Specific association of a small protein with the telomeric DNA-protein complex during the onset of leaf senescence in Arabidopsis thaliana

Telomeres and their changes in length throughout the life span of cells have been intensively investigated in different organisms. Telomere length is assumed to control replicative senescence in mammalian cells. However, only very few data are available on the developmental dynamics of plant telomeres. Here, changes of telomere length and DNA-protein structure of Arabidopsis thaliana telomeres were analysed in different stages of development, with the main focus resting on the transition from pre-senescent to senescent leaves. The lengths of the telomeres, ranging from ca. 2.0 to 6.5 kb, do not significantly change during plant development indicating that telomere length is not involved in differentiation and replicative senescence nor in post-mitotic senescence of A. thaliana. In dedifferentiated cultured cells a slight increase in length can be determined. The nucleoprotein structure of the telomeric DNA was investigated by gel mobility shift assays, with synthetic oligonucleotides and nuclear protein extracts derived from four defined stages of post-mitotic leaf senescence. In all four stages, a highly salt-resistant DNA-protein complex was formed with the double-stranded as well as with the single-stranded G-rich telomeric DNA. An additional DNA-protein complex was identified in nuclear protein extracts isolated from plants in the transition stage from pre-senescence to senescence. The protein components of the DNA-protein complexes were analysed on native PAGE and SDS-PAGE gels. A protein of 67 kDa (ATBP1) bound to the telomeric DNA in all developmental stages. An additional protein of merely 22 kDa (ATBP2) was associated via protein-protein interaction with ATBP1 to form a higher-order complex exclusively during the onset of senescence. DNA interaction of this higher-order protein complex seems to be restricted to double-stranded telomeric DNA. The defined period of ATBP1/ATBP2 complex formation with the telomeric DNA probably indicates that ATBP2 is involved in the onset of post-mitotic leaf senescence by either disturbing an established or establishing an additional function exhibited by the telomeres in the interphase nuclei.     

POT1-independent single-strand telomeric DNA binding activities in Brassicaceae

Telomeres define the ends of linear eukaryotic chromosomes and are required for genome maintenance and continued cell proliferation. The extreme ends of telomeres terminate in a single-strand protrusion, termed the G-overhang, which, in vertebrates and fission yeast, is bound by evolutionarily conserved members of the POT1 (protection of telomeres) protein family. Unlike most other model organisms, the flowering plant Arabidopsis thaliana encodes two divergent POT1-like proteins. Here we show that the single-strand telomeric DNA binding activity present in A. thaliana nuclear extracts is not dependent on POT1a or POT1b proteins. Furthermore, in contrast to POT1 proteins from yeast and vertebrates, recombinant POT1a and POT1b proteins from A. thaliana , and from two additional Brassicaceae species, Arabidopsis lyrata and Brassica oleracea (cauliflower), fail to bind single-strand telomeric DNA in vitro under the conditions tested. Finally, although we detected four single-strand telomeric DNA binding activities in nuclear extracts from B. oleracea , partial purification and DNA cross-linking analysis of these complexes identified proteins that are smaller than the predicted sizes of BoPOT1a or BoPOT1b. Taken together, these data suggest that POT1 proteins are not the major single-strand telomeric DNA binding activities in A. thaliana and its close relatives, underscoring the remarkable functional divergence of POT1 proteins from plants and other eukaryotes.     

Telomere structure in Euplotes crassus: characterization of DNA-protein interactions and isolation of a telomere-binding protein.

The nucleoprotein structure of telomeres from Euplotes crassus was studied by using nuclease and chemical footprinting. The macronuclear telomeres were found to exist as DNA-protein complexes that are resistant to micrococcal nuclease digestion. Each complex encompassed 85 to 130 base pairs of macronuclear DNA and appeared to consist of two structural domains that are characterized by dissimilar DNA-protein interactions. Dimethyl sulfate footprinting demonstrated that very sequence-specific and salt-stable interactions occur in the most terminal region of each complex. DNase I footprinting indicated that DNA in the region 30 to 120 base-pairs from the 5' end lies on a protein surface; the interactions in this region of the complex are unlikely to be sequence specific. A 50-kilodalton telomere-binding protein was isolated. Binding of this protein protected telomeric DNA from BAL 31 digestion and gave rise to many of the sequence-specific DNA-protein interactions that were observed in vivo. The telomeric complexes from E. crassus were very similar in overall structure to the complexes found at Oxytricha telomeres. However, telomeric complexes from the two ciliates showed significant differences in internal organization. The telomeric DNA, the telomere-binding proteins, and the resultant DNA-protein interactions were all somewhat different. The telomere-binding proteins from the two ciliates were found to be less closely conserved than might have been expected. It appears that the proteins are tailored to match their cognate telomeric DNA.     

