giving up smoking.     

Haptoglobin groups and lung cancer

Haptoglobin groups were investigated in 309 patients with primary lung cancer divided by sex, smoking habits and tumor type. Patients with squamous epithelial cancer and oat-cell cancer showed no significant difference from normal controls. Among patients with pulmonary adenocarcinoma the frequency of the Hp 2-2 type was significantly (p less than 0.05) lower compared to the controls, with a corresponding increase of the Hp 1-1 and Hp 2-1 types. This difference was more pronounced (p less than 0.025) among females with pulmonary adenocarcinoma.     

Smoking, green tea consumption, genetic polymorphisms in the insulin-like growth factors and lung cancer risk

Insulin-like growth factors (IGFs) are mediators of growth hormones; they have an influence on cell proliferation and differentiation. In addition, IGF-binding protein (IGFBP)-3 could suppress the mitogenic action of IGFs. Interestingly, tea polyphenols could substantially reduce IGF1 and increase IGFBP3. In this study, we evaluated the effects of smoking, green tea consumption, as well as IGF1, IGF2, and IGFBP3 polymorphisms, on lung cancer risk. Questionnaires were administered to obtain the subjects' characteristics, including smoking habits and green tea consumption from 170 primary lung cancer cases and 340 healthy controls. Genotypes for IGF1, IGF2, and IGFBP3 were identified by polymerase chain reaction. Lung cancer cases had a higher proportion of smoking, green tea consumption of less than one cup per day, exposure to cooking fumes, and family history of lung cancer than controls. After adjusting the confounding effect, an elevated risk was observed in smokers who never drank green tea, as compared to smokers who drank green tea more than one cup per day (odds ratio (OR) = 13.16, 95% confidence interval (CI) = 2.96-58.51). Interaction between smoking and green tea consumption on lung cancer risk was also observed. Among green tea drinkers who drank more than one cup per day, IGF1 (CA)(19)/(CA)(19) and (CA)(19)/X genotypes carriers had a significantly reduced risk of lung cancer (OR = 0.06, 95% CI = 0.01-0.44) compared with IGF1 X/X carriers. Smoking-induced pulmonary carcinogenesis could be modulated by green tea consumption and their growth factor environment.     

Calculation of the 1995 lung cancer incidence in the Netherlands and Sweden caused by smoking and radon: risk implications for radon

A two-mutation carcinogenesis model was used to calculate the expected lung cancer incidence caused by both smoking and exposure to radon in two populations, i.e. those of the Netherlands and Sweden. The model parameters were taken from a previous analysis of lung cancer in smokers and uranium miners and the model was applied to the two populations taking into account the smoking habits and exposure to radon. For both countries, the smoking histories and indoor radon exposure data for the period 1910-1995 were reconstructed and used in the calculations. Compared with the number of lung cancer cases observed in 1995 among both males and females in the two countries, the calculations show that between 72% and 94% of the registered lung cancer cases may be attributable to the combined effects of radon and smoking. In the Netherlands, a portion of about 4% and in Sweden, a portion of about 20% of the lung cancer cases (at ages 0-80 years) may be attributable to radon exposure, the numbers for males being slightly lower than for females. In the Netherlands, the proportions of lung cancers attributable to smoking are 91% for males and 71% for females; in Sweden, the figures are 70% and 56%, respectively. The risk from radon exposure is dependent on gender and cigarette smoking: the excess absolute risk for continuous exposure to 100 Bq m-3 ranges between 0.003 and 0.006 and compares well with current estimates, e.g. 0.0043 of the International Commission on Radiological Protection (ICRP). The excess relative risk for continuous exposure to 100 Bq m-3 shows a larger variation, ranging generally between 0.1 for smokers and 1.0 for non-smokers. The results support the assumption that exposure to (indoor) radon, even at a level as low as background radiation, causes lung cancer proportional to the dose and is consistent with risk factors derived from the miners data.     

