Concanavalin A binding sites on the plasma membrane of leek stem protoplasts

The binding of concanavalin A (con A) to leek (Allium porrum L.) stem protoplasts has been investigated using sequential treatment with con A and haemocyanin and using con A covalently linked to ferritin. Prefixed protoplasts were evenly labelled. Unfixed protoplasts showed a clustered distribution of label. Low temperature and lanthanum reduced the clustering. Bound con A was lost from unfixed protoplasts incubated for 5 h after treatment, but con A/haemocyanin was not bound to nascent wall materials. Prefixed protoplasts treated with wall-removing enzymes before labelling showed only a small reduction of con A binding. These results indicate that con A is bound to plasma membrane components, but that binding is reduced by competition of nascent wall precursors.Abbreviations con A concanavalin A - con A-H sequential treatment with con A and haemocyanin - con A-F con A covalently linked to ferritin     

Involvement of plasma membrane proteins in plant defense responses. Analysis of the cryptogein signal transduction in tobacco.

Cryptogein, a 98 amino acid protein secreted by the fungus Phytophthora cryptogea, induces a hypersensitive response and systemic acquired resistance in tobacco plants (Nicotiana tabacum var Xanthi). The mode of action of cryptogein has been studied using tobacco cell suspensions. The recognition of this elicitor by a plasma membrane receptor leads to a cascade of events including protein phosphorylation, calcium influx, potassium and chloride effluxes, plasma membrane depolarization, activation of a NADPH oxidase responsible for active oxygen species (AOS) production and cytosol acidification, activation of the pentose phosphate pathway, and activation of two mitogen-activated protein kinase (MAPK) homologues. The organization of the cryptogein responses reveals that the earliest steps of the signal transduction pathway involve plasma membrane activities. Their activation generates a complex network of second messengers which triggers the specific physiological responses. This study may contribute to our understanding of plant signaling processes because elicitors and a variety of signals including hormones, Nod factors, light, gravity and stresses share some common transduction elements and pathways.     

Bisulfite interacts with binding sites of the auxin-transport inhibitor N-1-naphthylphthalamic acid

The affinity of the auxin-transport inhibitor N-1-naphthylphthalamic acid (NPA) for membrane particles as well as for solubilized binding sites from Cucurbita pepo L. hypocotyls was reduced by low concentrations of bisulfite (half-maximal inhibition at 2·10^-3–3·10^-3 M). Two membrane fractions obtained by sedimentation aided with polyethylene glycol showed differential sensitivity to bisulfite. Other oxidizing or reducing substances tested at 1 mM had no effect, except for N-ethylmaleimide (80% inhibition) and iodine (complete inhibition), both of which reduced the number of binding sites but not their affinity. Addition of bisulfite to either the isoalloxane ring of flavoproteins or to pyridoxal phosphate or quinones is proposed as a possible mechanism of action. Sulfur dioxide, at concentrations measured in polluted air, can lead to bisulfite concentrations in plant tissue sufficient to interfere with NPA-binding sites and hence with auxin transport.Abbreviations DTE dithioerythritol - DTT dithiothreitol - IC₅₀ concentration of half-maximal inhibition - NAA 1-naphthylacetic acid - NEM N-ethylmaleimide - NPA N-1-naphthylphthalamic acid - PEG polyethylene glycol, 6000 molecular weight     

Autoradiographic localization of a non-reducible somatostatin analog (125I-CGP 23996) binding sites in the rat brain: comparison with membrane binding

The regional distribution of somatostatin binding sites in the rat brain was determined by quantitative autoradiography, using 125I-CGP 23996, a non-reducible somatostatin analog. In preliminary experiments, kinetic properties of 125I-CGP 23996 binding to rat brain membranes and slide mounted frozen brain sections were compared and found similar. In addition, distribution of 125I-CGP 23996 and 125I-N-Tyr-SRIF14 binding sites on membrane prepared from 10 different rat brain structures were closely correlated (r = 0.91, 2 p less than 0.01), indicating that the non-reducible analog recognizes the same binding site as the Tyr-extended native peptide. Highest levels of 125I-CGP 23996 binding sites were found in anterior temporal, frontal and cingular cortex as well as hippocampus. Moderate levels were found in the remaining part of the limbic system including amygdala, olfactory tubercles and bed nucleus of the stria terminalis. In the brain stem, nuclei involved in the auditory system such as the ventral cochlear nucleus and the superior olive nucleus, contained high levels of 125I-CGP 23996 binding sites. The distribution of 125I-CGP 23996 binding sites roughly correlated with that of the endogenous peptide in most structures, except in the mediobasal hypothalamus.     