<Emphasis Type="Italic">AtTBP2</Emphasis> and <Emphasis Type="Italic">AtTRP2</Emphasis> in <Emphasis Type="Italic">Arabidopsis</Emphasis> encode proteins that bind plant telomeric DNA and induce DNA bending in vitro

Telomeric DNA-binding proteins (TBPs) are crucial components that regulate the structure and function of eukaryotic telomeres and are evolutionarily conserved. We have identified two homologues of AtTBP1 (for Arabidopsis thaliana telomeric DNA binding protein 1), designated as AtTBP2 and AtTRP2, which encode proteins that specifically bind to the telomeric DNA of this plant. These proteins show extensive homology with other known plant TBPs. The isolated C-terminal segments of these proteins were capable of sequence-specific binding to duplex telomeric plant DNA in vitro. DNA bending assays using the Arabidopsis TBPs revealed that AtTBP1 and AtTBP2 have DNA-bending abilities comparable to that of the human homologue hTRF1, and higher than those of AtTRP1 and AtTRP2.     

Properties of the telomeric DNA-binding protein from Oxytricha nova

Telomeres of Oxytricha macronuclear DNA exist as discrete DNA-protein complexes. Different regions of each complex display characteristic DNA-protein interactions. In the most terminal region, binding of a 43- and a 55-kDa protein to the telomeric DNA appears to account for all the DNA-protein interactions that can be detected by chemical and nuclease footprinting. We have used gradient sedimentation and protein-protein cross-linking to establish that the 43- and 55-kDa proteins are subunits of a heterodimer. Both subunits are very basic, which is unexpected considering the resistance of the DNA-protein interaction to high concentrations of salt. It is extremely difficult to dissociate the two subunits either from telomeric DNA or from each other. Even after extensive treatment of protein preparations with nuclease, a fragment of the 3' tail from macronuclear DNA remains bound to the protein. A wide range of conditions was screened for dissociation of the subunits from the DNA and/or from each other. Dissociation was only obtained by using conditions that caused some inactivation of the DNA-binding capacity of the protein. The use of reagents that covalently modify sulfydryl groups during the purification procedure facilitates preparation of telomere protein with full DNA-binding activity.     

Rice proteins that bind single-stranded G-rich telomere DNA

In this work, we have identified and characterized proteins in rice nuclear extracts that specifically bind the single-stranded G-rich telomere sequence. Three types of specific DNA-protein complexes (I, II, and III) were identified by gel retardation assays using synthetic telomere substrates consisting of two or more single-stranded TTTAGGG repeats and rice nuclear extracts. Since each complex has a unique biochemical property and differs in electrophoretic mobility, at least three different proteins interact with the G-rich telomere sequences. These proteins are called rice G-rich telomere binding protein (RGBP) and none of them show binding affinity to double-stranded telomere repeats or single-stranded C-rich sequence. Changing one or two G's to C's in the TTTAGGG repeats abolishes binding activity. RGBPs have a greatly reduced affinity for human and Tetrahymena telomeric sequence and do not efficiently bind the cognate G-rich telomere RNA sequence UUUAGGG. Like other telomere binding proteins, RGBPs are resistant to high salt concentrations. RNase sensitivity of the DNA-protein interactions was tested to investigate whether an RNA component mediates the telomeric DNA-protein interaction. In this assay, we observed a novel complex (complex III) in gel retardation assays which did not alter the mobilities or the band intensities of the two pre-existing complexes (I and II). The complex III, in addition to binding to telomeric sequences, has a binding affinity to rice nuclear RNA, whereas two other complexes have a binding affinity to only single-stranded G-rich telomere DNA. Taken together, these studies suggest that RGBPs are new types of telomere-binding proteins that bind in vitro to single-stranded G-rich telomere DNA in the angiosperms.     

