Synthesis and functional activity of initiation regions of mRNA translation. II. RNA-ligase synthesis of hepta- and decaribonucleotides--components of 20-base polyribonucleotide templates

Preparative RNA-ligase synthesis of decaribonucleotides, the 5'-and 3'-constituent parts to be used for the synthesis of 20-base polyribonucleotides] simulating minimal translation initiation regions for phage RNA was carried out. The decamers were obtained via appropriate heptamers also by RNA-ligase catalyzed synthesis. Apart from decamers used to prepare the functionally active 20-base polyribonucleotide, the minimal translation initiation region of the replicase gene (R) in MS2 and fr phage--sequence R(-17----3) and two its variants, decanucleotides for other template modification were also synthesized. Three 5'-terminal decamers were isolated and identified including the natural decamer ApApApCpApUpGpApGpG (-17----(-)8) and those with G(-9)----A(-9) and U(-12)----C(-12) nucleotide substitutions, as well as three 3'-terminal products differing from the natural region ApUpUpCpCpCpApUpG (-7----3) in MS2 RNA by U(-6)----A(-6), U(-6)U(-5)----A(-6)A(-5) and CCC----UUU (-3----(-)1) substitutions.     

The regulatory region of phage fr replicase cistron. III. Initiation activity of specific fr RNA fragments.

RNA fragments from phage fr covering the complete or part of the replicase cistron initiation region have been used as templates in the formation of a ribosomal initiation complex in vitro. The results so obtained together with our earlier findings in a similar approach applied to fragments of the structurally related RNA from phage MS2 have allowed us to pinpoint the boundaries of the replicase cistron initiation region on phage RNA. A structural model of the above initiation region has been provided which shows that besides the minimal initiation region (comprises the Shine-Dalgarno sequence and initiator AUG), the flanking regions are also involved and are responsible for additional interactions with the ribosome. The flanking regions possibly contribute to the stability of specific contact between the ribosome and template realized by the minimal initiation region.     

The regulatory region of MS2 phage RNA replicase cistron. Functional activity of individual MS2 RNA fragments

The present work deals with the structural-functional organization of regulatory regions of messenger RNAs. Some principles of the action of a translational repressor (coat protein) and the formation of the ribosomal initiation complex at the replicase cistron have been studied with MS2 phage RNA. When the complex of MS2 RNA with the coat protein is treated with T₁ ribonuclease, the coat protein selectively protects mainly two fragments (59 and 103 nucleotides in length) from digestion; these fragments contain the intercistronic regulatory region and the beginning of the MS2 replicase cistron. These polynucleotides have been isolated in a pure state and their primary structure has been established.It has been established that both MS2 RNA fragments contain all the necessary information for specific interaction with MS2 coat protein and form a complex with it with an efficiency close to that observed in the case of native MS2 RNA. They also provide the normal polypeptide chain initiation at the replicase cistron. Enzymatic binding of the second aminoacyl-tRNA and electrophoretic analysis of N-terminal dipeptides prove that only the true initiator codon of the replicase cistron is recognized by a ribosome despite the presence of a few additional AUG triplets within the polynucleotides. Under conditions of limited hydrolysis by T₁ ribonuclease, the beginning of the replicase cistron has been removed from the shortest polynucleotide leading to a complete loss of its ability to bind both the coat protein and a ribosome.Some principles of the functioning of the regulatory region in MS2 RNA as well as the nature of the initiator signal of protein biosynthesis are discussed.     

The regulatory region of MS2 phage RNA replicase cistron. IV. Functional activity of specific MS2 RNA fragments in formation of the 70 S initiation complex of protein biosynthesis.

The initiation region of the MS2 replicase cistron can be isolated as a fragment 59 bases in length protected from RNAase by the binding of the coat protein which serves as a translational repressor. This fragment MS2 R(-53 leads to 6) starts 53 bases before the initiation codon and retains full activity in binding ribosomes. We have investigated the functional activity in initiation of a series of fragments from this region variously shortened from the 5'-end. Ribosome protected fragments starting 17 or 21 bases before the AUG are unable to rebind to ribosomes. The shortest fragment which has this activity was produced by partial S1 nuclease digestion and starts 33 to 35 bases before the AUG. The initiation signal comprises some nucleotides between 21 and 33 bases before the initiation codon and the regulatory region responsible for initiation is longer than that protected by the ribosome in the final initiation complex.     