Functional importance of calcium binding sites in outer membrane phospholipase A

Outer membrane phospholipase A (OMPLA) is an integral membrane enzyme that hydrolyses phospholipids requiring Ca²⁺ as cofactor. In vitro studies have shown that OMPLA is only active as a dimer. The structures of monomeric and dimeric OMPLA provided possible clues to the activation process. In the inhibited dimeric species calcium ions are located at the dimer interface ideally suited to stabilise the oxyanion intermediates formed during catalysis. The side chain hydroxyl function of Ser152 is one of the ligands of this interfacial calcium. In the crystal structure of monomeric OMPLA the interfacial calcium site is lacking, but calcium was found to bind at a site involving the carboxylates of Asp149 and Asp184. In the current study the relevance of the identified calcium sites has been studied by site-directed mutagenesis. The Ser152Asn variant confirmed the importance of the interfacial calcium site for catalysis, and also demonstrated that this site is essentially involved in the dimerisation process. Replacements of the ligands in monomeric OMPLA, i.e. Asp149Asn, Asp149Ala and Asp184Asn, only showed minor effects on catalytic activity and dimerisation. A stronger effect observed for the variant Asp184Ala was explained by the proximity of Asp184 to the catalytically important Ser152 residue. We propose that Asp149 and Asp184 provide an electronegative funnel that may facilitate Ca²⁺ transfer to the interfacial calcium site.     

G protein-coupled receptor 30 is an estrogen receptor in the plasma membrane

Recently, GPR30 was reported to be a novel estrogen receptor; however, its intracellular localization has remained controversial. To investigate the intracellular localization of GPR30 in vivo, we produced four kinds of polyclonal antibodies for distinct epitopes on GPR30. Immunocytochemical observations using anti-GPR30 antibody and anti-FLAG antibody show that FLAG-GPR30 localizes to the plasma membrane 24 h after transfection. Treatment with estrogen (17beta-estradiol or E2) causes an elevation in the intracellular Ca2+ concentration ([Ca2+]i) within 10 s in HeLa cells expressing FLAG-GPR30. In addition, E2 induces the translocation of GPR30 from the plasma membrane to the cytoplasm by 1 h after stimulation. Immunohistochemical analysis shows that GPR30 exists on the cell surface of CA2 pyramidal neuronal cells. The images on transmission electron microscopy show that GPR30 is localized to a particular region associated with the plasma membranes of the pyramidal cells. These data indicate that GPR30, a transmembrane receptor for estrogen, is localized to the plasma membrane of CA2 pyramidal neuronal cells of the hippocampus in rat brain.     

Studies of small molecule interactions with protein phosphatases using biosensor technology

Reversible protein phosphorylation of serine, threonine, and tyrosine residues by protein kinases and phosphatases is important for the regulation of cellular signal transduction and controls many cellular functions. Disturbances in this regulation have been implicated in a growing number of diseases, making kinases and phosphatases useful targets for therapeutic intervention. The suitability of surface plasmon resonance (SPR) technology has been widely demonstrated in many drug discovery applications. A novel and straightforward methodology is presented for analyzing small molecule binding to two serine/threonine phosphatases, PP1 and PP2B (calcineurin), and to the prototypic tyrosine phosphatase, PTP1B. Emphasis was placed on investigating the immobilization conditions of the phosphatases by using reducing conditions, inhibitors and metal ions. A comparison of inhibitor binding, either to phosphatase (PP2B) alone or in complex with the regulatory protein subunit calmodulin, revealed different kinetics. The methodology was also used to test inhibitor specificity toward different phosphatases. Inhibition of regulatory protein PP-inhibitor-2 binding to PP1 by a small molecule inhibitor was demonstrated. This type of information, together with data on compound binding that is independent of enzyme activity and in which affinities are resolved into kinetic rate constants, may be of great significance for the development of highly specific and high-affinity phosphatase inhibitors.     