Characterization of single stranded telomeric DNA-binding proteins in cultured soybean (Glycine max) cells

We have identified and characterized a protein factor in soybean (Glycine max) nuclear extracts that binds to plant single stranded telomeric DNA repeats. A single DNA-protein complex was detected in gel retardation assays using synthetic telomeres and nuclear extracts. The protein forming this complex was designated soy-bean (Glycine max) single stranded telomeric DNA-binding protein (Gm-STBP). Gm-STBP binds to single stranded telomeric DNA containing more than two repeats. It does not bind to Tetrahymena, human or mutated plant telomere sequences, and its binding activity is not affected by RNase treatment. Gm-STBP activity gradually decreased after suspension cultures entered stationary phase. A slower migrating band was formed with extracts of earlier and later phases of soybean suspension cultures. Our findings suggest that binding of Gm-STBP to plant single stranded telomeric DNA may play a role in the proper functioning of telomeres during development.     

Arabidopsis thaliana telomeric DNA-binding protein 1 is required for telomere length homeostasis and its Myb-extension domain stabilizes plant telomeric DNA binding

Telomeres are specific protein–DNA complexes that protect the ends of eukaryotic chromosomes from fusion and degradation and are maintained by a specialized mechanism exerted by telomerase and telomere-binding proteins (TBPs), which are evolutionarily conserved. AtTBP1 is an Arabidopsis thaliana protein that binds plant telomeric DNA in vitro. Here, we demonstrated that lack of AtTBP1 results in a deregulation of telomere length control, with mutant telomeres expanding steadily by the fourth generation. DNA-binding studies with mutant AtTBP1 proteins showed that the Myb-extension domain of AtTBP1 is required for binding to plant telomeric DNA. Our results suggest that AtTBP1 is involved in the telomere length mechanism in A. thaliana and that the Myb-extension domain of AtTBP1 may stabilize plant telomeric DNA binding.     

A C-terminal Myb extension domain defines a novel family of double-strand telomeric DNA-binding proteins in Arabidopsis

Little is known about the protein composition of plant telomeres. We queried the Arabidopsis thaliana genome data base in search of genes with similarity to the human telomere proteins hTRF1 and hTRF2. hTRF1/hTRF2 are distinguished by the presence of a single Myb-like domain in their C terminus that is required for telomeric DNA binding in vitro. Twelve Arabidopsis genes fitting this criterion, dubbed TRF-like (TRFL), fell into two distinct gene families. Notably, TRFL family 1 possessed a highly conserved region C-terminal to the Myb domain called Myb-extension (Myb-ext) that is absent in TRFL family 2 and hTRF1/hTRF2. Immunoprecipitation experiments revealed that recombinant proteins from TRFL family 1, but not those from family 2, formed homodimers and heterodimers in vitro. DNA binding studies with isolated C-terminal fragments from TRFL family 1 proteins, but not family 2, showed specific binding to double-stranded plant telomeric DNA in vitro. Removal of the Myb-ext domain from TRFL1, a family 1 member, abolished DNA binding. However, when the Myb-ext domain was introduced into the corresponding region in TRFL3, a family 2 member, telomeric DNA binding was observed. Thus, Myb-ext is required for binding plant telomeric DNA and defines a novel class of proteins in Arabidopsis.     

Tobacco GTBP1, a Homolog of Human Heterogeneous Nuclear Ribonucleoprotein, Protects Telomeres from Aberrant Homologous Recombination