Regulatory region of fr phage replicase cistron. II. Isolation and structure of specific fr RNA fragments

A new set of short RNA templates has been prepared for functional studies in initiation of translation in vitro. Number of individual RNA fragments which contain complete or part of the initiatory region of phage fr replicase cistron were isolated from complex fr RNA--fr coat protein. Their primary structure were determined by using standard fingerprint technique and rapid gel sequencing. Secondary structure of several RNA fragments and their binding activity with phage fr and MS2 coat proteins has been also studied.     

Altered mRNA binding activity and decreased translational initiation in a nuclear mutant lacking translation of the chloroplast psbA mRNA.

Translational regulation has been identified as one of the key steps in chloroplast-encoded gene expression. Genetic and biochemical analysis with Chlamydomonas reinhardtii has implicated nucleus-encoded factors that interact specifically with the 5' untranslated region of chloroplast mRNAs to mediate light-activated translation. F35 is a nuclear mutation in C. reinhardtii that specifically affects translation of the psbA mRNA (encoding D1, a core polypeptide of photosystem II), causing a photosynthetic deficiency in the mutant strain. The F35 mutant has reduced ribosome association of the psbA mRNA as a result of decreased translation initiation. This reduction in ribosome association correlates with a decrease in the stability of the mRNA. Binding activity of the psbA specific protein complex to the 5' untranslated region of the mRNA is diminished in F35 cells, and two members of this binding complex (RB47 and RB55) are reduced compared with the wild type. These data suggest that alteration of members of the psbA mRNA binding complex in F35 cells results in a reduction in psbA mRNA-protein complex formation, thereby causing a decrease in translation initiation of this mRNA.     

The regulatory region of MS2 phage RNA replicase cistron. III. Characterization of fragments resulting from S1 nuclease digestion.

The functionally active fragments MS2 R(-53 leads to 6) and MS2 R(-53 leads to 3) comprising the regulatory region for the replicase cistron have been isolated from MS2 RNA-coat protein complex following T1 RNase digestion. In order to obtain shorter fragments, active in coat protein binding and initiation of translation, MS2 R(-53 leads to 6) was cleaved with S1 nuclease. The results indicate that S1 nuclease attacks the most susceptible loop regions of the two hairpin helices of MSZ R(-53) leads to 6). Among the three fragments which have been isolated, only MS2 R(-35/33 leads to 6) containing the intact hairpin (b) region with initiation codon AUG is active in the coat protein binding. Functional activity exerted by another polynucleotide MS R(-17 leads to 6) supports the assumption that specific binding with the coat protein is determined by the hairpin (b) region prior to the replicase cistron.     

Genetic analysis of bacteriophage lambda cIII gene: mRNA structural requirements for translation initiation.

The bacteriophage lambda cIII gene product regulates the lysogenic pathway. The cIII gene is located in the leftward operon, which is transcribed from the pL promoter. We have previously shown (S. Altuvia and A. B. Oppenheim, J. Bacteriol. 167:415-419, 1986) that mutations that show elevated expression lie within the cIII coding sequence. We isolated mutants that show decreased CIII activity. All the mutations were found to cause a drastic reduction in the rate of initiation of cIII translation. Several mutations were found to be scattered within the first 40 nucleotides of the cIII coding region. Additional mutations affected the AUG initiation codon, the Shine-Dalgarno sequence, and the upstream RNaseIII processing site. Computer folding of the cIII mRNA suggested the presence of two alternative RNA structures. All the mutations within the coding region that reduce expression reduce the stability of one specific mRNA structure (structure B). Mutations that increase expression lie in the loops of this structure and may in fact stabilize it by interfering with the formation of the alternative structure (structure A). Thus, it appears that a specific mRNA secondary structure at the beginning of the cIII coding region is essential for efficient translation, suggesting that changes in mRNA structure regulate cIII expression.     

