首页 | 本学科首页   官方微博 | 高级检索  
相似文献
 共查询到20条相似文献,搜索用时 156 毫秒
1.
Forty-five different point mutations in POLG, the gene encoding the catalytic subunit of the human mitochondrial DNA polymerase (pol γ), cause the early onset mitochondrial DNA depletion disorder, Alpers syndrome. Sequence analysis of the C-terminal polymerase region of pol γ revealed a cluster of four Alpers mutations at highly conserved residues in the thumb subdomain (G848S, c.2542g→a; T851A, c.2551a→g; R852C, c.2554c→t; R853Q, c.2558g→a) and two Alpers mutations at less conserved positions in the adjacent palm subdomain (Q879H, c.2637g→t and T885S, c.2653a→t). Biochemical characterization of purified, recombinant forms of pol γ revealed that Alpers mutations in the thumb subdomain reduced polymerase activity more than 99% relative to the wild-type enzyme, whereas the palm subdomain mutations retained 50–70% wild-type polymerase activity. All six mutant enzymes retained physical and functional interaction with the pol γ accessory subunit (p55), and none of the six mutants exhibited defects in misinsertion fidelity in vitro. However, differential DNA binding by these mutants suggests a possible orientation of the DNA with respect to the polymerase during catalysis. To our knowledge this study represents the first structure-function analysis of the thumb subdomain in pol γ and examines the consequences of mitochondrial disease mutations in this region.As the only DNA polymerase found in animal cell mitochondria, DNA polymerase γ (pol γ)3 bears sole responsibility for DNA synthesis in all replication and repair transactions involving mitochondrial DNA (1, 2). Mammalian cell pol γ is a heterotrimeric complex composed of one catalytic subunit of 140 kDa (p140) and two 55-kDa accessory subunits (p55) that form a dimer (3). The catalytic subunit contains an N-terminal exonuclease domain connected by a linker region to a C-terminal polymerase domain. Whereas the exonuclease domain contains essential motifs I, II, and III for its activity, the polymerase domain comprising the thumb, palm, and finger subdomains contains motifs A, B, and C that are crucial for polymerase activity. The catalytic subunit is a family A DNA polymerase that includes bacterial pol I and T7 DNA polymerase and possesses DNA polymerase, 3′ → 5′ exonuclease, and 5′-deoxyribose phosphate lyase activities (for review, see Refs. 1 and 2). The 55-kDa accessory subunit (p55) confers processive DNA synthesis and tight binding of the pol γ complex to DNA (4, 5).Depletion of mtDNA as well as the accumulation of deletions and point mutations in mtDNA have been observed in several mitochondrial disorders (for review, see Ref. 6). mtDNA depletion syndromes are caused by defects in nuclear genes responsible for replication and maintenance of the mitochondrial genome (7). Mutation of POLG, the gene encoding the catalytic subunit of pol γ, is frequently involved in disorders linked to mutagenesis of mtDNA (8, 9). Presently, more than 150 point mutations in POLG are linked with a wide variety of mitochondrial diseases, including the autosomal dominant (ad) and recessive forms of progressive external ophthalmoplegia (PEO), Alpers syndrome, parkinsonism, ataxia-neuropathy syndromes, and male infertility (tools.niehs.nih.gov/polg) (9).Alpers syndrome, a hepatocerebral mtDNA depletion disorder, and myocerebrohepatopathy are rare heritable autosomal recessive diseases primarily affecting young children (1012). These diseases generally manifest during the first few weeks to years of life, and symptoms gradually develop in a stepwise manner eventually leading to death. Alpers syndrome is characterized by refractory seizures, psychomotor regression, and hepatic failure (11, 12). Mutation of POLG was first linked to Alpers syndrome in 2004 (13), and to date 45 different point mutations in POLG (18 localized to the polymerase domain) are associated with Alpers syndrome (9, 14, 15). However, only two Alpers mutations (A467T and W748S, both in the linker region) have been biochemically characterized (16, 17).During the initial cloning and sequencing of the human, Drosophila, and chicken pol γ genes, we noted a highly conserved region N-terminal to motif A in the polymerase domain that was specific to pol γ (18). This region corresponds to part of the thumb subdomain that tracks DNA into the active site of both Escherichia coli pol I and T7 DNA polymerase (1921). A high concentration of disease mutations, many associated with Alpers syndrome, is found in the thumb subdomain.Here we investigated six mitochondrial disease mutations clustered in the N-terminal portion of the polymerase domain of the enzyme (Fig. 1A). Four mutations (G848S, c.2542g→a; T851A, c.2551a→g; R852C, c.2554c→t; R853Q, c.2558g→a) reside in the thumb subdomain and two (Q879H, c.2637g→t and T885S, c.2653a→t) are located in the palm subdomain. These mutations are associated with Alpers, PEO, mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes (MELAS), ataxia-neuropathy syndrome, Leigh syndrome, and myocerebrohepatopathy (
POLG mutationDiseaseGeneticsReference
G848SAlpers syndromeIn trans with A467T, Q497H, T251I-P587L, or W748S-E1143G in Alpers syndrome15, 35, 4350
Leigh syndromeIn trans with R232H in Leigh syndrome49
MELASIn trans with R627Q in MELAS38
PEO with ataxia-neuropathyIn trans with G746S and E1143G in PEO with ataxia50
PEOIn trans with T251I and P587L in PEO51, 52
T851AAlpers syndromeIn trans with R1047W48, 53
In trans with H277C
R852CAlpers syndromeIn trans with A467T14, 48, 50
In cis with G11D and in trans with W748S-E1143G or A467T
Ataxia-neuropathyIn trans with G11D-R627Q15
R853QMyocerebrohepatopathyIn trans with T251I-P587L15
Q879HAlpers syndrome with valproate-induced hepatic failureIn cis with E1143G and in trans with A467T-T885S35, 54
T885SAlpers syndrome with valproate-induced hepatic failureIn cis with A467T and in trans with Q879H-E1143G35, 54
Open in a separate windowOpen in a separate windowFIGURE 1.POLG mutations characterized in this study. A, the location of the six mutations characterized is shown in red in the primary sequence of pol γ. Four mutations, the G848S, T851A, R852C, and R853Q, are located in the thumb domain, whereas two mutations, the Q879H and T885S, are in the palm domain of the polymerase region. B, sequence alignment of pol γ from yeast to humans. The amino acids characterized in this study are shown in red. Yellow-highlighted amino acids are highly conserved, and blue-highlighted amino acids are moderately conserved.  相似文献   

2.
Engineering of a Chimeric RB69 DNA Polymerase Sensitive to Drugs Targeting the Cytomegalovirus Enzyme     
Egor P. Tchesnokov  Aleksandr Obikhod  Raymond F. Schinazi  Matthias G?tte 《The Journal of biological chemistry》2009,284(39):26439-26446
  相似文献   

3.
Critical Factors Determining Dimerization of Human Antizyme Inhibitor     
Kuo-Liang Su  Ya-Fan Liao  Hui-Chih Hung    Guang-Yaw Liu 《The Journal of biological chemistry》2009,284(39):26768-26777
Ornithine decarboxylase (ODC) is the first enzyme involved in polyamine biosynthesis, and it catalyzes the decarboxylation of ornithine to putrescine. ODC is a dimeric enzyme, whereas antizyme inhibitor (AZI), a positive regulator of ODC that is homologous to ODC, exists predominantly as a monomer and lacks decarboxylase activity. The goal of this paper was to identify the essential amino acid residues that determine the dimerization of AZI. The nonconserved amino acid residues in the putative dimer interface of AZI (Ser-277, Ser-331, Glu-332, and Asp-389) were substituted with the corresponding residues in the putative dimer interface of ODC (Arg-277, Tyr-331, Asp-332, and Tyr-389, respectively). Analytical ultracentrifugation analysis was used to determine the size distribution of these AZI mutants. The size-distribution analysis data suggest that residue 331 may play a major role in the dimerization of AZI. Mutating Ser-331 to Tyr in AZI (AZI-S331Y) caused a shift from a monomer configuration to a dimer. Furthermore, in comparison with the single mutant AZI-S331Y, the AZI-S331Y/D389Y double mutant displayed a further reduction in the monomer-dimer Kd, suggesting that residue 389 is also crucial for AZI dimerization. Analysis of the triple mutant AZI-S331Y/D389Y/S277R showed that it formed a stable dimer (Kd value = 1.3 μm). Finally, a quadruple mutant, S331Y/D389Y/S277R/E332D, behaved as a dimer with a Kd value of ∼0.1 μm, which is very close to that of the human ODC enzyme. The quadruple mutant, although forming a dimer, could still be disrupted by antizyme (AZ), further forming a heterodimer, and it could rescue the AZ-inhibited ODC activity, suggesting that the AZ-binding ability of the AZI dimer was retained.Polyamines (putrescine, spermidine, and spermine) have been shown to have both structural and regulatory roles in protein and nucleic acid biosynthesis and function (13). Ornithine decarboxylase (ODC,3 EC 4.1.1.17) is a central regulator of cellular polyamine synthesis (reviewed in Refs. 1, 4, 5). This enzyme catalyzes the pyridoxal 5-phosphate (PLP)-dependent decarboxylation of ornithine to putrescine, and it is the first and rate-limiting enzyme in polyamine biosynthesis (2, 3, 6, 7). ODC and polyamines play important roles in a number of biological functions, including embryonic development, cell cycle, proliferation, differentiation, and apoptosis (815). They also have been associated with human diseases and a variety of cancers (1626). Because the regulation of ODC and polyamine content is critical to cell proliferation (11), as well as in the origin and progression of neoplastic diseases (23, 24), ODC has been identified as an oncogenic enzyme, and the inhibitors of ODC and the polyamine pathway are important targets for therapeutic intervention in many cancers (6, 11).ODC is ubiquitously found in organisms ranging from bacteria to humans. It contains 461 amino acid residues in each monomer and is a 106-kDa homodimer with molecular 2-fold symmetry (27, 28). Importantly, ODC activity requires the formation of a dimer (2931). X-ray structures of the ODC enzyme reveal that this dimer contains two active sites, both of which are formed at the interface between the N-terminal domain of one monomer, which provides residues involved in PLP interactions, and the C-terminal domain of the other subunit, which provides the residues that interact with substrate (27, 3241).ODC undergoes a unique ubiquitin-independent proteasomal degradation via a direct interaction with the regulatory protein antizyme (AZ). Binding of AZ promotes the dissociation of the ODC homodimers and targets ODC for degradation by the 26 S proteasome (4246). Current models of antizyme function indicate that increased polyamine levels promote the fidelity of the AZ mRNA translational frameshift, leading to increased concentrations of AZ (47). The AZ monomer selectively binds to dimeric ODC, thereby inactivating ODC by forming inactive AZ-ODC heterodimers (44, 4850). AZ acts as a regulator of polyamine metabolism that inhibits ODC activity and polyamine transport, thus restricting polyamine levels (4, 5, 51, 52). When antizymes are overexpressed, they inhibit ODC and promote ubiquitin-independent proteolytic degradation of ODC. Because elevated ODC activity is associated with most forms of human malignancies (1), it has been suggested that antizymes may function as tumor suppressors.In contrast to the extensive studies on the oncogene ODC, the endogenous antizyme inhibitor (AZI) is less well understood. AZI is homologous to the enzyme ODC. It is a 448-amino acid protein with a molecular mass of 50 kDa. However, despite the homology between these proteins, AZI does not possess any decarboxylase activity. It binds to antizyme more tightly than does ODC and releases ODC from the ODC-antizyme complex (53, 54). Both the AZI and AZ proteins display rapid ubiquitin-dependent turnover within a few minutes to 1 h in vivo (5). However, AZ binding actually stabilizes AZI by inhibiting its ubiquitination (55).AZI, which inactivates all members of the AZ family (53, 56), restores ODC activity (54), and prevents the proteolytic degradation of ODC, may play a role in tumor progression. It has been reported that down-regulation of AZI is associated with the inhibition of cell proliferation and reduced ODC activity, presumably through the modulation of AZ function (57). Moreover, overexpression of AZI has been shown to increase cell proliferation and promote cell transformation (5860). Furthermore, AZI is capable of direct interaction with cyclin D1, preventing its degradation, and this effect is at least partially independent of AZ function (60, 61). These results demonstrate a role for AZI in the positive regulation of cell proliferation and tumorigenesis.It is now known that ODC exists as a dimer and that AZI may exist as a monomer physiologically (62). Fig. 1 shows the dimeric structures of ODC (Fig. 1A) and AZI (Fig. 1B). Although structural studies indicate that both ODC and AZI crystallize as dimers, the dimeric AZI structure has fewer interactions at the dimer interface, a smaller buried surface area, and a lack of symmetry of the interactions between residues from the two monomers, suggesting that the AZI dimer may be nonphysiological (62). In this study, we identify the critical amino acid residues governing the difference in dimer formation between ODC and AZI. Our preliminary studies using analytical ultracentrifugation indicated that ODC exists as a dimer, whereas AZI exists in a concentration-dependent monomer-dimer equilibrium. Multiple sequence alignments of ODC and AZI from various species have shown that residues 277, 331, 332, and 389 are not conserved between ODC and AZI (Open in a separate windowFIGURE 1.Crystal structure and the amino acid residues at the dimer interface of human ornithine decarboxylase (hODC) and mouse antizyme inhibitor (mAZI). A, homodimeric structure of human ODC with the cofactor PLP analog, LLP (Protein Data Bank code 1D7K). B, putative dimeric structure of mouse AZI (Protein Data Bank code 3BTN). The amino acid residues in the dimer interface are shown as a ball-and-stick model. The putative AZ-binding site is colored in cyan. This figure was generated using PyMOL (DeLano Scientific LLC, San Carlos, CA).