Radon, smoking and lung cancer risk: results of a joint analysis of three European case-control studies among uranium miners

A combined analysis of three case-control studies nested in three European uranium miner cohorts was performed to study the joint effects of radon exposure and smoking on lung cancer death risk. Occupational history and exposure data were available from the cohorts. Smoking information was reconstructed using self-administered questionnaires and occupational medical archives. Linear excess relative risk models adjusted for smoking were used to estimate the lung cancer risk associated with radon exposure. The study includes 1046 lung cancer cases and 2492 controls with detailed radon exposure data and smoking status. The ERR/WLM adjusted for smoking is equal to 0.008 (95% CI: 0.004-0.014). Time since exposure is shown to be a major modifier of the relationship between radon exposure and lung cancer risk. Fitting geometric mixture models yielded arguments in favor of a sub-multiplicative interaction between radon and smoking. This combined study is the largest case-control study to investigate the joint effects of radon and smoking on lung cancer risk among miners. The results confirm that the lung carcinogenic effect of radon persists even when smoking is adjusted for, with arguments in favor of a sub-multiplicative interaction between radon and smoking.     

Comparative Assessment of Selected Metals in the Scalp Hair and Nails of Lung Cancer Patients and Controls

Lung cancer is seriously threatening human health and exposure to trace metals is the most important aetiology for lung cancer. Selected essential/toxic metals (Ca, Mg, Na, K, Fe, Zn, Cu, Sr, Li, Co, Mn, Ni, Cr, Cd and Pb) are measured in the scalp hair and nails of lung cancer patients and controls by atomic absorption spectrophotometric method employing nitric acid-perchloric acid-based wet digestion. Average concentrations of Pb, Cd, Mn, Co and Cu are found to be significantly higher (p?<?0.05) in the scalp hair and nails of lung cancer patients compared with the controls, however, appreciably higher concentrations of Zn, Ca, Na, Mg and Cr are noted in the scalp hair of the controls. Most of the metal levels reveal higher dispersion and asymmetry in the scalp hair/nails of the patients compared with the controls. Average metal levels are also compared to investigate probable differences based on sex, abode, food and smoking habits. The correlation study shows significantly diverse mutual variations of the metals in the scalp hair and nails of the patients and controls. Considerable variations in the metal levels are also noted for various stages and types of lung cancer (adenocarcinoma, squamous cell carcinoma, large cell carcinoma and small cell lung cancer). Multivariate apportionment of the metals in the scalp hair and nails of the patients and controls are also significantly diverse. The study reveals considerably divergent variations in the metal levels in lung cancer patients in comparison with healthy subjects.     

Lung cancer,smoking, and environment: a cohort study of the Danish population.

OBJECTIVE--The almost twofold difference in lung cancer incidence between people living in Copenhagen and in rural area of Denmark in the 1980s led to public concern; this study was undertaken to assess the effects of air pollution and occupation on lung cancer in Denmark, with control for smoking habits. DESIGN--Cohort study of national population. SUBJECTS--People aged 30-64 and economically active in 1970 (927,470 men and 486,130 women). MAIN OUTCOME MEASURES--Relative risks for lung cancer estimated with multiplicative Poisson modelling of incidence rates. RESULTS--Differences in smoking habit explained about 60% of the excess lung cancer risk in Copenhagen for men and 90% for women. After control for smoking, workers had double the lung cancer risk of teachers and academics. There was only a small independent effect of region. CONCLUSION--Smoking is the main factor behind the regional differences in lung cancer incidence in Denmark, and occupational risk factors also seem to have an important role. The outdoor air in Copenhagen around 1970 contained on average 50-80 micrograms/m3 of sulphur dioxide, 80-100 micrograms/m3 total suspended particulate matter, and up to 10 ng/m3 benzo(a)pyrene and had peak values of daily smoke of 120 micrograms/m3. Region had only a small effect on incidence of lung cancer int eh present study, which suggests that an influence of outdoor air pollution on lung cancer is identifiable only above this pollution level.     