Ribosomal protein S1 in the complex of E. coli ribosomal subunit 30S with phage MS2 RNA interacts with internal region of the replicase gene

The MS2 RNA fragments bound to ribosomal protein S1 within the complex of MS2 RNA with 30S ribosomal subunit have been isolated using a specially developed procedure and sequenced by the base-specific enzymatic method. The S1-binding site on MS2 RNA was identified as UUUCUUACAUGACAAAUCCUUGUCAUG and mapped within the replicase gene at positions 2030-2056. This finding suggests that ribosome-MS2 RNA interaction involves at least two different regions of the phage RNA--the internal region of the replicase gene (S1-binding site) and ribosome-binding site of the coat protein gene. The possible spatial proximity between these two regions is discussed.     

Influence of mRNA determinants on translation initiation in Escherichia coli.

We have studied the classic initiation elements of mRNA sequence and structure to better understand their influence on translation initiation rates in Escherichia coli. Changes introduced in the initiation codon, the Shine and Dalgarno sequence, the spacing between those two elements, and in the secondary structures within initiation domains each change the rate of 30 S ternary complex formation. We measured these differences using extension inhibition analysis, a technique we have called "toeprinting". The rate of 30 S initiation complex formation in the absence of initiation factors agrees well with in vivo translation rates in some instances, although in others a regulatory role of initiation factors in 30 S complex formation is likely. Nucleotides 5' to the Shine and Dalgarno domain facilitate ternary complex formation.     

Correlation between the effectiveness of translation initiation and secondary structure of mRNA in the hybrid gene cro-lacIZ

A set of plasmids containing short DNA deletions in the N-part of cro-lacIZ coding zone as constructed using Bal31 nuclease. Development of models of mRNA secondary structure was carried out stepwise beginning from the 5'-end by taking into consideration the hairpins first formed during mRNA synthesis. Comparison of the results of mRNA secondary structure determination and protein production analysis demonstrated a correlation between the efficiency of translation initiation and the appearance of a single-stranded region upon disruption of the mRNA local secondary structure in the translation initiation zone generated by ribosomes. These results confirm the suggestion of the central role played by the Shine-Dalgarno sequence in the generation of a single-stranded region. Some plasmids from the set are supposed to determine protein synthesis by a translation reinitiation mechanism in the absence of Shine--Dalgarno interaction. In this case, correlation between reinitiation efficiency and local disruption of the mRNA secondary structure by the terminating ribosome was also observed. The terminating ribosome that forms the single-stranded region near the initiation codon fulfils the major function of the Shine--Dalgarno interaction. In addition, the possible effect of another mRNA secondary structure region on the translation initiation efficiency is discussed.     

Cell-free translation systems prepared from starfish oocytes faithfully reflect in vivo activity; mRNA and initiation factors stimulate supernatants from immature oocytes.

Meiotic maturation stimulates a change in the translation of stored mRNAs: mRNAs encoding proteins needed for growth of oocytes are translated before meiotic maturation, whereas those encoding proteins required for cleavage are translated after meiotic maturation. Studies of translational regulation during meiotic maturation have been limited by the lack of translationally active cell-free supernatants. Starfish oocytes are ideal for preparing cell-free translation systems because experimental application of the hormone 1-methyladenine induces their maturation, synchronizing meiosis. We have prepared such systems from both immature and mature oocytes of starfish. Changes in protein synthesis rates and the specificity of proteins synthesized in these cell-free translation supernatants mimic those seen in vivo. Supernatants both from immature and mature oocytes have a high capacity to initiate new translation because 90% of the proteins made are newly initiated from mRNAs. Cell-free supernatants from mature oocytes have a much higher rate of initiation of translation than those from immature oocytes and use the 43S preinitiation complexes more efficiently in initiation of translation. Similarly, we have shown that mRNAs and initiation factors are rate limiting in cell-free translation systems prepared from immature oocytes. In addition, cell-free translation systems prepared from immature oocytes are only slightly, if at all, inhibitory to cell-free translation systems from mature oocytes. Thus, soluble inhibitors, if they exist, are rapidly converted by cell-free supernatants from mature oocytes. The similarities between translation in our starfish cell-free translation systems and in intact oocytes suggests that the cell-free translation systems will be useful tools for further studies of maturation events and translational control during meiosis.     