TABLE 1

Amino acid residues at the dimer interface of human ODC and AZI
Human ODCResidueHuman AZI
Nonconserved
    Arg277Ser
    Tyr331Ser
    Asp332Glu
    Tyr389Asp

Conserved
    Asp134Asp
    Lys169Lys
    Lys294Lys
    Tyr323Tyr
    Asp364Asp
    Gly387Gly
    Phe397Phe
Open in a separate window  相似文献   

4.
Single-cell-type Proteomics: Toward a Holistic Understanding of Plant Function     
Shaojun Dai  Sixue Chen 《Molecular & cellular proteomics : MCP》2012,11(12):1622-1630
  相似文献   

5.
A Systematic Proteomic Analysis of Listeria monocytogenes House-keeping Protein Secretion Systems     
Sven Halbedel  Swantje Reiss  Birgit Hahn  Dirk Albrecht  Gopala Krishna Mannala  Trinad Chakraborty  Torsten Hain  Susanne Engelmann  Antje Flieger 《Molecular & cellular proteomics : MCP》2014,13(11):3063-3081
  相似文献   

6.
Proteomics of Saccharomyces cerevisiae Organelles     
Elena Wiederhold  Liesbeth M. Veenhoff  Bert Poolman    Dirk Jan Slotboom 《Molecular & cellular proteomics : MCP》2010,9(3):431-445
  相似文献   

7.
Active Efflux of Organic Solvents by Pseudomonas putida S12 Is Induced by Solvents   总被引:2,自引:0,他引:2       下载免费PDF全文
Jasper Kieboom  Jonathan J. Dennis  Gerben J. Zylstra    Jan A. M. de Bont 《Journal of bacteriology》1998,180(24):6769-6772
  相似文献   

8.
Molecular and Biochemical Characterization of the Protein Template Controlling Biosynthesis of the Lipopeptide Lichenysin     
Dirk Konz  Sascha Doekel  Mohamed A. Marahiel 《Journal of bacteriology》1999,181(1):133-140
Lichenysins are surface-active lipopeptides with antibiotic properties produced nonribosomally by several strains of Bacillus licheniformis. Here, we report the cloning and sequencing of an entire 26.6-kb lichenysin biosynthesis operon from B. licheniformis ATCC 10716. Three large open reading frames coding for peptide synthetases, designated licA, licB (three modules each), and licC (one module), could be detected, followed by a gene, licTE, coding for a thioesterase-like protein. The domain structure of the seven identified modules, which resembles that of the surfactin synthetases SrfA-A to -C, showed two epimerization domains attached to the third and sixth modules. The substrate specificity of the first, fifth, and seventh recombinant adenylation domains of LicA to -C (cloned and expressed in Escherichia coli) was determined to be Gln, Asp, and Ile (with minor Val and Leu substitutions), respectively. Therefore, we suppose that the identified biosynthesis operon is responsible for the production of a lichenysin variant with the primary amino acid sequence l-Gln–l-Leu–d-Leu–l-Val–l-Asp–d-Leu–l-Ile, with minor Leu and Val substitutions at the seventh position.Many strains of Bacillus are known to produce lipopeptides with remarkable surface-active properties (11). The most prominent of these powerful lipopeptides is surfactin from Bacillus subtilis (1). Surfactin is an acylated cyclic heptapeptide that reduces the surface tension of water from 72 to 27 mN m−1 even in a concentration below 0.05% and shows some antibacterial and antifungal activities (1). Some B. subtilis strains are also known to produce other, structurally related lipoheptapeptides (Table (Table1),1), like iturin (32, 34) and bacillomycin (3, 27, 30), or the lipodecapeptides fengycin (50) and plipastatin (29).

TABLE 1

Lipoheptapeptide antibiotics of Bacillus spp.
LipopeptideOrganismStructureReference
Lichenysin AB. licheniformisFAa-L-Glu-L-Leu-D-Leu-L-Val-L-Asn-D-Leu-L-Ile51, 52
Lichenysin BFAa-L-Glu-L-Leu-D-Leu-L-Val-L-Asp-D-Leu-L-Leu23, 26
Lichenysin CFAa-L-Glu-L-Leu-D-Leu-L-Val-L-Asp-D-Leu-L-Ile17
Lichenysin DFAa-L-Gln-L-Leu-D-Leu-L-Val-L-Asp-D-Leu-L-IleThis work
Surfactant 86B. licheniformisFAa-L-Glxd-L-Leu-D-Leu-L-Val-L-Asxd-D-Leu-L-Ilee14, 15
L-Val
SurfactinB. subtilisFAa-L-Glu-L-Leu-D-Leu-L-Val-L-Asp-D-Leu-L-Leu1, 7, 49
EsperinB. subtilisFAb-L-Glu-L-Leu-D-Leu-L-Val-L-Asp-D-Leu-L-Leue45
L-Val 
Iturin AB. subtilisFAc-L-Asn-D-Tyr-D-Asn-L-Gln-L-Pro-D-Asn-L-Ser32
Iturin CFAc-L-Asn-D-Tyr-D-Asn-L-Gln-L-Pro-D-Asne-L-Asne34
D-Ser-L-Thr 
Bacillomycin LB. subtilisFAc-L-Asp-D-Tyr-D-Asn-L-Ser-L-Gln-D-Proe-L-Thr3
D-Ser- 
Bacillomycin DFAc-L-Asp-D-Tyr-D-Asn-L-Pro-L-Glu-D-Ser-L-Thr30, 31
Bacillomycin FFAc-L-Asn-D-Tyr-D-Asn-L-Gln-L-Pro-D-Asn-L-Thr27
Open in a separate windowaFA, β-hydroxy fatty acid. The β-hydroxy group forms an ester bond with the carboxy group of the C-terminal amino acid. bFA, β-hydroxy fatty acid. The β-hydroxy group forms an ester bond with the carboxy group of Asp5. cFA, β-amino fatty acid. The β-amino group forms a peptide bond with the carboxy group of the C-terminal amino acid. dOnly the following combinations of amino acid 1 and 5 are allowed: Gln-Asp or Glu-Asn. eWhere an alternative amino acid may be present in a structure, the alternative is also presented. In addition to B. subtilis, several strains of Bacillus licheniformis have been described as producing the lipopeptide lichenysin (14, 17, 23, 26, 51). Lichenysins can be grouped under the general sequence l-Glx–l-Leu–d-Leu–l-Val–l-Asx–d-Leu–l-Ile/Leu/Val (Table (Table1).1). The first amino acid is connected to a β-hydroxyl fatty acid, and the carboxy-terminal amino acid forms a lactone ring to the β-OH group of the lipophilic part of the molecule. In contrast to the lipopeptide surfactin, lichenysins seem to be synthesized during growth under aerobic and anaerobic conditions (16, 51). The isolation of lichenysins from cells growing on liquid mineral salt medium on glucose or sucrose basic has been studied intensively. Antimicrobial properties and the ability to reduce the surface tension of water have also been described (14, 17, 26, 51). The structural elucidation of the compounds revealed slight differences, depending on the producer strain. Various distributions of branched and linear fatty acid moieties of diverse lengths and amino acid variations in three defined positions have been identified (Table (Table11).In contrast to the well-defined methods for isolation and structural characterization of lichenysins, little is known about the biosynthetic mechanisms of lichenysin production. The structural similarity of lichenysins and surfactin suggests that the peptide moiety is produced nonribosomally by multifunctional peptide synthetases (7, 13, 25, 49, 53). Peptide synthetases from bacterial and fungal sources describe an alternative route in peptide bond formation in addition to the ubiquitous ribosomal pathway. Here, large multienzyme complexes affect the ordered recognition, activation, and linking of amino acids by utilizing the thiotemplate mechanism (19, 24, 25). According to this model, peptide synthetases activate their substrate amino acids as aminoacyl adenylates by ATP hydrolysis. These unstable intermediates are subsequently transferred to a covalently enzyme-bound 4′-phosphopantetheinyl cofactor as thioesters. The thioesterified amino acids are then integrated into the peptide product through a stepwise elongation by a series of transpeptidations directed from the amino terminals to the carboxy terminals. Peptide synthetases have not only awakened interest because of their mechanistic features; many of the nonribosomally processed peptide products also possess important biological and medical properties.In this report we describe the identification and characterization of a putative lichenysin biosynthesis operon from B. licheniformis ATCC 10716. Cloning and sequencing of the entire lic operon (26.6 kb) revealed three genes, licA, licB, and licC, with structural patterns common to peptide synthetases and a gene designated licTE, which codes for a putative thioesterase. The modular organization of the sequenced genes resembles the requirements for the biosynthesis of the heptapeptide lichenysin. Based on the arrangement of the seven identified modules and the tested substrate specificities, we propose that the identified genes are involved in the nonribosomal synthesis of the portion of the lichenysin peptide with the primary sequence l-Gln–l-Leu–d-Leu–l-Val–l-Asp–d-Leu–l-Ile (with minor Val and Leu substitutions).  相似文献   