Lifetime Smoking History and Cause-Specific Mortality in a Cohort Study with 43 Years of Follow-Up

BackgroundIn general, smoking increases the risk of mortality. However, it is less clear how the relative risk varies by cause of death. The exact impact of changes in smoking habits throughout life on different mortality risks is less studied.MethodsWe studied the impact of baseline and lifetime smoking habits, and duration of smoking on the risk of all-cause mortality, mortality of cardiovascular diseases (CVD), chronic obstructive pulmonary disease (COPD), any cancer and of the four most common types of cancer (lung, colorectal, prostate, and breast cancer) in a cohort study (Vlagtwedde-Vlaardingen 1965–1990, with a follow-up on mortality status until 2009, n = 8,645). We used Cox regression models adjusted for age, BMI, sex, and place of residence. Since previous studies suggested a potential effect modification of sex, we additionally stratified by sex and tested for interactions. In addition, to determine which cause of death carried the highest risk we performed competing-risk analyses on mortality due to CVD, cancer, COPD and other causes.ResultsCurrent smoking (light, moderate, and heavy cigarette smoking) and lifetime persistent smoking were associated with an increased risk of all-cause, CVD, COPD, any cancer, and lung cancer mortality. Higher numbers of pack years at baseline were associated with an increased risk of all-cause, CVD, COPD, any cancer, lung, colorectal, and prostate cancer mortality. Males who were lifetime persistent pipe/cigar smokers had a higher risk of lung cancer [HR (95% CI) = 7.72 (1.72–34.75)] as well as all-cause and any cancer mortality. A longer duration of smoking was associated with a higher risk of COPD, any and lung cancer [HR (95% CI) = 1.06 (1.00–1.12), 1.03 (1.00–1.06) and 1.10 (1.03–1.17) respectively], but not with other mortality causes. The competing risk analyses showed that ex- and current smokers had a higher risk of cancer, CVD, and COPD mortality compared to all other mortality causes. In addition, heavy smokers had a higher risk for COPD mortality compared to cancer, and CVD mortality.ConclusionOur study indicates that lifetime numbers of cigarettes smoked and the duration of smoking have different impacts for different causes of mortality. Moreover, our findings emphasize the importance of smoking-related competing risks when studying the smoking-related cancer mortality in a general population and that smoking cessation immediately effectively reduces the risk of all-cause and any cancer mortality.     

Smoking Habits of Men Employed in Industry,and Mortality

A study of the relation between smoking habits and lung cancer in male industrial workers over a period of three years has confirmed the earlier findings in doctors that the death-rate from lung cancer correlates closely with the number of cigarettes smoked. Of 54,460 men studied 68.7% were current cigarette smokers. The annual mortality rate from lung cancer was 0.33 per thousand in non-smokers and ex-smokers, and 1.2 per thousand for all cigarette smokers, and higher in heavy smokers.Heavy cigarette smokers who retained the cigarette in the mouth between puffs (“drooping” cigarette habit) had an annual mortality rate of 4.1 per thousand.The mortality from coronary thrombosis in smokers was nearly three times that in non-smokers. A mortality gradient with rising consumption of cigarettes was observed.Some correlation between smoking and cancer of other sites and from non-neoplastic lung disease was observed in older men, but no correlation was found with other cardiovascular diseases and cerebrovascular diseases.     

Elevated N3-methylpurine-DNA glycosylase DNA repair activity is associated with lung cancer

Tobacco smoke contains a range of chemical agents that can alkylate DNA. DNA repair proteins such as N3-methylpurine-DNA glycosylase (MPG) provide protection against cell killing and mutagenicity by removing lesions such as N7-methylguanine and N3-methyladenine. However, high levels of MPG activity in transfected mammalian cells in vitro have also been associated with increased genotoxicity. The aim of this study was to examine to what extent inter-individual differences in MPG activity modify susceptibility to lung cancer. Incident cases of lung cancer (n=51) and cancer free controls (n=88) were recruited from a hospital bronchoscopy unit. Repair activity was determined in a nuclear extract of peripheral blood mononuclear cells, using a [(32)P]-based oligonucleotide cleavage assay (MPG substrate 5'-CCGCT?AGCGGGTACCGAGCTCGAAT; ?A=ethenoadenine). MPG activity was not related to sex or smoking status but was significantly higher in cases compared to controls (4.21±1.67fmol/μg DNA/h vs 3.47±1.35fmol/μg DNA/h, p=0.005). After adjustment for age, sex, presence of chronic respiratory disease and smoking duration, patients in the highest tertile of MPG activity had a three fold increased probability of lung cancer (OR 3.00, 95% CI 1.16-7.75) when compared to those patients in the lowest tertile. These results suggest that elevated MPG activity is associated with lung cancer, possibly by creating an imbalance in the base excision repair pathway.     