Dynamics of pH-dependent self-association and membrane binding of a dicarboxylic porphyrin: a study with small unilamellar vesicles

Steady-state and stopped-flow measurements of the absorbance and fluorescence of aqueous solutions were performed to characterize the pH-dependent ionization and aggregation states of deuteroporphyrin. Porphyrin self-association promoted by neutralization of the carboxylic groups takes place within a few milliseconds impeding characterization of the monomer ionization states. Extrapolation at infinite dilution of the values obtained from steady-state measurements yielded the pKs of the carboxylic groups (6.6, 5.3) and inner nitrogens (4.1, 2.3). The kinetics of interactions of the porphyrin with unilamellar fluid state dioleoylphosphatidylcholine vesicles was examined in a large pH range, with focus on the entry step. From alkaline pH to a value of 6.5, the entrance rate is maximal (1.69×10⁶ M⁻¹ s⁻¹ versus phospholipid concentration). It decreases to 2.07×10⁵ M⁻¹ s⁻¹ at lower pH with an apparent pK of 5.39. This effect appears to be related to the formation of porphyrin dimer rather than to the protonation of inner nitrogen. In keeping with previous data, these results support the concept of a pH-mediated selectivity of carboxylic porphyrins for tumor. They also indicate that the propensity of these molecules to self-associate at low pH could yield to some retention in acidic intracellular vesicles of the endosome/lysosome compartment.     

Interaction of p-aminobenzoic acid with erythrocyte membrane: photoaffinity labeling of the binding sites

p-Aminobenzoic acid (PABA) was found to prevent eichinocytosis of red cells in vitro. Equilibrium binding studies with right-side-out membrane vesicles revealed a similar number of binding sites and Kd values for both normal and sickle cell membranes. A [14C]Azide analog of PABA was synthesized as a photoaffinity label to probe its sites of interaction on the erythrocyte membranes. Competitive binding studies of PABA with its azide indicated that both the compounds share common binding sites on the membrane surface. The azide was found to covalently incorporate into the membrane components upon irradiation; 52-35% of the label was associated with the proteins and the remaining with the lipids. Electrophoretic analysis of photolabeled membranes revealed that the azide interacts mainly with Band 3 protein in the case of intact erythrocytes and right-side-out sealed vesicles; however, if unsealed ghosts are used, other membrane proteins besides Band 3 are photolabeled. PABA was found to inhibit both high and low affinity calcium-binding sites situated on either surface of the membrane apparently in a non-competitive manner. However, calcium binding stimulated by magnesium and ATP was only slightly affected. Calcium transport into inside-out vesicles was inhibited by PABA, but it did not affect the calcium ATPase activity.     

Kinetic studies of small molecule interactions with protein kinases using biosensor technology

Protein kinases are among the most commonly targeted groups of molecules in drug discovery today. Despite this, there are few examples of using surface plasmon resonance (SPR) for kinase inhibitor interaction studies, probably reflecting the need for better developed assays for these proteins. In this article, we present a general methodology that uses biosensor technology to study small molecule binding to eight different serine/threonine and tyrosine kinases. Mild immobilization conditions and a carefully composed assay buffer were identified as key success factors. The methodology package consists of direct binding studies of compounds to immobilized kinases, kinase activity assays to confirm inhibitory effects, detailed kinetic analyses of inhibitor binding, and competition assays with ATP for identification of competitive inhibitors. The kinetic assays resolve affinity into the rates of inhibitor binding and dissociation. Therefore, more detailed information on the relation between inhibitor structure and function is obtained. This might be of key importance for the development of effective kinase inhibitors.     