9.
Chimeric Nitrogenase-like Enzymes of (Bacterio)chlorophyll Biosynthesis     
Denise W?tzlich  Markus J. Br?cker  Frank Uliczka  Markus Ribbe  Simone Virus  Dieter Jahn  Jürgen Moser 《The Journal of biological chemistry》2009,284(23):15530-15540
Nitrogenase-like light-independent protochlorophyllide oxidoreductase (DPOR) is involved in chlorophyll biosynthesis. Bacteriochlorophyll formation additionally requires the structurally related chlorophyllide oxidoreductase (COR). During catalysis, homodimeric subunit BchL2 or ChlL2 of DPOR transfers electrons to the corresponding heterotetrameric catalytic subunit, (BchNB)2 or (ChlNB)2. Analogously, subunit BchX2 of the COR enzymes delivers electrons to subunit (BchYZ)2. Various chimeric DPOR enzymes formed between recombinant subunits (BchNB)2 and BchL2 from Chlorobaculum tepidum or (ChlNB)2 and ChlL2 from Prochlorococcus marinus and Thermosynechococcus elongatus were found to be enzymatically active, indicating a conserved docking surface for the interaction of both DPOR protein subunits. Biotin label transfer experiments revealed the interaction of P. marinus ChlL2 with both subunits, ChlN and ChlB, of the (ChlNB)2 tetramer. Based on these findings and on structural information from the homologous nitrogenase system, a site-directed mutagenesis approach yielded 10 DPOR mutants for the characterization of amino acid residues involved in protein-protein interaction. Surface-exposed residues Tyr127 of subunit ChlL, Leu70 and Val107 of subunit ChlN, and Gly66 of subunit ChlB were found essential for P. marinus DPOR activity. Next, the BchL2 or ChlL2 part of DPOR was exchanged with electron-transferring BchX2 subunits of COR and NifH2 of nitrogenase. Active chimeric DPOR was generated via a combination of BchX2 from C. tepidum or Roseobacter denitrificans with (BchNB)2 from C. tepidum. No DPOR activity was observed for the chimeric enzyme consisting of NifH2 from Azotobacter vinelandii in combination with (BchNB)2 from C. tepidum or (ChlNB)2 from P. marinus and T. elongatus, respectively.Chlorophyll and bacteriochlorophyll biosynthesis, as well as nitrogen fixation, are essential biochemical processes developed early in the evolution of life (1). During biological fixation of nitrogen, nitrogenase catalyzes the reduction of atmospheric dinitrogen to ammonia (2). Enzyme systems homologous to nitrogenase play a crucial role in the formation of the chlorin and bacteriochlorin ring system of chlorophylls (Chl)2 and bacteriochlorophylls (Bchl) (3, 4) (Fig. 1a). For the synthesis of both Chl and Bchl, the stereospecific reduction of the C-17-C-18 double bond of ring D of protochlorophyllide (Pchlide) catalyzed by the nitrogenase-like enzyme light-independent (dark-operative) protochlorophyllide oxidoreductase (DPOR) results in the formation of chlorophyllide (Chlide) (Fig. 1a, left) (5, 6). DPOR enzymes consist of three protein subunits which are designated BchN, BchB and BchL in Bchl-synthesizing organisms and ChlN, ChlB and ChlL in Chl-synthesizing organisms. A second reduction step at ring B (C-7-C-8) unique to the synthesis of Bchl converts the chlorin Chlide into a bacteriochlorin ring structure to form bacteriochlorophyllide (Bchlide) (Fig. 1a, right, Bchlide). This reaction is catalyzed by another nitrogenase-like enzyme, termed chlorophyllide oxidoreductase (COR) (7). COR enzymes are composed of subunits BchY, BchZ, and BchX.Open in a separate windowFIGURE 1.Comparison of the three subunit enzymes DPOR, COR, and nitrogenase. a, during Chl and Bchl biosynthesis, ring D is stereospecifically reduced by the nitrogenase-like enzyme DPOR (subunit composition BchL2/(BchNB)2 or ChlL2/(ChlNB)2) leading to the chlorin Chlide. Subunits N, B, and L are named ChlN, ChlB, and ChlL in Chl-synthesizing organisms and BchN, BchB, and BchL in Bchl-synthesizing organisms. The synthesis of Bchl additionally requires the stereospecific B ring reduction by a second nitrogenase-like enzyme called COR, with the subunit composition BchX2/(BchYZ)2. COR catalyzes the formation of the bacteriochlorin Bchlide. Subunits Y, Z, and X of the COR enzyme are named BchY, BchZ, and BchX. b, the homologous nitrogenase complex has the subunit composition NifH2/(NifD/NifK)2. Rings A–E and the carbon atoms are designated according to IUPAC nomenclature (41). R is either a vinyl or an ethyl moiety. The position marked by an asterisk indicates either a vinyl or a hydroxyethyl moiety (42).All subunits share significant amino acid sequence homology to the corresponding subunits of nitrogenase, which are designated NifD, NifK, and NifH, respectively (1) (compare Fig. 1, a and b). Whereas subunits BchL or ChlL, BchX and NifH exhibit a sequence identity at the amino acid level of ∼33%, subunits BchN or ChlN, BchY, NifD, and BchB or ChlB, BchZ, and NifK, respectively, show lower sequence identities of ∼15% (1). For all enzymes a common oligomeric protein architecture has been proposed consisting of the heterotetrameric complexes (BchNB)2 or (ChlNB)2, (BchYZ)2, and (NifD/NifK)2, which are completed by a homodimeric protein subunit BchL2 or ChlL2, BchX2, and NifH2, respectively (compare Fig. 1, a and b) (3, 7, 8).Nitrogenase is a well characterized protein complex that catalyzes the reduction of nitrogen to ammonia in a reaction that requires at least 16 molecules of MgATP (2, 9, 10). During nitrogenase catalysis, subunit NifH2 (Fe protein) associates with and dissociates from the (NifD/NifK)2 complex (MoFe protein). Binding, hydrolysis of MgATP and structural rearrangements are coupled to sequential intersubunit electron transfer. For this purpose, NifH2 contains an ATP-binding motif and an intersubunit [4Fe-4S] cluster coordinated by two cysteine residues from each NifH monomer (1, 11). Electrons from this [4Fe-4S] cluster are transferred via a [8Fe-7S] cluster (P-cluster) onto the [1Mo-7Fe-9S-X-homocitrate] cluster (MoFe cofactor). Both of the latter clusters are located on (NifD/NifK)2, where dinitrogen is reduced to ammonia (10). Three-dimensional structures of NifH2 in complex with (NifD/NifK)2 revealed a detailed picture of the dynamic interaction of both subcomplexes (8, 12).Based on biochemical and bioinformatic approaches, it has been proposed that the initial steps of DPOR reaction strongly resemble nitrogenase catalysis. Key amino acid residues essential for DPOR function have been identified by mutagenesis of the enzyme from Chlorobaculum tepidum (formerly denoted as Chlorobium tepidum) (3). The catalytic mechanism of DPOR includes the electron transfer from a “plant-type” [2Fe-2S] ferredoxin onto the dimeric DPOR subunit, BchL2, carrying an intersubunit [4Fe-4S] redox center coordinated by Cys97 and Cys131 in C. tepidum. Analogous to nitrogenase, Lys10 in the phosphate-binding loop (P-loop) and Leu126 in the switch II region of DPOR were found essential for DPOR catalysis. Moreover, it was shown that the BchL2 protein from C. tepidum does not form a stable complex with the catalytic (BchNB)2 subcomplex. Therefore, a transient interaction responsible for the electron transfer onto protein subunit (BchNB)2 has been proposed (3).The subsequent [Fe-S] cluster-dependent catalysis and the specific substrate recognition at the active site located on subunit (BchNB)2 are unrelated to nitrogenase. The (BchNB)2 subcomplex was shown to carry a second [4Fe-4S] cluster, which was proposed to be ligated by Cys21, Cys46, and Cys103 of the BchN subunit and Cys94 of subunit BchB (C. tepidum numbering) (3). No evidence for any type of additional cofactor was obtained from biochemical and EPR spectroscopic analyses (5, 13). Thus, despite the same common oligomeric architecture, the catalytic subunits (BchNB)2 and (ChlNB)2 clearly differ from the corresponding nitrogenase complex, as no molybdenum-containing cofactor or P-cluster equivalent is employed (5, 14). From these results it was concluded that electrons from the [4Fe-4S] cluster of (BchNB)2 or (ChlNB)2 are transferred directly onto the Pchlide substrate at the active site of DPOR.The second nitrogenase-like enzyme, COR, catalyzes the reduction of ring B of Chlide during the biosynthesis of Bchl (7). Therefore, an accurate discrimination of the ring systems of the individual substrates is required. COR subunits share an overall amino acid sequence identity of 15–22% for BchY and BchZ and 31–35% for subunit BchX when compared with the corresponding DPOR subunits (supplemental Figures S2–S4). In amino acid sequence alignments of BchX proteins with the closely related BchL or ChlL subunits of DPOR, both cysteinyl ligands responsible for [4Fe-4S] cluster formation and residues for ATP binding are conserved (1). Furthermore, all cysteinyl residues characterized as ligands for a catalytic [4Fe-4S] cluster in (BchNB)2 or (ChlNB)2 are conserved in the sequences of subunits BchY and BchZ of COR (7). These findings correspond to a recent EPR study in which a characteristic signal for a [4Fe-4S] cluster was obtained for the COR subunit BchX2 as well as for subunit (BchYZ)2 (15). These results indicate that the catalytic mechanism of COR strongly resembles DPOR catalysis. In vitro assays for nitrogenase as well as for DPOR and COR make use of the artificial electron donor dithionite in the presence of high concentrations of ATP (7, 16, 17).

TABLE 1

Amino acid sequence identities of the individual subunits of DPOR, COR, and nitrogenaseAmino acid sequences of the individual subunits of DPOR, COR, and nitrogenase employed in the present study (compareFig. 3A) were aligned by using the ClustalW method in MegAlign (DNASTAR), and sequence identities were calculated.
DPOR
COR
Nitrogenase
NBLYZXNifDNifKNifH
DPOR
    N37–5815–1812–20
    B34–6215–2214–18
    L51–6931–3531–38

COR
    Y35–7813–15
    Z39–8111–16
    X42–8329–36

Nitrogenase
    NifD17–70
    NifK37–58
    NifH67–75
Open in a separate windowIn this study, we investigated the transient interaction of the dimeric subunit BchL2 or ChlL2 with the heterotetrameric (BchNB)2 or (ChlNB)2 complex, which is essential for DPOR catalysis. We make use of the individually purified DPOR subunits BchL2 and (BchNB)2 from the green sulfur bacterium C. tepidum and ChlL2 and (ChlNB)2 from the prochlorophyte Prochlorococcus marinus and from the cyanobacterium Thermosynechococcus elongatus. The individual combination of (BchNB)2 or (ChlNB)2 complexes and BchL2 or ChlL2 proteins from these organisms resulted in catalytically active chimeras of DPOR. These results enabled us to propose conserved regions of the postulated docking surface, which were subsequently verified in a mutagenesis study. To elucidate the potential evolution of the electron-transferring subunit of nitrogenase and nitrogenase-like enzymes, we also analyzed chimeric enzymes consisting of DPOR subunits (BchNB)2 or (ChlNB)2 in combination with subunits BchX2 from C. tepidum and R. denitrificans of the COR enzyme and with subunit NifH2 of nitrogenase from Azotobacter vinelandii, respectively.  相似文献   

10.
Neurodegeneration and Alzheimer's disease (AD). What Can Proteomics Tell Us About the Alzheimer's Brain?     
Guillermo Moya-Alvarado  Noga Gershoni-Emek  Eran Perlson  Francisca C. Bronfman 《Molecular & cellular proteomics : MCP》2016,15(2):409-425
  相似文献   