Circulating anti-p53 antibodies in lung cancer and relationship to histology and smoking

Anti-p53 antibodies were examined in the plasma of 112 lung cancer patients by ELISA in order to study the distributions in lung cancer patients and the determinants of these antibodies in relation to lung cancer. Twenty (17.9 %) lung cancer patients were found to have anti-p53 antibodies. The distribution of the antibodies by histological type was 7/48 (14.6 %) adenocarcinoma, 8/32 (25.0 %) squamous cell carcinoma, 3/7 (42.9 %) small cell lung cancer, 0/4 large cell carcinoma, 0/8 adenosquamous cell carcinoma and 2/13 (15.4 %) other types. By ethnicity, 8/44 (18.2 %) Caucasians, 4/20 (20.0 %) Hispanics and 8/48 (16.7 %) African-Americans were positive for anti-p53 antibodies, with no significant differences among the groups (p=0.5137). The antibody positivity rates were higher in lung cancer patients 55 years or older (21.2 %) than in the patients under 55 years (7.4 %). The positive rates of the antibodies were 14.3 % in non-smokers, 16.7 % in ex-smokers and 19.1 % in current smokers, with heavy smokers (41 pack-years) having the highest positive rate (28.6 %), but none of these differences were statistically significant (p > 0.05). Seven controls who had anti-p53 antibodies were all ex-smokers or current smokers and some had occupational exposures. No anti-p53 antibodies were found in 41 non-smoking controls. These results suggest that the development of anti-p53 antibodies in pulmonary carcinogenesis and its association with smoking and other carcinogenic exposures deserve further study.     

Metabolic signatures of lung cancer in biofluids: NMR-based metabonomics of blood plasma

In this work, the variations in the metabolic profile of blood plasma from lung cancer patients and healthy controls were investigated through NMR-based metabonomics, to assess the potential of this approach for lung cancer screening and diagnosis. PLS-DA modeling of CPMG spectra from plasma, subjected to Monte Carlo Cross Validation, allowed cancer patients to be discriminated from controls with sensitivity and specificity levels of about 90%. Relatively lower HDL and higher VLDL + LDL in the patients' plasma, together with increased lactate and pyruvate and decreased levels of glucose, citrate, formate, acetate, several amino acids (alanine, glutamine, histidine, tyrosine, valine), and methanol, could be detected. These changes were found to be present at initial disease stages and could be related to known cancer biochemical hallmarks, such as enhanced glycolysis, glutaminolysis, and gluconeogenesis, together with suppressed Krebs cycle and reduced lipid catabolism, thus supporting the hypothesis of a systemic metabolic signature for lung cancer. Despite the possible confounding influence of age, smoking habits, and other uncontrolled factors, these results indicate that NMR-based metabonomics of blood plasma can be useful as a screening tool to identify suspicious cases for subsequent, more specific radiological tests, thus contributing to improved disease management.     

Mortality in relation to smoking: 20 years' observations on male British doctors.

In 1951 the British Medical Association forwarded to all British doctors a questionnaire about their smoking habits, and 34440 men replied. With few exceptions, all men who replied in 1951 have been followed for 20 years. The certified causes of all 10 072 deaths and subsequent changes in smoking habits were recorded. The ratio of the death rate among cigarette smokers to that among lifelong non-smokers of comparable age was, for men under 70 years, about 2:1, while for men over 70 years it was about 1-5:1. These ratios suggest that between a half and a third of all cigarette smokers will die because of their smoking, if the excess death rates are actually caused by smoking. To investigate whether this is the case, the relation of many different causes of death to age and tobacco consumption were examined, as were the effects of giving up smoking. Smoking caused death chiefly by heart disease among middle-aged men (and, with a less extreme relative risk, among old men,) lung cancer, chronic obstructive lung disease, and various vascular diseases. The distinctive features of this study were the completeness of follow-up, the accuracy of death certification, and the fact that the study population as a whole reduced its cigarette consumption substantially during the period of observation. As a result lung cancer grew relatively less common as the study progressed, but other cancers did not, thus illustrating in an unusual way the causal nature of the association between smoking and lung cancer.     