Reassociation of cortical secretory vesicles with sea urchin egg plasma membrane: Assessment of binding specificity

Summary An assay has been developed for quantitating the reassociation of cortical secretory vesicles (CVs) with fragments of sea urchin egg plasma membrane attached to glass slides (PM lawns). Binding ofS. pupuratus CVs to homologous PM lawns increased with time and CV concentration. The observation that CV binding was blocked by chymotrypsin digestion of the PM fragments suggested that a PM protein(s) is required for reassociation. The possibility that the extent of CV lysis that occurred during CV preparation (15.4±3.8% as assessed by ovoperoxidase assay) influenced reassociation was investigated by determining the effect of CV content proteins (isolated as fertilization product) on binding. Various concentrations of fertilization product (up to equivalent amounts of fertilization product and CV protein) had no effect on CV binding. The specificity of binding was investigated by assessing the ability of CVs to bind to PM lawns prepared from human red blood cells, and by determining the ability of heterologous vesicles to bind to egg PM fragments. PM lawns from HRBCs did not support CV binding; however, PM lawns prepared from the eggs of several species of sea urchin did bindS. pupuratus CVs. Vesicles from a partially purified preparation of yolk platelets bound to egg PM lawns with low efficiency (1/7 that of CVs), but immunofluorescence analysis with an anti-hyalin monoclonal antibody demonstrated that 74±9% of the bound vesicles were CVs that contaminated the yolk platelet preparation. Dioleoylphosphatidyl choline liposomes were also unable to bind to egg PM lawns. These results are consistent with hypothesis that CV binding to egg PM lawns is a specific, protein-mediated event.     

The direct permeation of nanoparticles through the plasma membrane transiently modifies its properties

The exposure to metal nanoparticles (NPs) has increased with their widespread use in industry, research and medicine. It is well known that NPs may enter cells and that this mechanism is crucial to exert both the therapeutic and toxicity effects. The main cellular entrance route is endocytosis-based, however, recent experimental studies, have reported that NPs can also enter the cell crossing directly the plasma membrane, it is thus important to investigate this alternative internalization mechanism. Size, surface chemistry, solubility and shape play a role in NP ability of entering the cell, but it is still to be elucidated how these properties act on cell membrane. We have demonstrated that a direct permeation of metal oxide NPs through the lipid bilayer of the cell membrane can occur, giving direct access to the cytoplasm. In this paper, using the powerful tool of Xenopus laevis oocytes and two electrode Voltage Clamp, we have investigated several parameters that can influence the direct crossing. The most significant of them is the NP hydrodynamic size as clearly shown by the comparison of the behaviour between Co₃O₄ and NiO NPs. By collecting biophysical membrane parameters in different conditions, we have shown that NPs that are able to cross the membrane share the ability to maintain a hydrodynamic size lower than 200 nm. The presence of this route of entrance must be considered for a better comprehension of the effect at intracellular level considering possible mechanism in order to a safer design of engineered NPs.     

Characterization of gonadotropin binding sites in the intracellular organelles of bovine corpora lutea and comparison with plasma membrane sites

The specific binding of 125I-human choriogonadotropin (hCG) to plasma membranes, nuclear membranes, lysosomes, rough endoplasmic reticulum, heavy golgi, and medium and light golgi of bovine corpora lutea was dependent on the amount of protein, 125I-hCG concentration and incubation time. The bound hormone in all the organelles was able to rebind to fresh corresponding organelles. Scatchard analysis revealed a homogenous population of gonadotropin binding sites in plasma membrane, rough endoplasmic reticulum, heavy golgi, and medium and light golgi, whose binding affinities (Kd = 8.6-11.0 X 10(-11) M) were similar but whose number of available gonadotropin binding sites varied. Scatchard analyses of nuclear membranes and lysosome binding, on the other hand, were heterogenous (Nuclear membranes, 11 and 23 X 10(-11) M lysosomes, 3.4 and 130 X 10(-11) M). The rate constants for association (5.9 to 12.1 X 10(6) M-1 S-1) and dissociation (7.4 to 9.0 X 10(-4) S-1) were similar among different subcellular organelles except for nuclear membranes and lysosomes, where rate constants for association were significantly lower. The ligand binding specificity, lower effectiveness of human luteinizing hormone as compared to hCG in competition, the optimal pH, the lack of ionic requirements for binding, and the molecular size of 125I-hCG-gonadotropin binding site complexes solubilized from various intracellular organelles were similar to those observed for plasma membranes. Numerous differences were also observed between intracellular organelles and plasma membranes as well as among intracellular organelles themselves with respect to binding losses due to exposure to low and high pH values, di- and monovalent cations, increasing preincubation temperatures, and a variety of enzymes and protein reagents. The possible reasons for these similarities as well as differences observed are discussed. The differences are viewed as an additional indication that contamination cannot solely explain the presence of gonadotropin binding sites in various intracellular organelles.     