11.
Glycopeptide-preferring Polypeptide GalNAc Transferase 10 (ppGalNAc T10), Involved in Mucin-type O-Glycosylation, Has a Unique GalNAc-O-Ser/Thr-binding Site in Its Catalytic Domain Not Found in ppGalNAc T1 or T2     
Cynthia L. Perrine  Anjali Ganguli  Peng Wu  Carolyn R. Bertozzi  Timothy A. Fritz  Jayalakshmi Raman  Lawrence A. Tabak    Thomas A. Gerken 《The Journal of biological chemistry》2009,284(30):20387-20397
Mucin-type O-gly co sy la tion is initiated by a large family of UDP-GalNAc:polypeptide α-N-acetylgalactosaminyltransferases (ppGalNAc Ts) that transfer GalNAc from UDP-GalNAc to the Ser and Thr residues of polypeptide acceptors. Some members of the family prefer previously gly co sylated peptides (ppGalNAc T7 and T10), whereas others are inhibited by neighboring gly co sy la tion (ppGalNAc T1 and T2). Characterizing their peptide and glycopeptide substrate specificity is critical for understanding the biological role and significance of each isoform. Utilizing a series of random peptide and glycopeptide substrates, we have obtained the peptide and glycopeptide specificities of ppGalNAc T10 for comparison with ppGalNAc T1 and T2. For the glycopeptide substrates, ppGalNAc T10 exhibited a single large preference for Ser/Thr-O-GalNAc at the +1 (C-terminal) position relative to the Ser or Thr acceptor site. ppGalNAc T1 and T2 revealed no significant enhancements suggesting Ser/Thr-O-GalNAc was inhibitory at most positions for these isoforms. Against random peptide substrates, ppGalNAc T10 revealed no significant hydrophobic or hydrophilic residue enhancements, in contrast to what has been reported previously for ppGalNAc T1 and T2. Our results reveal that these transferases have unique peptide and glycopeptide preferences demonstrating their substrate diversity and their likely roles ranging from initiating transferases to filling-in transferases.Mucin-type O-glycosylation is a common post-translational modification of secreted and membrane-associated proteins. O-Glycan biosynthesis is initiated by the transfer of GalNAc from UDP-GalNAc to the hydroxyl groups of serine or threonine residues in a polypeptide, catalyzed by a family of polypeptide N-α-acetylgalactosaminyltransferases (ppGalNAc Ts).5 To date, 16 mammalian members have been reported in the literature (116) with a total of at least 20 members currently present in the human genome data base. Multiple members of the ppGalNAc T family have also been identified in Drosophila (9, 10, 14), Caenorhabditis elegans (3, 8), and single and multicellular organisms (1720). Several members show close sequence orthologues across species suggesting that the ppGalNAc Ts are responsible for biologically significant functions that have been conserved during evolution. For example, in Drosophila four isoforms have close sequence orthologues to the mammalian transferases. Of the two that have been recently compared, nearly identical peptide substrate specificities have been observed between the fly and mammals, suggesting common but presently unknown functions preserved across these diverse species (21).Recently, several ppGalNAc T isoforms have been shown to be important for normal development or cellular processes. For example, inactive mutations in the fly PGANT35A (the T11 orthologue in mammals) are lethal because of the disruption of the tracheal tube structures (9, 10, 22), whereas mutations in PGANT3 alter epithelial cell adhesion in the Drosophila wing blade resulting in wing blistering (23). In humans, mutations in ppGalNAc T3 are associated with familial tumoral calcinosis, the result of the abnormal processing and secretion of the phosphaturic factor FGF23 (24, 25). Human ppGalNAc T14 has been suggested to modulate apoptotic signaling in tumor cells by its glycosylation of the proapoptotic receptors DLR4 and DLR5 (26), and very recently the specific O-glycosylation of the TGFB-II receptor (ActR-II) by the GalNTL1 has been shown to modulate its signaling in development (16).Historically, the major targets of the ppGalNAc Ts have been thought to be heavily O-glycosylated mucin domains of membrane and secreted glycoproteins. Such domains typically contain 15–30% Ser or Thr, which are highly (>50%) substituted by GalNAc. One question in the field is as follows. How is this high degree of peptide core glycosylation achieved and is it related to the large number of ppGalNAc isoforms, some of which may even have specific mucin domain preferences? Interestingly, some members of the ppGalNAc T family are known to prefer substrates that have been previously modified with O-linked GalNAc on nearby Ser/Thr residues, hence having so-called glycopeptide or filling-in activities, i.e. ppGalNAc T7 and T10 (8, 2729). Others simply possess altered preferences against glycopeptide substrates, i.e. ppGalNAc T2 and T4 (3033), or may be inhibited by neighboring glycosylation, i.e. ppGalNAc T1 and T2 (29, 34, 35). These latter transferases have been called early or initiating transferases, preferring nonglycosylated over-glycosylated substrates. Presently, little is known about which factors dictate the different peptide/glycopeptide specificities among the ppGalNAc Ts.The ppGalNAc Ts consist of an N-terminal catalytic domain tethered by a short linker to a C-terminal ricin-like lectin domain containing three recognizable carbohydrate-binding sites (36). Because ppGalNAc T7 and T10 prefer to transfer GalNAc to glycopeptide acceptors, it has been widely assumed that their C-terminal lectin domains would play significant roles in this activity, as has been demonstrated for other family members (27, 28, 32). Recently, Kubota et al. (37) solved the crystal structure of ppGalNAc T10 in complex with Ser-GalNAc specifically bound to its lectin domain. In this work (37), the authors further demonstrated that a T10 lectin domain mutant indeed had altered specificity against GalNAc-containing glycopeptide substrates when the acceptor Ser/Thr site was distal from the pre-existing glycopeptide GalNAc site. However, it was also observed that the lectin mutant still possessed relatively unaltered glycopeptide activity when the acceptor Ser/Thr site was directly N-terminal of a pre-existing glycopeptide GalNAc site. Kubota et al. (37) therefore concluded that for ppGalNAc T10, both its lectin and indeed its catalytic domain must contain distinct peptide GalNAc recognition sites. In support of this, Raman et al. (33) have shown that the complete removal of the ppGalNAc T10 lectin domain only slightly alters its specificity against distal glycopeptide substrates while showing no difference in its ability to glycosylate residues directly N-terminal of an existing site of glycosylation. Thus, it seems that the catalytic domain of ppGalNAc T10 may have specific requirements for a peptide O-linked GalNAc in at least the +1 position (toward the C terminus) of residues being glycosylated. As no systematic determination of the glycopeptide binding properties of the ppGalNAc Ts catalytic domain has been performed, it is unknown whether additional GalNAc peptide-binding sites exist in T10 or, for that matter, any of the other ppGalNAc Ts.We have recently reported the use of oriented random peptide substrates, GAGA(X)nT(X)nAGAGK (where X indicates randomized amino acid positions and n = 3 and 5) for determining the peptide substrate specificities of mammalian ppGalNAc T1, T2, and their fly orthologues (21, 38). In the present work, we extend this approach to the determination of the catalytic domain glycopeptide (Ser/Thr-O-GalNAc) substrate preferences for ppGalNAc T1, T2, and T10 employing two n = 4 oriented random glycopeptide libraries (21). Interestingly, ppGalNAc T10 displays few significant enhancements and specifically lacks the Pro residue enhancements observed for ppGalNAc T1 and T2. These findings further demonstrate the vast substrate diversity of the catalytic domains of the ppGalNAc T family of transferases.

TABLE 1

ppGalNAc transferase random substrates utilized in this workPVI, PVII, GP-I, and GP-II random (glyco)peptide substrates.
PeptideSequenceNo. of unique sequences
GAGAXXXXXTXXXXXAGAGK
P-VIX = G, A, P, V, L, Y, E, Q, R, H10 × 109
P-VIIX = G, A, P, I, M, F, D, N, R, K10 × 109

GAGAXXXXTXXXXAGAG
GP-IX = G, A, P, V, I, F, Y, E, D, N, R, K, H, and Ser-O-α-GalNAc1.47 × 109

GAGAXXXX(Thr-O-α-GalNAc)XXXXAGAG
GP-IIX = G, A, P, V, I, F, Y, E, D, N, R, K, H, S1.47 × 109
Open in a separate window  相似文献   

12.
RNA Polymerase I Transcription Silences Noncoding RNAs at the Ribosomal DNA Locus in Saccharomyces cerevisiae     
Elisa Cesarini  Francesca Romana Mariotti  Francesco Cioci  Giorgio Camilloni 《Eukaryotic cell》2010,9(2):325-335
  相似文献   

13.
The Atrazine Catabolism Genes atzABC Are Widespread and Highly Conserved     
Mervyn L. de Souza  Jennifer Seffernick  Betsy Martinez  Michael J. Sadowsky  Lawrence P. Wackett 《Journal of bacteriology》1998,180(7):1951-1954
Pseudomonas strain ADP metabolizes the herbicide atrazine via three enzymatic steps, encoded by the genes atzABC, to yield cyanuric acid, a nitrogen source for many bacteria. Here, we show that five geographically distinct atrazine-degrading bacteria contain genes homologous to atzA, -B, and -C. The sequence identities of the atz genes from different atrazine-degrading bacteria were greater than 99% in all pairwise comparisons. This differs from bacterial genes involved in the catabolism of other chlorinated compounds, for which the average sequence identity in pairwise comparisons of the known members of a class ranged from 25 to 56%. Our results indicate that globally distributed atrazine-catabolic genes are highly conserved in diverse genera of bacteria.Atrazine [2-chloro-4-(ethylamino)-6-(isopropylamino)- 1,3,5-triazine] is a herbicide used for controlling broad-leaf and grassy weeds and is relatively persistent in soils (51). Atrazine and other s-triazine compounds have been detected in ground and surface waters at levels exceeding the Environmental Protection Agency’s maximum contaminant level of 3 ppb (30).Microbial populations exposed to synthetic chlorinated compounds, such as atrazine, often respond by producing enzymes that degrade these molecules. Most of our current understanding of the genes and enzymes involved in atrazine degradation derives from studies using Pseudomonas strain ADP, in which the first three enzymatic steps in atrazine degradation have been defined (6, 14, 15, 48). The genes atz A, -B, and -C, which encode these enzymes, have been cloned and sequenced. Atrazine chlorohydrolase (AtzA), hydroxyatrazine ethylaminohydrolase (AtzB), and N-isopropylammelide isopropylaminohydrolase (AtzC) sequentially convert atrazine to cyanuric acid (6, 14, 15, 48) (Fig. (Fig.1).1). Cyanuric acid and related compounds are catabolized by many soil bacteria (10, 11, 17, 24, 26, 61), and by Pseudomonas sp. ADP, to carbon dioxide and ammonia (35). This provides the evolutionary pressure for the atzA, -B, and -C genes to permit bacterial growth on the more than one billion pounds of atrazine that have been applied to soils globally (20). Here we used a knowledge of the atzA, -B, and -C gene sequences to investigate the presence of homologous genes in other atrazine-degrading bacteria. In this study, we report that five atrazine-degrading microorganisms, which were recently isolated from geographically separated sites exposed to atrazine, contained nearly identical atzA, -B, and -C genes. Open in a separate windowFIG. 1Pathway for atrazine catabolism to cyanuric acid in Pseudomonas sp. strain ADP.

Atrazine-catabolizing bacteria used in this study.

Until recently, attempts at isolating bacteria (18) or fungi (27) that completely degrade atrazine to carbon dioxide, ammonia, and chloride were unsuccessful. While several microorganisms were shown to dealkylate atrazine, they were unable to displace the chlorine atom (41, 54). Since 1994, several research groups have independently isolated atrazine-degrading bacteria that displaced the chlorine atom and mineralized atrazine (3, 7, 13, 35, 39, 46). Six of these bacterial cultures, listed in Table Table1,1, were studied here, and the Clavibacter strain had been investigated previously (13).

TABLE 1

Recently isolated atrazine-catabolizing bacteria
GenusStrainLocation where isolatedYr reported (reference)
PseudomonasaADPAgricultural-chemical dealership site, Little Falls, Minn.1995 (35)
RalstoniaaM91-3Agricultural soil, Ohio1995 (46, 55)
Mixed cultureBasel, Switzerland1995 (57)
ClavibacterAgricultural soil, Riverside, Calif.1996 (13)
AgrobacteriumJ14aAgricultural soil, Nebraska1996 (39)
NDb38/38Atrazine-contaminated soil, Indiana1996 (3)
AlcaligenesaSG1Industrial settling pond, San Gabriel, La.1997 (7)
Open in a separate windowaIsolate identity based on 16S rRNA sequence analysis. bND, not determined. 

Detection of atzA, -B, and -C homologs in atrazine-degrading microorganisms by PCR analysis.