Telomeres are nucleoprotein complexes essential for the integrity of eukaryotic chromosomes. Cellular roles of single-stranded telomeric DNA binding proteins have been extensively described in yeast and animals, but our knowledge about plant single-strand telomeric factors is rudimentary. Here, we investigated Nicotiana tabacum G-strand-specific single-stranded telomere binding proteins (GTBPs), homologs of a human heterogeneous nuclear ribonucleoprotein. GTBPs bound specifically to the plant single-stranded (TTTAGGG)₄ telomeric repeat element in vitro and were associated with telomeric sequences in tobacco BY-2 suspension cells. Transgenic plants (35S:RNAi-GTBP1), in which GTBP1 was suppressed, exhibited severe developmental anomalies. In addition, the chromosomes of 35S:RNAi-GTBP1 cells displayed elongated telomeres, frequent formation of extrachromosomal telomeric circles, and numerous abnormal anaphase bridges, indicating that GTBP1 knockdown tobacco plants experienced genome instability. GTBP1 inhibited strand invasion, an initial step in interchromosomal homologous recombination. We propose that GTBP1 plays a critical role in telomere structure and function by preventing aberrant interchromosomal telomeric homologous recombination in tobacco.     

Protection of Telomeres 1 Is Required for Telomere Integrity in the Moss Physcomitrella patens

In vertebrates, the single-stranded telomeric DNA binding protein Protection of Telomeres 1 (POT1) shields chromosome ends and prevents them from eliciting a DNA damage response. By contrast, Arabidopsis thaliana encodes two divergent full-length POT1 paralogs that do not exhibit telomeric DNA binding in vitro and have evolved to mediate telomerase regulation instead of chromosome end protection. To further investigate the role of POT1 in plants, we established the moss Physcomitrella patens as a new model for telomere biology and a counterpoint to Arabidopsis. The sequence and architecture of the telomere tract is similar in P. patens and Arabidopsis, but P. patens harbors only a single-copy POT1 gene. Unlike At POT1 proteins, Pp POT1 efficiently bound single-stranded telomeric DNA in vitro. Deletion of the P. patens POT1 gene resulted in the rapid onset of severe developmental defects and sterility. Although telomerase activity levels were unperturbed, telomeres were substantially shortened, harbored extended G-overhangs, and engaged in end-to-end fusions. We conclude that the telomere capping function of POT1 is conserved in early diverging land plants but is subsequently lost in Arabidopsis.     

Evolution of Telomeres in Schizosaccharomyces pombe and Its Possible Relationship to the Diversification of Telomere Binding Proteins

Telomeres of nuclear chromosomes are usually composed of an array of tandemly repeated sequences that are recognized by specific Myb domain containing DNA-binding proteins (telomere-binding proteins, TBPs). Whereas in many eukaryotes the length and sequence of the telomeric repeat is relatively conserved, telomeric sequences in various yeasts are highly variable. Schizosaccharomyces pombe provides an excellent model for investigation of co-evolution of telomeres and TBPs. First, telomeric repeats of S. pombe differ from the canonical mammalian type TTAGGG sequence. Second, S. pombe telomeres exhibit a high degree of intratelomeric heterogeneity. Third, S. pombe contains all types of known TBPs (Rap1p [a version unable to bind DNA], Tay1p/Teb1p, and Taz1p) that are employed by various yeast species to protect their telomeres. With the aim of reconstructing evolutionary paths leading to a separation of roles between Teb1p and Taz1p, we performed a comparative analysis of the DNA-binding properties of both proteins using combined qualitative and quantitative biochemical approaches. Visualization of DNA-protein complexes by electron microscopy revealed qualitative differences of binding of Teb1p and Taz1p to mammalian type and fission yeast telomeres. Fluorescence anisotropy analysis quantified the binding affinity of Teb1p and Taz1p to three different DNA substrates. Additionally, we carried out electrophoretic mobility shift assays using mammalian type telomeres and native substrates (telomeric repeats, histone-box sequences) as well as their mutated versions. We observed relative DNA sequence binding flexibility of Taz1p and higher binding stringency of Teb1p when both proteins were compared directly to each other. These properties may have driven replacement of Teb1p by Taz1p as the TBP in fission yeast.     

T4 phage gene uvsX product catalyzes homologous DNA pairing.