Modulation of prolactin binding sites in vitro by membrane fluidizers II. Age-dependent effects on rat ventral prostatic membranes

The objectives of this study were to determine (i) if the age-related changes in ¹²⁵I-labeled ovine prolactin specific binding of rat ventral prostate was correlated with changes in membrane lipid microviscosity and (ii) if membrane fluidizers produced age-dependent effects on prolactin binding of prostatic membranes. The degree of fluidization was monitored by a fluorescence polarization method using 1,6-diphenylhexatriene. Membrane preparations of ventral prostate glands obtained from immature (24–25 days old), young-adult (80–90 days old) and aged (550–610 days old) male rats were used for prolactin binding and membrane lipid microviscosity measurements. Relative to immature rats, prostatic prolactin binding decreased approximately 50% in young-adult rats and 75% in aged rats. Membrane lipid microviscosity, relative to immature rats, was increased 72% in young-adult rats and 140% in aged rats. Prostatic membranes obtained from immature animals exhibited no significant effects of in vitro alcohol treatment on prolactin binding, whereas, those obtained from aged animals exhibited maximal increase in prolactin binding. The value of the microviscosity parameter, after in vitro alcohol exposure, exhibited no significant changes in immature animals, whereas, this parameter was decreased approximately 15% in young-adults and approximately 30% in aged animals. These data suggest that in vitro fluidization of prostatic membrane exhibits an age-dependent modification of prolactin binding.     

VAP-A and its binding partner CERT drive biogenesis of RNA-containing extracellular vesicles at ER membrane contact sites

1. Download : Download high-res image (265KB)
2. Download : Download full-size image

     

Association of gangliosides with the lymphocyte plasma membrane studied using radiolabels and spin labels

Gangliosides are known to act as potent suppressors of lectin-stimulated lymphocyte activation when added to the culture medium. Since this effect may be mediated via ganglioside association with (or insertion into) the plasma membrane, we have used 3H- and spin-labelled derivatives of mixed gangliosides to probe the nature of this interaction. Gangliosides bind rapidly to the lymphocyte membrane and show no preference for association with either inside-out or right-side-out membrane vesicles. Around 20% of the bound gangliosides can be removed by repetitive washing, and a further 22-28% by treatment with pronase for 1 h, suggesting that this fraction is tightly bound to membrane proteins at the cell surface. The ESR spectrum of membrane-bound gangliosides did not resemble the spin-exchanged spectrum of micellar spin-labelled gangliosides in aqueous solution, but was similar to that seen for 5 mol% ganglioside spin label in liposomes of egg phosphatidylcholine. This suggests that the bulk of the membrane-bound gangliosides are inserted and molecular dispersed in the lymphocyte membrane. Binding of wheat-germ agglutinin to lymphocyte-associated gangliosides results in specific immobilization of the carbohydrate headgroup, while concanavalin A and other lectins have little or no effect on oligosaccharide mobility. Membrane-inserted gangliosides show a response to lectin binding which is qualitatively different from that seen for gangliosides in bilayers of phosphatidylcholine.     

Pharmacological evaluation of plasma membrane beta-adrenoceptors in rat hearts using the tissue segment binding method