Cigarette smoking strongly modifies the association of complement factor H variant and the risk of lung cancer

The complement system is an important immunosurveillance mechanism against tumors, and complement factor H (CFH) is a key regulator for activation of the complement system. Expression of complement factor H has been demonstrated in cell lines from several malignancies. In this study we examined the contribution of the single-nucleotide polymorphism (SNP) Try402His (Y402H) (rs1061170) in the CFH gene to the risk of lung cancer in a case-control study with 1000 cases and 1000 controls. Odds ratios (ORs) and 95% confidence intervals (CIs) were computed by logistic regression. The frequencies for CFH Y402H genotypes among the cases were statistically significantly different from those among controls (χ(2)=8.66, P=0.003), with 402His/His or 402His/Try genotypes being over-represented among patients compared with controls (13.6% versus 9.4%, P<0.004). A multivariate regression analysis showed that a significantly increased risk of lung cancer for the 402His/His or 402His/Try carriers with OR (95% CI), 1.50 (1.12-2.00). When stratified by smoking status, the elevated risk of the cancer associated with variant CFH genotypes was observed among smokers, but not among non-smokers. When analyzed with cumulative smoking dose (pack-years), a super-multiplicative interaction was observed at different smoking levels. Among carriers with the 402Tyr/His or His/His genotype, the ORs of developing lung cancer for smoking<16, 16-28, or >28 pack-years were 0.98 (0.49-1.94), 2.36 (1.14-4.90), and 6.39 (3.49-11.68), respectively. These findings suggest that CFH Y402H polymorphism may interact with cigarette smoking to effect the development of lung cancer in the Chinese population.     

Are SNP-Smoking Association Studies Needed in Controls? DNA Repair Gene Polymorphisms and Smoking Intensity

Variations in tobacco-related cancers, incidence and prevalence reflect differences in tobacco consumption in addition to genetic factors. Besides, genes related to lung cancer risk could be related to smoking behavior. Polymorphisms altering DNA repair capacity may lead to synergistic effects with tobacco carcinogen-induced lung cancer risk. Common problems in genetic association studies, such as presence of gene-by-environment (G x E) correlation in the population, may reduce the validity of these designs. The main purpose of this study was to evaluate the independence assumption for selected SNPs and smoking behaviour in a cohort of 320 healthy Spanish smokers. We found an association between the wild type alleles of XRCC3 Thr241Met or KLC3 Lys751Gln and greater smoking intensity (OR = 12.98, 95% CI = 2.86–58.82 and OR=16.90, 95% CI=2.09-142.8; respectively). Although preliminary, the results of our study provide evidence that genetic variations in DNA-repair genes may influence both smoking habits and the development of lung cancer. Population-specific G x E studies should be carried out when genetic and environmental factors interact to cause the disease.     

Cigarette smoking and risk of second primary cancer: a systematic review and meta-analysis

Approximately 5% of the population are living with a diagnosis of cancer. Recent improvements in survival following a diagnosis of cancer have led to an increase in second primary cancers (SPCs) worldwide. Their aetiology remains largely unknown with a large proportion believed to be related to modifiable lifestyle factors. We conducted a systematic review and meta-analysis of published data that evaluated an association between cigarette smoking and risk of SPC. Studies were identified by searching Medline, Web of Science, CINAHL (Cumulative Index to Nursing and Allied Health Literature) and Scopus databases through March 2021 using broad search criteria. A meta-analysis was performed to derive pooled relative risks (RRs) for SPC defined a priori as smoking-related based on current evidence (lung, upper aero-digestive tract, stomach, pancreas, colorectum, liver, kidney, ureter, bladder and acute myeloid leukaemia). Eleven cohort studies and ten case-control studies met the eligibility criteria for review. There was marked heterogeneity in methods used in terms of classification and timing of smoking, confounders adjusted for and duration of follow-up across the studies. Nine cohort and seven case-control studies classified smoking habits prior to diagnosis of first cancer while the remaining studies classified post-first cancer smoking habits. In a meta-analysis using six studies, an increased risk of smoking-related SPC was observed for both former (RR=1.42; 95% confidence interval (CI) 1.20–1.67) and current smoking (RR=2.76; 95% CI 2.29–3.33), compared with never smoking. The pooled RRs changed only slightly when studies which measured post-first cancer smoking were excluded. A two-fold increase in risk was observed for ever smoking compared with never smoking. In conclusion, there was evidence that smoking might increase the risk of SPC in cancer survivors. For better informed cancer survivorship practice guidelines, more studies are needed particularly of post-cancer smoking and for cancers not known to be caused by smoking.     