Recently isolated atrazine-degrading bacteria were screened for the presence of DNA homologous to the Pseudomonas strain ADP atzABC genes, which encode enzymes transforming atrazine to cyanuric acid (Fig. (Fig.1).1). Total genomic DNA was isolated from each of these bacteria as described elsewhere (49), and the PCR technique was used to amplify sequences internal to the atzA, -B, and -C genes as described elsewhere (13). Custom primers were designed specifically for atzA (5′CCATGTGAACCAGATCCT3′ and 5′TGAAGCGTCCACATTACC3′), atzB (5′TCACCGGGGATGTCGCGGGC3′ and 5′CTCTCCCGCATGGCATCGGG3′), and atzC (5′GCTCACATGCAGGTACTCCA3′ and 5′GTACCATATCACCGTTTGCCA3′) by using the Primer Designer package, version 2.01 (Scientific and Educational Software, State Line, Pa.), and were synthesized by Gibco BRL (Gaithersburg, Md.). PCR fragments were amplified by using Taq DNA polymerase (Gibco BRL) (22) and were separated from primers on a 1.0% agarose gel. The results of these studies (Fig. (Fig.2)2) indicated that PCR amplification consistently produced DNA fragments of 0.5 kb for all organisms when the atzA or -B primers were used and fragments of 0.6 kb when the atzC primers were used. Open in a separate windowFIG. 2PCR analysis with primers designed to amplify internal regions of atzA (lanes 1 to 5), atzB (lanes 6 to 10), and atzC (lanes 11 to 15). The atrazine-degrading bacteria analyzed were Pseudomonas strain ADP (35) (lanes 1, 6, and 11), Alcaligenes strain SGI (7) (lanes 2, 7, and 12), Ralstonia strain M91-3 (46) (lanes 3, 8, and 13), Agrobacterium strain J14a (39) (lanes 4, 9, and 14), and isolate 38/38 (3) (lanes 5, 10, and 15). Values to the right of the gel are sizes (in kilobase pairs).Southern hybridization analyses were performed on the PCR-amplified DNA as described elsewhere (49) to confirm the presence of homologous DNA. We used a 0.6-kb ApaI/PstI fragment from pMD4 (15), a 1.5-kb BglII fragment from pATZB-2 (6), and a 2.0-kb EcoRI/AvaI fragment from pTD2.5 (48) as probes for atzA, -B, and -C genes, respectively. DNA probes were labeled with [α-32P]dCTP by using the Rediprime Random Primer Labeling Kit (Amersham Life Science, Arlington Heights, Ill.) according to the manufacturer’s instructions. Southern hybridization analyses, performed under stringent conditions, confirmed that each strain contained DNA homologous to atzA, -B, and -C (data not shown). With strain M91-3 and isolate 38/38, however, in addition to the expected 0.5-kb atzB PCR product (Fig. (Fig.2,2, lanes 8 and 10), a 1.2-kb fragment was also obtained. However, no hybridization to this fragment was seen with the atzB probe. Similar investigations showed that a mixed culture obtained from Switzerland (Table (Table1),1), capable of degrading atrazine, also contained DNA homologous to all three atz genes (12).As a negative control, bacteria known not to degrade atrazine were analyzed. PCR analyses were carried out with genomic DNA from the following randomly chosen laboratory strains: Rhodococcus chlorophenolicus (1), Flavobacterium sp. (47), Streptomyces coelicolor M145 (21), Amycolatopsis mediterranei (19), Agrobacterium strain A136 and strain A348 (A136/pTiA6NC) (60), Arthrobacter globiformis MN1 (45), Bradyrhizobium japonicum (33), Rhizobium sp. strain NGR 234 (44), Pseudomonas NRRLB12228, and Klebsiella pneumoniae 99 (16). None of these strains contained DNA that was amplified by PCR using the primers designed to identify the atzA, -B, or -C gene (data not shown).

DNA sequences of atzA, -B, and -C homologs in atrazine-degrading microorganisms.

DNAs amplified from the five strains in Table Table11 with the atzA, -B, and -C primers were purified from gel slices by using the GeneClean II System (Bio 101, Inc., Vista, Calif.) and sequenced with a PRISM Ready Reaction DyeDeoxy Terminator Cycle Sequencing kit (Perkin-Elmer Corp., Norwalk, Conn.) and an ABI model 373A DNA sequencer (Applied Biosystems, Foster City, Calif.). The GCG sequence analysis software package (Genetics Computer Group, Inc., Madison, Wis.) was used for all DNA and protein sequence comparisons and alignments. Table Table22 summarizes these data. The PCR-amplified genes were ≥99% identical to the Pseudomonas strain ADP atzA, -B, and -C genes in all pairwise comparisons of DNA sequences. This remarkable sequence identity suggested that each atz gene in the different genera was derived from a common ancestor and that they have diverged evolutionarily only to a limited extent.

TABLE 2

Sequence identities of atzABC homologs from different atrazine-degrading bacteria
Strain% DNA sequence identitya
atzAatzBatzC
Pseudomonas ADP100100100
Alcaligenes SG199.2100100
Ralstonia M91-399.0100100
Agrobacterium J14a99.1100100
Isolate 38/3899.310099.8
Open in a separate windowaDNA sequences obtained from each strain by using the ataA, -B, and -C primers were compared with the atzABC gene sequences from Pseudomonas strain ADP. A review of the literature on other bacterial catabolic pathways indicated a much greater degree of divergence when genes encoding enzymes for the catabolism of other commercially relevant chlorinated compounds were compared (Table (Table3).3). As with atrazine, multiple bacterial strains that catabolize 1,2-dichloroethane, chloroacetic acid, 2,4-dichlorophenoxyacetate, dichloromethane, and 4-chlorobenzoate have been isolated. A comparison of the gene sequences encoding the initiating reactions in the catabolism of each of those compounds revealed that sequence divergence was comparatively high. In pairwise comparisons within each gene class, the average sequence identities ranged from 25 to 56% (divergence was 46 to 75%). With the atzABC genes, by contrast, there is at most a 1% sequence difference within the sequenced gene region (Table (Table2).2). Moreover, the atzB sequences were completely identical, and the atzC genes diverged by only 1 bp in one of the five strains tested. This suggests that the atz genes recently arose from a single origin and have become distributed globally. Similarly, identical parathion hydrolase genes were isolated from two bacteria representing different genera and global locations (40, 52, 53).

TABLE 3

Sequence comparisons of isofunctional bacterial enzymes that catabolize chlorinated compounds
GeneEnzymeAverage % protein sequence identitya (no. of pairwise comparisons)References
dhlA, dhaAHaloalkane dehalogenase25.0 (1)23, 31
dehC, hadL, dehH, dehH1, dehH2, dhlB, dehCI, dehCII2-Haloacid dehalogenase36.6 ± 3.9 (36)5, 25, 28, 29, 42, 43, 50, 59
tfdA2,4-Dichlorophenoxyacetate monooxygenase43.2 ± 4.6 (21)b34, 37, 38, 56, 58
dcmADichloromethane dehalogenase56.0 (1)4, 32
atzAAtrazine chlorohydrolase98.6 ± 0.12 (15)cThis study
atzBHydroxyatrazine ethylaminohydrolase100 (10)cThis study
atzCN-Isopropylammelide isopropylaminohydrolase99.0 ± 0.43 (10)cThis study
Open in a separate windowaAll possible pairwise alignments of translated gene sequences were made. The average percent identity is the mean of the percent identity values for all pairwise alignments ± standard error of the mean. bIncludes full protein sequences as well as partial protein sequences of ≥100 amino acids. cSequence identity within a 0.5-kb PCR product for atzA and -B and within a 0.6-kb PCR product for atzC. Six sequences were analyzed for atzA, and five were analyzed for atzB and -C. The data presented here provide further support for previous studies suggesting that hydroxyatrazine in the environment derives from biological processes (36), and not solely from abiotic reactions (2, 9). The present data, and a recent report by Bouquard et al. (8), indicate that the gene encoding atrazine chlorohydrolase is widespread in the United States and Europe.Our observations argue for a single, recent evolutionary origin of the atz genes and their subsequent global distribution. We have recently localized the atzA, -B, and -C genes to a large, self-transmissible plasmid in Pseudomonas strain ADP (12), and possible mechanisms of transfer of the atzABC genes are currently under investigation.  相似文献   

14.
Visualization of Ca2+ Signaling During Embryonic Skeletal Muscle Formation in Vertebrates     
Sarah E. Webb  Andrew L. Miller 《Cold Spring Harbor perspectives in biology》2011,3(2)
Dynamic changes in cytosolic and nuclear Ca2+ concentration are reported to play a critical regulatory role in different aspects of skeletal muscle development and differentiation. Here we review our current knowledge of the spatial dynamics of Ca2+ signals generated during muscle development in mouse, rat, and Xenopus myocytes in culture, in the exposed myotome of dissected Xenopus embryos, and in intact normally developing zebrafish. It is becoming clear that subcellular domains, either membrane-bound or otherwise, may have their own Ca2+ signaling signatures. Thus, to understand the roles played by myogenic Ca2+ signaling, we must consider: (1) the triggers and targets within these signaling domains; (2) interdomain signaling, and (3) how these Ca2+ signals integrate with other signaling networks involved in myogenesis. Imaging techniques that are currently available to provide direct visualization of these Ca2+ signals are also described.The recognition of Ca2+ as a key regulator of muscle contraction dates back to Sydney Ringer''s seminal observations in the latter part of the 19th Century (Ringer 1883; Ringer 1886; Ringer and Buxton 1887; see reviews by Martonosi 2000; Szent-Györgyi 2004). More recently, evidence is steadily accumulating to support the proposition that Ca2+ also plays a necessary and essential role in regulating embryonic muscle development and differentiation (Flucher and Andrews 1993; Ferrari et al. 1996; Lorenzon et al. 1997; Ferrari and Spitzer 1998, 1999; Wu et al. 2000; Powell et al. 2001; Jaimovich and Carrasco 2002; Li et al. 2004; Brennan et al. 2005; Harris et al. 2005; Campbell et al. 2006; Terry et al. 2006; Fujita et al. 2007; and see reviews by Berchtold et al. 2000; Ferrari et al. 2006; Al-Shanti and Stewart 2009). What is currently lacking, however, is extensive direct visualization of the spatial dynamics of the Ca2+ signals generated by developing and differentiating muscle cells. This is especially so concerning in situ studies. The object of this article, therefore, is to review and report the current state of our understanding concerning the spatial nature of Ca2+ signaling during embryonic muscle development, especially from an in vivo perspective, and to suggest possible directions for future research. The focus of our article is embryonic skeletal muscle development because of this being an area of significant current interest. Several of the basic observations reported, however, may also be common to cardiac muscle development and in some cases to smooth muscle development. What the recent development of reliable imaging techniques has most certainly done, is to add an extra dimension of complexity to understanding the roles played by Ca2+ signaling in skeletal muscle development. For example, it is clear that membrane-bound subcellular compartments, such as the nucleus (Jaimovich and Carrasco 2002), may have endogenous Ca2+ signaling activities, as do specific cytoplasmic domains, such as the subsarcolemmal space (Campbell et al. 2006). How these Ca2+ signals interact with specific down-stream targets within their particular domain, and how they might serve to communicate information among domains, will most certainly be one of the future challenges in elucidating the Ca2+-mediated regulation of muscle development.Any methodology used to study the properties of biological molecules and how they interact during development should ideally provide spatial information, because researchers increasingly need to integrate data about the interactions that underlie a biological process (such as differentiation) with information regarding the precise location within cells or an embryo where these interactions take place. Current Ca2+ imaging techniques are beginning to provide us with this spatial information, and are thus opening up exciting new avenues of investigation in our quest to understand the signaling pathways that regulate muscle development (AnimalIntact animals/Cells in cultureCa2+ reporterReporter Loading ProtocolReferenceRat1° cultures prepared from hind limb muscle of neonatal rat pupsFluo 3-AMCells incubated in 5.4 µM reporter for 30 min at 25°C.Jaimovich et al. 2000MouseMyotubes grown from C2C12 subclone of the C2 mouse muscle cell lineFluo 3-AMIncubated in 5 µM reporter plus 0.1% pluronic F-127 for 1 h at r.t.Flucher and Andrews 1993Myotubes isolated from the intercostal muscles of E18 wild-type and RyR type 3-null mice.Fluo 3-AMCells incubated with 4 µM for 30 min at r.t.Conklin et al. 1999bMyotubes in culture prepared from newborn mice.Fluo 3-AMCells incubated in 10 µM for 20 min.Shirokova et al. 19991° cultures prepared from hind limb muscle from newborn mice.Fluo 3-AMCells incubated in 5.4 µM reporter for 30 min at 25°C.Powell et al. 2001Embryonic day 18 (E18) isolated diaphragm muscle fibersFluo 4-AMIncubated in 10 µM reporter for 30 min.Chun et al. 2003ChickMyotubes prepared from leg or breast of 11-day chick embryosFluo 3-AMIncubated in 5 µM reporter plus 0.1% pluronic F-127 for 1 h at r.t.Flucher and Andrews 1993Myoblasts isolated from thigh muscle of E12 embryos.Fluo 3-AM1 mM stock was diluted 1:200 with 0.2% pluronic F-127. Cells were incubated for 60 min at r.t. in the dark.Tabata et al. 2006XenopusExposed myotome in dissected embryoFluo-3 AMIncubated dissected tissue in 10 µM reporter for 30–60 min.Ferrari and Spitzer 19991° myocyte cultures prepared from stage 15 Xenopus embryos.Fluo-4 AMCells incubated in 2 µM reporter plus 0.01% pluronic F-127 for 60 min.Campbell et al. 2006ZebrafishIntact animalsCalcium green-1 dextran (10S)Reporter at 20 mM was injected into a single blastomere between the 32- and 128-cell stage.Zimprich et al. 1998Intact animalsOregon Green 488 BAPTA dextranSingle blastomeres from 32-cell stage embryos injected with reporter (i.c. 100 µM) and tetramethylrhodamine dextran (i.c. 40 µM).Ashworth et al. 2001Intact animalsOregon Green 488 BAPTA dextranMicroinjected with rhodamine dextran to give an intracellular concentration of ∼40 µM.Ashworth 2004Intact animalsAequorinaEmbryos injected with 700 pg aeq-mRNA at the 1-cell stage and then incubated with 50 µM f-coelenterazine from the 64-cell stage.Cheung et al. 2006Intact animalsAequorinTransgenic fish that express apoaequorin in the skeletal muscles were incubated with 50 µM f-coelenterazine from the 8-cell stage.Cheung et al. 2010Open in a separate windowaExpression of aequorin was ubiquitous but it was suggested that the Ca2+ signals visualized in the trunk at the approximately 8–20-somite stage and at ∼47 hpf might play a role in muscle development.  相似文献   