Translational initiation at the coat-protein gene of phage MS2: native upstream RNA relieves inhibition by local secondary structure

Maximal translation of the coat-protein gene from RNA bacteriophage MS2 requires a contiguous stretch of native MS2 RNA that extends hundreds of nucleotides upstream from the translational start site. Deletion of these upstream sequences from MS2 cDNA plasmids results in a 30-fold reduction of translational efficiency. By site-directed mutagenesis, we show that this low level of expression is caused by a hairpin structure centred around the initiation codon. When this hairpin is destabilized by the introduction of mismatches, expression from the truncated messenger increases 20-fold to almost the level of the full-length construct. Thus, the translational effect of hundreds of upstream nucleotides can be mimicked by a single substitution that destabilizes the structure. The same hairpin is also present in full-length MS2 RNA, but there it does not Impair ribosome binding. Apparently, the upstream RNA somehow reduces the inhibitory effect of the structure on translational initiation. The upstream MS2 sequence does not stimulate translation when cloned in front of another gene, nor can unrelated RNA segments activate the coat-protein gene. Several possible mechanisms for the activation are discussed and a function in gene regulation of the phage is suggested.     

Internal initiation of translation of the TrkB mRNA is mediated by multiple regions within the 5' leader

Translational regulation of the dendritically localized mRNA encoding for the neurotrophin receptor TrkB has important ramifications for synaptic function. We examined whether the TrkB mRNA is translated through an internal initiation entry site (IRES). The human TrkB 5′ leaders are derived from the use of alternative promoters and alternative splicing, but all 5′ leaders share a common exon. Insertion of a full-length 5′ leader, as well as the common exon into the intercistronic region of a dicistronic luciferase construct, yielded luciferase activity generated from the second cistron that was either equivalent or higher than that observed from the encephalomyocarditis virus IRES. Moreover, inhibiting cap-dependent translation ex vivo and in in vitro lysates had only a minimal effect on the translation of mRNA containing the TrkB 5′ leader. Dissecting the 5′ leader showed that the IRES is located in the exon common to all TrkB 5′ leaders. Moreover, six regions ranging from 2 to 25 nt were identified that either promoted or inhibited IRES activity. Taken together, these results suggest that the 5′ leader of the human TrkB mRNA contains multiple cis-elements that regulate internal initiation of translation and that this mechanism may contribute significantly to the translation of the TrkB mRNA in neuronal dendrites.     

Ribosome-independent GTPase activity of translation initiation factor IF2 and of its G-domain.

In the absence of ribosomes, Bacillus stearothermophilus translation initiation factor IF2 (Mr = 82 kDa) and its GTP-binding domain (i.e. the G-domain, Mr = 41 kDa) promote barely detectable hydrolysis of GTP. Upon addition of some aliphatic alcohols, however, the rate of nucleotide cleavage is substantially increased with both IF2 and G-domain, the highest stimulation being observed with 20% (v/v) ethanol. Under these conditions, the rates of ribosome-independent GTP hydrolysis with both IF2 and G-domain are approximately 30-fold lower than the corresponding rates obtained in the presence of ribosomes, while the Km for GTP is approximately the same in all cases. These results indicate that, as with the other two prokaryotic G proteins involved in translation (i.e. elongation factors EF-Tu and EF-G), also in the case of IF2, the GTPase catalytic center resides in the factor and, more specifically, in its G-domain.     

Structure of the archaeal translation initiation factor aIF2 beta from Methanobacterium thermoautotrophicum: implications for translation initiation

aIF2 beta is the archaeal homolog of eIF2 beta, a member of the eIF2 heterotrimeric complex, implicated in the delivery of Met-tRNA(i)(Met) to the 40S ribosomal subunit. We have determined the solution structure of the intact beta-subunit of aIF2 from Methanobacterium thermoautotrophicum. aIF2 beta is composed of an unfolded N terminus, a mixed alpha/beta core domain and a C-terminal zinc finger. NMR data shows the two folded domains display restricted mobility with respect to each other. Analysis of the aIF2 gamma structure docked to tRNA allowed the identification of a putative binding site for the beta-subunit in the ternary translation complex. Based on structural similarity and biochemical data, a role for the different secondary structure elements is suggested.