This study evaluates beta-adrenoceptors in rat atria and ventricle using the tissue segment binding method and compares the results with those obtained using conventional homogenate binding assays. In studies with tissue segment binding, the hydrophilic radioligand [(3)H]-CGP12177 selectively bound to plasma membrane beta-adrenoceptors, and the B(max) levels were significantly higher than those obtained with homogenate binding. However, both binding approaches revealed similar proportions of beta(1)- and beta(2)-adrenoceptors. The regional distribution of plasma membrane beta(1)- and beta(2)-adrenoceptors in rat hearts were also determined using tissue segment binding. Abundance of beta-adrenoceptors and proportion of beta(1)-adrenoceptors were higher in atria than in ventricle, but there was no significant difference between right and left atria or within ventricle (right and left ventricle free walls, apex, and interventricular septum). To establish the ability of the tissue segment binding method to study beta-adrenoceptor regulation such as the internalization of receptors, the effect of prolonged exposure of rat ventricle to (-)-isoprenaline was also investigated by using tissue segments and homogenate binding. Incubation with (-)-isoprenaline for 1 h in vitro caused a concentration-dependent decrease in the density of beta-adrenoceptors, predominantly beta(2)-adrenoceptors, when assessed with tissue segment binding method. In contrast, the subtype-specific change after treatment with (-)-isoprenaline was not detected using homogenate binding. In summary, the tissue segment binding method with [(3)H]-CGP12177 enables a more precise quantitation of plasma membrane beta(1)- and beta(2)-adrenoceptors in rat hearts and is suitable for studying their regulation.     

Binding of Leishmania spp with gold nanoparticles supported polyethylene glycol and its application for the sensitive detection of infectious photogenes in human plasma samples: A novel biosensor

The management of pathogen detection using a rapid and cost‐effective method presents a major challenge to the biological safety of the world. The field of pathogen detection is nascent and therefore, faces a dynamic set of challenges as the field evolves. Visceral leishmaniasis (VL), or kala‐azar is the most severe form of leishmaniasis. Delay to the accurate diagnosis and treatment is likely to lead to fatality. The reliable, fast and sensitive detection is closely linked to safe and effective treatment of Leishmania spp. Despite several routine and old method for sensitive and specificity detection of Leishmania spp, there is highly demand for developing modern and powerfully system. In this study a novel ultra‐sensitive DNA‐based biosensor was prepared for detection of Leishmania spp. For the first time, the specific and thiolated sequences of the Leishmania spp genome (5′‐SH‐[CH₂]₆ ATCTCGTAAGCAGATCGCTGTGTCAC‐3′) were recognized by electrochemical methods. Also, selectivity of the proposed bioassay was examined by three sequences that were mismatched in 1, 2, and 3 nucleotides. The linear range (10^?6 to 10^?21 M) and limit of detection (LLOQ = 1 ZM) obtained are remarkable in this study. Also, simple and cost‐effective construction of genosensors was another advantage of the proposal DNA‐based assay. The experimental results promise a fast and simple method in detection of kala‐azar patients with huge potential of the nanocomposite‐based probe for development of ideal biosensors.     

Two substrate sites in the renal Na+-d-glucose cotransporter studied by model analysis of phlorizin binding and-d-glucose transport measurements

Summary Time courses of phlorizin binding to the outside of membrane vesicles from porcine renal outer cortex and outer medulla were measured and the obtained families of binding curves were fitted to different binding models. To fit the experimental data a model with two binding sites was required. Optimal fits were obtained if a ratio of low and high affinity phlorizin binding sites of 1:1 was assumed. Na⁺ increased the affinity of both binding sites. By an inside-negative membrane potential the affinity of the high affinity binding site (measured in the presence of 3 mM Na⁺) and of the low affinity binding site (measured in the presence of 3 or 90 mM Na⁺) was increased. Optimal fits were obtained when the rate constants of dissociation were not changed by the membrane potential. In the presence of 90 mM Na⁺ on both membrane sides and with a clamped membrane potential,K _D values of 0.4 and 7.9 M were calculated for the low and high affinity phlorizin binding sites which were observed in outer cortex and in outer medulla. Apparent low and high affinity transport sites were detected by measuring the substrate dependence ofd-glucose uptake in membrane vesicles from outer cortex and outer medulla which is stimulated by an initial gradient of 90 mM Na⁺(out>in). Low and high affinity transport could be fitted with identicalK _m values in outer cortex and outer medulla. An inside-negative membrane potential decreased the apparentK _m ofhigh affinity transport whereas the apparentK _m of low affinity transport was not changed. The data show that in outer cortex and outer medulla of pighigh and low affinity Na⁺-d-glucose cotransporters are present which containlow and high affinity phlorizin binding sites, respectively. It has to be elucidated from future experiments whether equal amounts of low and high affinity transporters are expressed in both kidney regions or whether the low and high affinity transporter are parts of the same glucose transport moleculc.