15.
Evidence for Interspecies Gene Transfer in the Evolution of 2,4-Dichlorophenoxyacetic Acid Degraders     
Catherine McGowan  Roberta Fulthorpe  Alice Wright  J. M. Tiedje 《Applied and environmental microbiology》1998,64(10):4089-4092
Small-subunit ribosomal DNA (SSU rDNA) from 20 phenotypically distinct strains of 2,4-dichlorophenoxyacetic acid (2,4-D)-degrading bacteria was partially sequenced, yielding 18 unique strains belonging to members of the alpha, beta, and gamma subgroups of the class Proteobacteria. To understand the origin of 2,4-D degradation in this diverse collection, the first gene in the 2,4-D pathway, tfdA, was sequenced. The sequences fell into three unique classes found in various members of the beta and gamma subgroups of Proteobacteria. None of the α-Proteobacteria yielded tfdA PCR products. A comparison of the dendrogram of the tfdA genes with that of the SSU rDNA genes demonstrated incongruency in phylogenies, and hence 2,4-D degradation must have originated from gene transfer between species. Only those strains with tfdA sequences highly similar to the tfdA sequence of strain JMP134 (tfdA class I) transferred all the 2,4-D genes and conferred the 2,4-D degradation phenotype to a Burkholderia cepacia recipient.Bacteria capable of mineralizing 2,4-dichlorophenoxyacetic acid (2,4-D), a commonly used herbicide, are found in many different phylogenetic groups (2, 3, 7, 11, 22, 23). Evidence suggests that numerous variants of 2,4-D catabolic genes exist and that catabolic operons consist of a near-random mixing of these variants (7). Interspecies gene transfer is a well-documented phenomenon (13), and horizontal gene transfer of the 2,4-D-degrading plasmid pJP4 has been shown (3, 5). However, not all 2,4-D catabolic operons are found on plasmids (10, 11, 16, 20). The extent to which other 2,4-D genes have been exchanged in nature is unknown. The aim of this research was to assess the role of horizontal gene transfer in the evolution of 2,4-D-degrading strains. This article summarizes the results of two aspects of this work—the study of the transfer of the entire 2,4-D pathway by using standard mating experiments and a phylogenetic study of the tfdA gene. The tfdA gene codes for an α-ketoglutarate-dependent 2,4-D dioxygenase which converts 2,4-D into 2,4-dichlorophenol and glyoxylate (6). This 861-bp gene was first sequenced from Ralstonia eutropha JMP134 (19). Two more tfdA genes were cloned from chromosomal locations in Burkholderia strain RASC and Burkholderia strain TFD6 (16, 20). These proved to be identical to each other and 78.5% similar to the original. An alignment of the two variants allowed conserved areas to be identified and primers to be designed for the amplification of tfdA-like genes from other sources (24). Sequence analysis of putative tfdA fragments and the small-subunit ribosomal DNA (SSU rDNA) of the strains carrying them allowed us to construct phylogenies of the genes and their hosts and to look for congruency between them.

Mating experiments.

A collection of 2,4-D degraders containing 15 unique strains as determined by genomic fingerprinting (7) was used as a source of donors in a series of mating experiments (Table (Table1).1). Burkholderia cepacia D5, lacking the ability to grow on 2,4-D and not hybridizing to any tfd genes, was used as a recipient in mating experiments. Strain D5 contains neomycin phosphotransferase genes (nptII) carried on transposon Tn5 and is resistant to 50 μg each of kanamycin, carbenicillin, and bacitracin per ml. All of the 2,4-D strains used were sensitive to these antibiotics. Filter matings were performed with a donor-to-recipient ratio of 1:10. Colonies which grew on selective medium (500 ppm of 2,4-D in mineral salts agar [MMO] [23] including 50 μg of kanamycin, carbenicillin, and bacitracin per ml) were subjected to further tests. Their ability to catabolize 2,4-D was tested in liquid medium (same composition as that described above).

TABLE 1

2,4-D-degrading strains, geographic origins, and GenBank accession numbers
StrainGenBank accession no. (SSU rDNA)OriginMost similar to genus and/or speciesaTransferbtfdA typecGenBank accession no. (tfdA gene)Reference or source
JMP134AF049542AustraliaRalstonia eutropha+IM167303
EML1549AF049546OregonBurkholderia sp.+I2
TFD39AF049539SaskatchewanBurkholderia sp.+IU4319723
K712AF049543MichiganBurkholderia sp.+IU4327611
TFD9AF049537SaskatchewanAlcaligenes xylosoxidans+IU4327623
TFD41AF049541MichiganRalstonia eutropha+I23
TFD38AF049540MichiganRalstonia eutropha+NDc23
TFD23AF049536MichiganRhodoferax fermentans+IU4327623
RASCAF049544OregonBurkholderia sp.(+)IIU257172
TFD6AF049546MichiganBurkholderia sp.II23
TFD2AF049545MichiganBurkholderia sp.II23
TFD31AF049536SaskatchewanRhodoferax fermentansIII23
B6-9AF049538OntarioRhodoferax fermentansNDIIIU431969
I-18U22836OregonHalomonas sp.NDIIIU2249915
K1443AF049531MichiganSphingomonas sp.d11
2,4-D1AF049535MontanaSphingomonas sp.R. Sanford
B6-5AF049533OntarioSphingomonas sp.ND9
B6-10AF049534OntarioSphingomonas sp.ND9
EML146AF049532OregonSphingomonas sp.2
M1AF049530French PolynesiaRhodospeudomonas sp.NDR. Fulthorpe
Open in a separate windowaThe generus and/or species most similar to the strain is given based on similarities of SSU rDNA sequences. bSymbols: +, able to transfer 2,4-D degradation to B. cepacia D5; (+), able to transfer at very low frequency; −, no transfer detected. cND, not determined. d—, no amplificate was obtained. The disappearance of 2,4-D from the culture medium was monitored by high-performance liquid chromatography. Cells were removed by centrifugation, and the supernatant was filtered through 0.2-μm-pore-size filters. These samples were then analyzed on a Lichrosorb Rp-18 column (Anspec Co., Ann Arbor, Mich.) with 60% methanol–40% 0.1% H3PO4 as the eluant. 2,4-D was detected by measuring light absorption at 230 nm. The presence of tfd genes was detected by hybridizing colony blots with a DNA probe derived from the entire pJP4 plasmid. The identity of the colonies was confirmed by probing with the nptII gene of Tn5 (found in B. cepacia D5). Probes were labeled with random hexanucleotides incorporating [32P]dCTP (3,000 Ci/mmol; New England Nuclear, Boston, Mass.). Hybridizations were done under high-stringency conditions by using 50% formamide and Denhardt’s solution (18) at 42°C. Of the 15 unique strains tested, 9 transferred 2,4-D degradation abilities to D5. This transfer was confirmed by hybridization with pJP4 for eight of these strains. B. cepacia RASC could transfer degradative abilities, but neither it nor the transconjugant hybridized to the pJP4 probe. Work subsequent to this study has confirmed that the genes carried by RASC do not hybridize to those found on pJP4 under high-stringency conditions (7).

Phylogenetic analyses.

Total genomic DNA was isolated from 20 unique 2,4-D-degrading strains (including all 15 used for mating experiments) grown on 500 ppm of 2,4-D mineral salts medium amended with 50 ppm of yeast extract. SSU rDNA was amplified by using fD1 and rD1 as primers (25). Putative tfdA fragments were amplified by using primers TVU and TVL as previously described (24). PCR products were purified with a Gene Clean kit (Bio 101, La Jolla, Calif.). Sequencing was done with an Applied Biosystems model 373A automatic sequencer (Perkin-Elmer Cetus) by using fluorescently labeled dye termination at the Michigan State University Sequencing Facility. The sequencing primer used for SSU rDNA fragments was 519R (5′ GTA TTA CCG CGG CTG CTG G-3′). For tfdA fragments, the sequencing primers were the same as the amplification primers. GenBank accession numbers for these sequences are given in Table Table11.The SSU rDNA sequences were compared to sequences in GenBank by using the Basic Local Alignment Search Tool (BLAST) (1), and those strains with the highest maximal segment pair scores were retrieved from GenBank and included in the phylogenetic analysis. Sequences were aligned manually with the software SeqEd (Applied Biosystems) and with MacClade (14). Sites where nucleotides were not resolved for all sequences were deleted from the alignment, as were those nucleotides corresponding to the small loop in this region that is absent in the alpha subgroup of the class Proteobacteria. These deletions left 283 unambiguous sites for the construction of the SSU rDNA phylogenies. Phylogenetic trees were constructed by using the neighbor-joining analysis of pairwise Jukes-Cantor distances (4), and the topology was confirmed by using the maximum parsimony method PAUP (21). Desulfomonile tiedjei of the δ-Proteobacteria was used as an outgroup. Bootstrap analysis based on 100 replicates was used to place confidence estimates on the tree. Only bootstrap values of greater than 50 were used.

2,4-D degrader diversity.