Combined genetic polymorphism and risk for development of lung cancer

Susceptibility to lung cancer has been shown to be modulated by host specific factors. Inheritance of different polymorphic cytochrome P450s (CYPs) and the glutathione S-transferases (GSTs) which affect metabolism of environmental toxicants may play a key role in individual susceptibility. Although individual polymorphic genes have been reported to be associated with development of lung cancer, little is known about the combined effects of several genes in carcinogenesis. From our study of 54 lung cancer patients and 50 matched controls, we observed that a combination of several versions of ‘unfavorable' metabolizing genes (CYP2D6, CYP2E1, GSTM1 and GSTT1) is strongly associated with lung cancer. The relative risk for the different combinations of these genotypes ranged between 1.3 and 14, with higher risk involving the activating genes. The duration and intensity of heavy smoking (expressed in pack-years) are the most important determinant for the development of lung cancer. For example, the estimated risk for development of lung cancer associated with smoking >30 pack-years is represented by an odds ratio=6.65; 95% CL=2.3–19.9 irrespective of an individual's genotype, whereas for smoking between >30 and <50 pack-years, odds ratio=4.5; 95% CL=1.37–15; and for smoking >50 pack-years, odds ratio=30; 95% CL=5.7–114. On the other hand, smoking of less than 30 pack-years is associated with an increased risk in the presence of the polymorphic genes (odds ratio=2.5; 95% CL=0.32–54). The results of our study indicate that the inheritance of multiple ‘unfavorable' genotypes, especially activating genes, is a crucial predisposing factor for the development of lung cancer from cigarette smoking. In addition, the genes may cause moderate smokers who would normally outlive the deleterious effects of smoking to develop lung cancer. The information can therefore be used to target individuals for prevention of health problems.     

Buccal Spectral Markers for Lung Cancer Risk Stratification

Lung cancer remains the leading cause of cancer deaths in the US with >150,000 deaths per year. In order to more effectively reduce lung cancer mortality, more sophisticated screening paradigms are needed. Previously, our group demonstrated the use of low-coherence enhanced backscattering (LEBS) spectroscopy to detect and quantify the micro/nano-architectural correlates of colorectal and pancreatic field carcinogenesis. In the lung, the buccal (cheek) mucosa has been suggested as an excellent surrogate site in the “field of injury”. We, therefore, wanted to assess whether LEBS could similarly sense the presence of lung. To this end, we applied a fiber-optic LEBS probe to a dataset of 27 smokers without diagnosed lung cancer (controls) and 46 with lung cancer (cases), which was divided into a training and a blinded validation set (32 and 41 subjects, respectively). LEBS readings of the buccal mucosa were taken from the oral cavity applying gentle contact. The diagnostic LEBS marker was notably altered in patients harboring lung cancer compared to smoking controls. The prediction rule developed on training set data provided excellent diagnostics with 94% sensitivity, 80% specificity, and 95% accuracy. Applying the same threshold to the blinded validation set yielded 79% sensitivity and 83% specificity. These results were not confounded by patient demographics or impacted by cancer type or location. Moreover, the prediction rule was robust across all stages of cancer including stage I. We envision the use of LEBS as the first part of a two-step paradigm shift in lung cancer screening in which patients with high LEBS risk markers are funnelled into more invasive screening for confirmation.