Gene uvsX of phage T4 controls genetic recombination and the repair of DNA damage. We have recently purified the gene product, and here describe its properties. The protein has a single-stranded DNA-dependent ATPase activity. It binds efficiently to single- and double-stranded DNAs at 0 degrees C in a cooperative manner. At 30 degree C the double-stranded DNA-protein complex was stable, but the single-stranded DNA-protein complex dissociated rapidly. The instability of the latter complex was reduced by ATP. The protein renatured heat-denatured double-stranded DNA, and assimilated linear single-stranded DNA into homologous superhelical duplexes to produce D-loops. The reaction is stimulated by gene 32 protein when the uvsX protein is limiting. With linear double-stranded DNA and homologous, circular single-stranded DNA, the protein catalyzed single-strand displacement in the 5' to 3' direction with the cooperation of gene 32 protein. All reactions required Mg2+, and all except DNA binding required ATP. We conclude that the uvsX protein is directly involved in strand exchange and is analogous to the recA protein of Escherichia coli. The differences between the uvsX protein and the recA protein, and the role of gene 32 protein in single-strand assimilation and single-strand displacement are briefly discussed.     

Sequence-specific binding property of Arabidopsis thaliana telomeric DNA binding protein 1 (AtTBP1)

We have identified an Arabidopsis thaliana cDNA, designated as AtTBP1, encoding a protein with a predicted size of 70.6 kDa that specifically binds to the plant telomeric repeat sequence TTTAGGG. AtTBP1 is present as a single-copy gene in Arabidopsis genome and is expressed ubiquitously in various organs. AtTBP1 has a single Myb telomeric DNA binding domain at the C-terminus and an extensive homology with other known telomere-binding proteins. The isolated C-terminus of AtTBP1 is capable of sequence-specific DNA binding to plant duplex telomeric DNA. These results suggest that AtTBP1 may play important roles in plant telomere function in vivo.     

DNA recognition and binding by the Euplotes telomere protein.

The 51-kDa telomere protein from Euplotes crassus binds to the extreme terminus of macronuclear telomeres, generating a very salt-stable telomeric DNA-protein complex. The protein recognizes both the sequence and the structure of the telomeric DNA. To explore how the telomere protein recognizes and binds telomeric DNA, we have examined the DNA-binding specificity of the purified protein using oligonucleotides that mimic natural and mutant versions of Euplotes telomeres. The protein binds very specifically to the 3' terminus of single-stranded oligonucleotides with the sequence (T4G4) > or = 3 T4G2; even slight modifications to this sequence reduce binding dramatically. The protein does not bind oligonucleotides corresponding to the complementary C4A4 strand of the telomere or to double-stranded C4A4.T4G4-containing sequences. Digestion of the telomere protein with trypsin generates an N-terminal protease-resistant fragment of approximately 35 kDa. This 35-kDa peptide appears to comprise the DNA-binding domain of the telomere protein as it retains most of the DNA-binding characteristics of the native 51-kDa protein. For example, the 35-kDa peptide remains bound to telomeric DNA in 2 M KCl. Additionally, the peptide binds well to single-stranded oligonucleotides that have the same sequence as the T4G4 strand of native telomeres but binds very poorly to mutant telomeric DNA sequences and double-stranded telomeric DNA. Removal of the C-terminal 15 kDa from the telomere protein does diminish the ability of the protein to bind only to the terminus of a telomeric DNA molecule.     

Sequence-specific and 3'-end selective single-strand DNA binding by the Oxytricha nova telomere end binding protein alpha subunit

Oxytricha nova telomere end binding protein (OnTEBP) specifically recognizes and caps single-strand (T(4)G(4))(2) telomeric DNA at the very 3'-ends of O. nova macronuclear chromosomes. The discovery of proteins homologous to the N-terminal domain of the OnTEBP alpha subunit in Euplotes crassus, Schizosaccharomyces pombe, and Homo sapiens suggests that related proteins are widely distributed in eukaryotes. Previously reported crystal structures of the ssDNA binding domain of the OnTEBP alpha subunit both uncomplexed and complexed with telomeric ssDNA have suggested specific mechanisms for sequence-specific and 3'-end selective recognition of the single-strand telomeric DNA. We now describe comparative binding studies of ssDNA recognition by the N-terminal domain of the OnTEBP alpha subunit. Addition of nucleotides to the 3'-end of the TTTTGGGG telomere repeat decreases the level of alpha binding by up to 7-fold, revealing a modest specificity for a 3'-terminus relative to an internal DNA binding site. Nucleotide substitutions at specific positions within the t(1)t(2)t(3)T(4)G(5)G(6)G(7)G(8) repeat show that base substitutions at some sites do not substantially decrease the binding affinity (<2-fold for lowercase letters), while substitutions at other sites dramatically reduce the binding affinity (>20-fold decrease for the uppercase bold letter). Comparison of the structural and binding data provides unique insights into the ways in which proteins recognize and bind single-stranded DNA.     