The 2,4-D degraders in this study were distributed throughout the alpha, beta, and gamma subgroups of the Proteobacteria (Fig. (Fig.1).1). The lack of representation of gram-positive bacteria is likely a reflection of isolation methods, not of the lack of gram-positive 2,4-D degraders. The majority of these strains were members of the beta subgroup of Proteobacteria, five of which were most closely related to the genus Burkholderia, having at least 92% sequence similarity with each other. Three were closely related to Rhodoferax fermentans (close to the class Comamonadaceae), three were related to Ralstonia eutropha, and one was related to Alcaligenes xylosoxidans. TFD39 falls outside any clear cluster. One member of the γ-Proteobacteria, strain I-18, a haloalkaliphile, was found to be closely related to the salt-loving genus Halomonas (15). The remaining six strains all clustered in the alpha branch of Proteobacteria (Fig. (Fig.1).1). Of this subgroup, five were most closely related to the genus Sphingomonas. One member of the α-Proteobacteria, strain M1, which is the most oligotrophic and slow growing of all the strains used in this study, is 97% similar to Rhodopseudomonas palustris. The character of strain M1 correlates well with its phylogenetic placement near the slow-growing genus Bradyrhizobium. Open in a separate windowFIG. 1Neighbor-joining dendrogram (Jukes-Cantor distances) of SSU rDNA from 2,4-D-degrading bacteria (indicated in boldface type) and reference strains (indicated in italic type). Class I (•), class II (▴), and class III (■) types of tfdA genes are indicated. Bootstrap confidence limits (percentages) are indicated above each branch. Scale bar represents a Jukes-Cantor distance of 0.01.

tfdA gene fragments.

tfdA gene fragments were successfully amplified and sequenced from 10 strains of β-Proteobacteria and 1 strain of γ-Protobacteria. None of the strains from the α-Proteobacteria gave any amplificates with these primers. These 313 contiguous nucleotides were aligned with additional tfdA sequences from JMP134 and from strain RASC (Fig. (Fig.2).2). Three distinct classes of tfdA gene sequences with slight variations in each class were found. Class I included fragments from JMP134, TFD39, TFD23, K712, and TFD9 that differed from each other by 2 bp at the most. Class I tfdA genes are probably plasmid encoded. All strains with a class I tfdA gene examined so far contained broad-host-range, self-transmissible plasmids containing 2,4-D genes (2, 3, 11, 17). All of the strains with a class I tfdA gene were able to transfer the 2,4-D phenotype in the mating studies reported above. The class II tfdA sequences included identical fragments amplified from RASC, TFD6, and TFD2 which were 76% similar to those in class I. Class III included identical fragments from strains TFD31, B6-9, and I-18 which were 77% similar to class I genes and 80% similar to class II genes. Both class II and III tfdA genes differed from each other and from class I genes in the same nine sites corresponding to the third base pair of the codons. The tfdA phylogenetic tree is a simple one, with three distinct branches that are incongruent with the SSU rDNA-derived phylogeny (Fig. (Fig.3).3). Class I tfdA sequences were found in Burkholderia-like strains, in strains related to the Comamonas-Rhodoferax group, and in the Ralstonia-Acaligenes group, all in the β-Proteobacteria. Class II sequences are less widely distributed, found only in Burkholderia-like branches. However, even in this subgroup, this tfdA variant is found in strains that differ by 7% at the SSU rDNA level (RASC and TFD2). However, the class III sequences were most interesting, being found both in the Comamonas-Rhodoferax group and in a strain of the γ-Proteobacteria, I-18, strains that differ by 24% at the SSU rDNA level. Class III genes have since been found in a collection of randomly isolated non-2,4-D degraders, including gram-positive bacilli, as well as in various gram-negative bacteria, even though the gene is not expressed (10). Open in a separate windowFIG. 2Alignment of 313 nucleotides of internal fragments of tfdA genes from representative strains. Nucleotides identical to tfdA from pJP4 are represented by periods.Open in a separate windowFIG. 3Phylogenetic incongruency of tfdA genes and SSU rDNA from diverse 2,4-D-degrading bacteria. Dendrograms for tfdA and SSU rDNA are indicated. Shading indicates the type of tfdA sequence, either class I, II, or III. Note that branch lengths are not drawn to scale.An interesting result was the detection of two different tfdA gene variants in sibling strains. TFD23 and TFD31 are identical at the ribosomal gene level, but one harbors a class I gene and the other harbors a class III gene. Similarly, TFD6 and EML159 are rRNA siblings that carry a class II and class I gene, respectively.None of the α-Proteobacteria yielded a PCR product when amplified with the conserved tfdA primers. This finding complements our observation that none of these bacteria hybridized to the tfdA gene, even under conditions of low stringency, indicating that any tfdA-like genes in the α-Proteobacteria are likely to be more divergent from the ones sequenced here (7, 11). In addition, none of the Sphingomonas strains in the study hybridized with a whole pJP4 probe, and similarly, no Sphingomonas strains scored positive for transfer of 2,4-D-degrading ability to recipient B. cepacia D5. Together these results suggest a reduced gene flow between members of the α- and β- or γ-Proteobacteria or poor gene expression of β- or γ-derived genes by α-Proteobacteria. Although plasmid pJP4 is a broad-host-range plasmid and has been known to transfer to α-Proteobacteria such as Rhizobium and Agrobacterium species and to γ-Proteobacteria such as Pseudomonas putida, Pseudomonas fluorescens, and Pseudomonas aeruginosa, the 2,4-D pathway is not expressed in these strains of the α- or γ-Proteobacteria (3). Phylogenetically limited expression of plasmid-borne 3-chlorobenzoate-degradative genes has also been noted for the pseudomonads (8). Subsequent studies have found divergent but related sequences for the tfdB and tfdC genes in 2,4-D-degrading Sphingomonas strains (7, 12, 24).With the exceptions of the minor differences within the class I pJP4-like tfdA sequences, there were no intermediate tfdA sequences. The most likely explanation of this is that the rate of horizontal transfer of the tfd genes is high relative to the rate at which mutations can accumulate. Examination of sequences of tfdA genes from a greater variety of organisms may turn up more intermediate variation.  相似文献   

16.
Multiple roles for cytokinin receptors and cross-talk of signaling pathways     
Teodoro Coba de la Pe?a  Claudia B Cárcamo  M Mercedes Lucas  José J Pueyo 《Plant signaling & behavior》2008,3(10):791-794
  相似文献   

17.
Comparative Analysis of Myxococcus Predation on Soil Bacteria     
Andrew D. Morgan  R. Craig MacLean  Kristina L. Hillesland  Gregory J. Velicer 《Applied and environmental microbiology》2010,76(20):6920-6927
Predator-prey relationships among prokaryotes have received little attention but are likely to be important determinants of the composition, structure, and dynamics of microbial communities. Many species of the soil-dwelling myxobacteria are predators of other microbes, but their predation range is poorly characterized. To better understand the predatory capabilities of myxobacteria in nature, we analyzed the predation performance of numerous Myxococcus isolates across 12 diverse species of bacteria. All predator isolates could utilize most potential prey species to effectively fuel colony expansion, although one species hindered predator swarming relative to a control treatment with no growth substrate. Predator strains varied significantly in their relative performance across prey types, but most variation in predatory performance was determined by prey type, with Gram-negative prey species supporting more Myxococcus growth than Gram-positive species. There was evidence for specialized predator performance in some predator-prey combinations. Such specialization may reduce resource competition among sympatric strains in natural habitats. The broad prey range of the Myxococcus genus coupled with its ubiquity in the soil suggests that myxobacteria are likely to have very important ecological and evolutionary effects on many species of soil prokaryotes.Predation plays a major role in shaping both the ecology and evolution of biological communities. The population and evolutionary dynamics of predators and their prey are often tightly coupled and can greatly influence the dynamics of other organisms as well (1). Predation has been invoked as a major cause of diversity in ecosystems (11, 12). For example, predators may mediate coexistence between superior and inferior competitors (2, 13), and differential trajectories of predator-prey coevolution can lead to divergence between separate populations (70).Predation has been investigated extensively in higher organisms but relatively little among prokaryotes. Predation between prokaryotes is one of the most ancient forms of predation (27), and it has been proposed that this process may have been the origin of eukaryotic cells (16). Prokaryotes are key players in primary biomass production (44) and global nutrient cycling (22), and predation of some prokaryotes by others is likely to significantly affect these processes. Most studies of predatory prokaryotes have focused on Bdellovibrionaceae species (e.g., see references 51, 55, and 67). These small deltaproteobacteria prey on other Gram-negative cells, using flagella to swim rapidly until they collide with a prey cell. After collision, the predator cells then enter the periplasmic space of the prey cell, consume the host cell from within, elongate, and divide into new cells that are released upon host cell lysis (41). Although often described as predatory, the Bdellovibrionaceae may also be considered to be parasitic, as they typically depend (apart from host-independent strains that have been observed [60]) on the infection and death of their host for their reproduction (47).In this study, we examined predation among the myxobacteria, which are also deltaproteobacteria but constitute a monophyletic clade divergent from the Bdellovibrionaceae (17). Myxobacteria are found in most terrestrial soils and in many aquatic environments as well (17, 53, 74). Many myxobacteria, including the model species Myxococcus xanthus, exhibit several complex social traits, including fruiting body formation and spore formation (14, 18, 34, 62, 71), cooperative swarming with two motility systems (64, 87), and group (or “wolf pack”) predation on both bacteria and fungi (4, 5, 8, 9, 15, 50). Using representatives of the genus Myxococcus, we tested for both intra- and interspecific variation in myxobacterial predatory performance across a broad range of prey types. Moreover, we examined whether prey vary substantially in the degree to which they support predatory growth by the myxobacteria and whether patterns of variation in predator performance are constant or variable across prey environments. The latter outcome may reflect adaptive specialization and help to maintain diversity in natural populations (57, 59).Although closely related to the Bdellovibrionaceae (both are deltaproteobacteria), myxobacteria employ a highly divergent mode of predation. Myxobacteria use gliding motility (64) to search the soil matrix for prey and produce a wide range of antibiotics and lytic compounds that kill and decompose prey cells and break down complex polymers, thereby releasing substrates for growth (66). Myxobacterial predation is cooperative both in its “searching” component (6, 31, 82; for details on cooperative swarming, see reference 64) and in its “handling” component (10, 29, 31, 32), in which secreted enzymes turn prey cells into consumable growth substrates (56, 83). There is evidence that M. xanthus employs chemotaxis-like genes in its attack on prey cells (5) and that predation is stimulated by close contact with prey cells (48).Recent studies have revealed great genetic and phenotypic diversity within natural populations of M. xanthus, on both global (79) and local (down to centimeter) scales (78). Phenotypic diversity includes variation in social compatibility (24, 81), the density and nutrient thresholds triggering development (33, 38), developmental timing (38), motility rates and patterns (80), and secondary metabolite production (40). Although natural populations are spatially structured and both genetic diversity and population differentiation decrease with spatial scale (79), substantial genetic diversity is present even among centimeter-scale isolates (78). No study has yet systematically investigated quantitative natural variation in myxobacterial predation phenotypes across a large number of predator genotypes.Given the previous discovery of large variation in all examined phenotypes, even among genetically extremely similar strains, we anticipated extensive predatory variation as well. Using a phylogenetically broad range of prey, we compared and contrasted the predatory performance of 16 natural M. xanthus isolates, sampled from global to local scales, as well as the commonly studied laboratory reference strain DK1622 and representatives of three additional Myxococcus species: M. flavescens (86), M. macrosporus (42), and M. virescens (63) (Table (Table1).1). In particular, we measured myxobacterial swarm expansion rates on prey lawns spread on buffered agar (31, 50) and on control plates with no nutrients or with prehydrolyzed growth substrate.

TABLE 1.

List of myxobacteria used, with geographical origin
Organism abbreviation used in textSpeciesStrainGeographic originReference(s)
A9Myxococcus xanthusA9Tübingen, Germany78
A23Myxococcus xanthusA23Tübingen, Germany78
A30Myxococcus xanthusA30Tübingen, Germany78
A41Myxococcus xanthusA41Tübingen, Germany78
A46Myxococcus xanthusA46Tübingen, Germany78
A47Myxococcus xanthusA47Tübingen, Germany78
A75Myxococcus xanthusA75Tübingen, Germany78
A85Myxococcus xanthusA85Tübingen, Germany78
TVMyxococcus xanthusTvärminneTvärminne, Finland79
PAKMyxococcus xanthusPaklenicaPaklenica, Croatia79
MADMyxococcus xanthusMadeira 1Madeira, Portugal79
WARMyxococcus xanthusWarwick 1Warwick, UK79
TORMyxococcus xanthusToronto 1Toronto, Ontario, Canada79
SUL2Myxococcus xanthusSulawesi 2Sulawesi, Indonesia79
KALMyxococcus xanthusKalalauKalalau, HI79
DAVMyxococcus xanthusDavis 1ADavis, CA79
GJV1Myxococcus xanthusGJV 1Unknown35, 72
MXFL1Myxococcus flavescensMx fl1Unknown65
MXV2Myxococcus virescensMx v2Unknown65
CCM8Myxococcus macrosporusCc m8Unknown65
Open in a separate window  相似文献   

18.
Evidence for a New Avian Paramyxovirus Serotype 10 Detected in Rockhopper Penguins from the Falkland Islands     
Patti J. Miller  Claudio L. Afonso  Erica Spackman  Melissa A. Scott  Janice C. Pedersen  Dennis A. Senne  Justin D. Brown  Chad M. Fuller  Marcela M. Uhart  William B. Karesh  Ian H. Brown  Dennis J. Alexander  David E. Swayne 《Journal of virology》2010,84(21):11496-11504
The biological, serological, and genomic characterization of a paramyxovirus recently isolated from rockhopper penguins (Eudyptes chrysocome) suggested that this virus represented a new avian paramyxovirus (APMV) group, APMV10. This penguin virus resembled other APMVs by electron microscopy; however, its viral hemagglutination (HA) activity was not inhibited by antisera against any of the nine defined APMV serotypes. In addition, antiserum generated against this penguin virus did not inhibit the HA of representative viruses of the other APMV serotypes. Sequence data produced using random priming methods revealed a genomic structure typical of APMV. Phylogenetic evaluation of coding regions revealed that amino acid sequences of all six proteins were most closely related to APMV2 and APMV8. The calculation of evolutionary distances among proteins and distances at the nucleotide level confirmed that APMV2, APMV8, and the penguin virus all were sufficiently divergent from each other to be considered different serotypes. We propose that this isolate, named APMV10/penguin/Falkland Islands/324/2007, be the prototype virus for APMV10. Because of the known problems associated with serology, such as antiserum cross-reactivity and one-way immunogenicity, in addition to the reliance on the immune response to a single protein, the hemagglutinin-neuraminidase, as the sole base for viral classification, we suggest the need for new classification guidelines that incorporate genome sequence comparisons.Viruses from the Paramyxoviridae family have caused disease in humans and animals for centuries. Over the last 40 years, many paramyxoviruses isolated from animals and people have been newly described (16, 17, 22, 29, 31, 32, 36, 42, 44, 46, 49, 58, 59, 62-64). Viruses from this family are pleomorphic, enveloped, single-stranded, nonsegmented, negative-sense RNA viruses that demonstrate serological cross-reactivity with other paramyxoviruses related to them (30, 46). The subfamily Paramyxovirinae is divided into five genera: Respirovirus, Morbillivirus, Rubulavirus, Henipavirus, and Avulavirus (30). The Avulavirus genus contains nine distinct avian paramyxovirus (APMV) serotypes (Table (Table1),1), and information on the discovery of each has been reported elsewhere (4, 6, 7, 9, 12, 34, 41, 50, 51, 60, 68).

TABLE 1.

Characteristics of prototype viruses APMV1 to APMV9 and the penguin virus
StrainHostDiseaseDistributionFusion cleavagecGI accession no.
APMV1/Newcastle disease virus>250 speciesHigh mortalityWorldwideGRRQKRF45511218
InapparentWorldwideGGRQGRLa11545722
APMV2/Chicken/CA/Yucaipa/1956Turkey, chickens, psittacines, rails, passerinesDecrease in egg production and respiratory diseaseWorldwideDKPASRF169144527
APMV3/Turkey/WI/1968TurkeyMild respiratory disease and moderate egg decreaseWorldwidePRPSGRLa209484147
APMV3/Parakeet/Netherlands/449/1975Psittacines, passerines, flamingosNeurological, enteric, and respiratory diseaseWorldwideARPRGRLa171472314
APMV4/Duck/Hong Kong/D3/1975Duck, geese, chickensNone knownWorldwideVDIQPRF210076708
APMV5/Budgerigar/Japan/Kunitachi/1974Budgerigars, lorikeetsHigh mortality, enteric diseaseJapan, United Kingdom, AustraliaGKRKKRFa290563909
APMV6/Duck/Hong Kong/199/1977Ducks, geese, turkeysMild respiratory disease and increased mortality in turkeysWorldwidePAPEPRLb15081567
APMV7/Dove/TN/4/1975Pigeons, doves, turkeysMild respiratory disease in turkeysUnited States, England, JapanTLPSSRF224979458
APMV8/Goose/DE/1053/1976Ducks, geeseNone knownUnited States, JapanTYPQTRLa226343050
APMV9/Duck/NY/22/1978DucksNone knownWorldwideRIREGRIa217068693
APMV10/Penguin/Falkland Islands/324/2007Rockhopper penguinsNone KnownFalkland IslandsDKPSQRIa300432141
Open in a separate windowaRequires the addition of an exogenous protease.bProtease requirement depends on the isolate examined.cPutative.Six of these serotypes were classified in the latter half of the 1970s, when the most reliable assay available to classify paramyxoviruses was the hemagglutination inhibition (HI) assay (61). However, there are multiple problems associated with the use of serology, including the inability to classify some APMVs by comparing them to the sera of the nine defined APMVs alone (2, 8). In addition, one-way antigenicity and cross-reactivity between different serotypes have been documented for many years (4, 5, 14, 25, 29, 33, 34, 41, 51, 52, 60). The ability of APMVs, like other viruses, to show antigenic drift as it evolves over time (37, 43, 54) and the wide use and availability of precise molecular methods, such as PCR and genome sequencing, demonstrate the need for a more practical classification system.The genetic diversity of APMVs is still largely unexplored, as hundreds of avian species have never been surveyed for the presence of viruses that do not cause significant signs of disease or are not economically important. The emergence of H5N1 highly pathogenic avian influenza (HPAI) virus as the cause of the largest outbreak of a virulent virus in poultry in the past 100 years has spurred the development of surveillance programs to better understand the ecology of avian influenza (AI) viruses in aquatic birds around the globe, and in some instances it has provided opportunities for observing other viruses in wild bird populations (15, 53). In 2007, as part of a seabird health surveillance program in the Falkland Islands (Islas Malvinas), oral and cloacal swabs and serum were collected from rockhopper penguins (Eudyptes chrysocome) and environmental/fecal swab pools were collected from other seabirds.While AI virus has not yet been isolated from penguins in the sub-Antarctic and Antarctic areas, there have been two reports of serum antibodies positive to H7 and H10 from the Adélie species (11, 40). Rare isolations of APMV1, both virulent (45) and of low virulence (8), have been reported from Antarctic penguins. Sera positive for APMV1 and AMPV2 have also been reported (21, 24, 38, 40, 53). Since 1981, paramyxoviruses have been isolated from king penguins (Aptenodytes patagonicus), royal penguins (Eudyptes schlegeli), and Adélie penguins (Pygoscelis adeliae) from Antarctica and little blue penguins (Eudyptula minor) from Australia that cannot be identified as belonging to APMV1 to -9 and have not yet been classified (8, 11, 38-40). The morphology, biological and genomic characteristics, and antigenic relatedness of an APMV recently isolated from multiple penguin colonies on the Falkland Islands are reported here. Evidence that the virus belongs to a new serotype (APMV10) and a demonstration of the advantages of a whole genome system of analysis based on random sequencing followed by comparison of genetic distances are presented. Only after all APMVs are reported and classified will epidemiological information be known as to how the viruses are moving and spreading as the birds travel and interact with other avian species.  相似文献   

19.
Stress-induced flowering     
Kaede C Wada  Kiyotoshi Takeno 《Plant signaling & behavior》2010,5(8):944-947
Many plant species can be induced to flower by responding to stress factors. The short-day plants Pharbitis nil and Perilla frutescens var. crispa flower under long days in response to the stress of poor nutrition or low-intensity light. Grafting experiments using two varieties of P. nil revealed that a transmissible flowering stimulus is involved in stress-induced flowering. The P. nil and P. frutescens plants that were induced to flower by stress reached anthesis, fruited and produced seeds. These seeds germinated, and the progeny of the stressed plants developed normally. Phenylalanine ammonialyase inhibitors inhibited this stress-induced flowering, and the inhibition was overcome by salicylic acid (SA), suggesting that there is an involvement of SA in stress-induced flowering. PnFT2, a P. nil ortholog of the flowering gene FLOWERING LOCUS T (FT) of Arabidopsis thaliana, was expressed when the P. nil plants were induced to flower under poor-nutrition stress conditions, but expression of PnFT1, another ortholog of FT, was not induced, suggesting that PnFT2 is involved in stress-induced flowering.Key words: flowering, stress, phenylalanine ammonia-lyase, salicylic acid, FLOWERING LOCUS T, Pharbitis nil, Perilla frutescensFlowering in many plant species is regulated by environmental factors, such as night-length in photoperiodic flowering and temperature in vernalization. On the other hand, a short-day (SD) plant such as Pharbitis nil (synonym Ipomoea nil) can be induced to flower under long days (LD) when grown under poor-nutrition, low-temperature or high-intensity light conditions.19 The flowering induced by these conditions is accompanied by an increase in phenylalanine ammonia-lyase (PAL) activity.10 Taken together, these facts suggest that the flowering induced by these conditions might be regulated by a common mechanism. Poor nutrition, low temperature and high-intensity light can be regarded as stress factors, and PAL activity increases under these stress conditions.11 Accordingly, we assumed that such LD flowering in P. nil might be induced by stress. Non-photoperiodic flowering has also been sporadically reported in several plant species other than P. nil, and a review of these studies suggested that most of the factors responsible for flowering could be regarded as stress. Some examples of these factors are summarized in 1214

Table 1

Some cases of stress-induced flowering
Stress factorSpeciesFlowering responseReference
high-intensity lightPharbitis nilinduction5
low-intensity lightLemna paucicostatainduction29
Perilla frutescens var. crispainduction14
ultraviolet CArabidopsis thalianainduction23
droughtDouglas-firinduction30
tropical pasture Legumesinduction31
lemoninduction3235
Ipomoea batataspromotion36
poor nutritionPharbitis nilinduction3, 4, 13
Macroptilium atropurpureumpromotion37
Cyclamen persicumpromotion38
Ipomoea batataspromotion36
Arabidopsis thalianainduction39
poor nitrogenLemna paucicostatainduction40
poor oxygenPharbitis nilinduction41
low temperaturePharbitis nilinduction9, 12
high conc. GA4/7Douglas-firpromotion42
girdlingDouglas-firinduction43
root pruningCitrus sp.induction44
Pharbitis nilinduction45
mechanical stimulationAnanas comosusinduction46
suppression of root elongationPharbitis nilinduction7
Open in a separate window  相似文献   

20.
Functional Characterization of Naturally Occurring Variants of Human Hepatitis B Virus Containing the Core Internal Deletion Mutation     
Thomas Ta-Tung Yuan  Min-Hui Lin  Sui Min Qiu  Chiaho Shih 《Journal of virology》1998,72(3):2168-2176
  相似文献   

设为首页 | 免责声明 | 关于勤云 | 加入收藏

Copyright©北京勤云科技发展有限公司  京ICP备09084417号