Identification of non-telomeric G4-DNA binding proteins in human,E. coli,yeast, and Arabidopsis

G4-DNA binding proteins of E. coli, Saccharomyces cerevisiae, Arabidopsis, and human have been identified by a synthetic non-telomeric G4-DNA oligo 5'-d(ACTGTCGTACTTGATATGGGGGT)-3' using gel mobility shift assays. G4-DNA binding proteins are specific to G4-DNA, a four-stranded guanine-DNA structure. Bound complexes of G4-DNA and proteins were identified in nuclear extracts of all examined organisms in this study. In humans, three different G4-DNA and protein complexes were identified. However, human telomeric G-quadruplex oligo did not compete with G4-DNA oligo in the competition assays, suggesting that the identified G4-DNA binding proteins may be different from the known human telomeric G4-DNA binding proteins. We discovered two complexes of G4-DNA and protein in Arabidopsis identified in mobility shift assays. Interestingly, two complexes of G4-DNA and proteins were identified from E. coli, which have a circular genomic DNA structure. Results of this investigation suggest that non-telomeric G4-DNA structure and its binding proteins may be involved in important functional roles in both prokaryotes and eukaryotes.     

Delineation of the high-affinity single-stranded telomeric DNA-binding domain of Saccharomyces cerevisiae Cdc13

Cdc13 is an essential protein from Saccharomyces cerevisiae that caps telomeres by protecting the C-rich telomeric DNA strand from degradation and facilitates telomeric DNA replication by telomerase. In vitro, Cdc13 binds TG-rich single-stranded telomeric DNA with high affinity and specificity. A previously identified domain of Cdc13 encompassing amino acids 451–694 (the 451–694 DBD) retains the single-stranded DNA-binding properties of the full-length protein; however, this domain contains a large unfolded region identified in heteronuclear NMR experiments. Trypsin digestion and MALDI mass spectrometry were used to identify the minimal DNA-binding domain (the 497–694 DBD) necessary and sufficient for full DNA-binding activity. This domain was completely folded, and the N-terminal unfolded region removed was shown to be dispensable for function. Using affinity photocrosslinking to site-specifically modified telomeric single-stranded DNA, the 497–694 DBD was shown to contact the entire 11mer required for high-affinity binding. Intriguingly, both domains bound single-stranded telomeric DNA with much greater affinity than the full-length protein. The full-length protein exhibited the same rate of dissociation as both domains, however, indicating that the full-length protein contains a region that inhibits association with single-stranded telomeric DNA.     

POT-3 preferentially binds the terminal DNA-repeat on the telomeric G-overhang

Eukaryotic chromosomes typically end in 3′ telomeric overhangs. The safeguarding of telomeric single-stranded DNA overhangs is carried out by factors related to the protection of telomeres 1 (POT1) protein in humans. Of the three POT1-like proteins in Caenorhabditis elegans, POT-3 was the only member thought to not play a role at telomeres. Here, we provide evidence that POT-3 is a bona fide telomere-binding protein. Using a new loss-of-function mutant, we show that the absence of POT-3 causes telomere lengthening and increased levels of telomeric C-circles. We find that POT-3 directly binds the telomeric G-strand in vitro and map its minimal DNA binding site to the six-nucleotide motif, GCTTAG. We further show that the closely related POT-2 protein binds the same motif, but that POT-3 shows higher sequence selectivity. Crucially, in contrast to POT-2, POT-3 prefers binding sites immediately adjacent to the 3′ end of DNA. These differences are significant as genetic analyses reveal that pot-2 and pot-3 do not function redundantly with each other in vivo. Our work highlights the rapid evolution and specialisation of telomere binding proteins and places POT-3 in a unique position to influence activities that control telomere length.