Targeting human telomeric DNA quadruplex with novel berberrubine derivatives: insights from spectroscopic and docking studies

Study on bioactive molecules, capable of stabilizing G-Quadruplex structures is considered to be a potential strategy for anticancer drug development. Berberrubine (BER) and two of its analogs bearing alkyl phenyl and biphenyl substitutions at 13-position were studied for targeting human telomeric G-quadruplex DNA sequence. The structures of berberrubine and analogs were optimized by density functional theory (DFT) calculations. Time-dependent DFT (B3LYP) calculations were used to establish and understand the nature of the electronic transitions observed in UV–vis spectra of the alkaloid. The interaction of berberrubine and its analogs with human telomeric G-quadruplex DNA sequence 5′-(GGGTTAGGGTTAGGGTTAGGG)-3′ was investigated by biophysical techniques and molecular docking study. Both the analogs were found to exhibit higher binding affinity than natural precursor berberrrubine. 13-phenylpropyl analog (BER1) showed highest affinity [(1.45 ± 0.03) × 10⁵ M^?1], while the affinity of the 13-diphenyl analog (BER2) was lower at (1.03 ± 0.05) × 10⁵ M^?1, and that of BER was (0.98 ± 0.03) × 10⁵ M^?1. Comparative fluorescence quenching studies gave evidence for a stronger stacking interaction of the analog compared to berberrubine. The thiazole orange displacement assay has clearly established that the analogs were more effective in displacing the end stacked dye in comparison to berberrubine. Molecular docking study showed that each alkaloid ligand binds primarily at the G rich regions of hTelo G4 DNA which makes them G specific binder towards hTelo G4 DNA. Isothermal titration calorimetry studies of quadruplex–berberrubine analog interaction revealed an exothermic binding that was favored by both enthalpy and entropy changes in BER in contrast to the analogs where the binding was majorly enthalpy dominated. A 1:1 binding stoichiometry was revealed in all the systems. This study establishes the potentiality of berberrubine analogs as a promising natural product based compounds as G-quadruplex-specific ligands.     

Enhanced DNA binding of 9-ω-amino alkyl ether analogs from the plant alkaloid berberine

To understand the structure-activity relationship of isoquinoline alkaloids, absorption, fluorescence, circular dichroism, and thermodynamics were employed to study the interaction of five C-9-ω-amino alkyl ether analogs from the plant alkaloid berberine with double-stranded calf thymus DNA. The C-9 derivatization resulted in dramatic enhancements in the fluorescence emission of these compounds. The most remarkable changes in the spectral and binding properties were in the BC4 and BC5 derivatives. Interactions of these analogs, which have an additional recognition motif with DNA, were evaluated through different spectroscopic and calorimetric titration experiments. The analogs remarkably enhanced the DNA binding affinity and the same was directly dependent on the alkyl chain length. The analog with six alkyl chains enhanced the DNA binding affinity by about 33 times compared with berberine. The binding became more entropically driven with increasing chain length. These results may be of potential use in the design of berberine derivatives and understanding of the structure-activity relationship for improved therapeutic applications.     

Targeting human telomeric G‐quadruplex DNA with antitumour natural alkaloid aristololactam‐β‐D‐glucoside and its comparison with daunomycin

Study on anticancer agents that act via stabilization of telomeric G‐quadruplex DNA has emerged as novel and exciting field for anticancer drug discovery. The interaction of carbohydrate containing anticancer alkaloid aristololactam‐β‐D‐glucoside (ADG) with human telomeric G‐quadruplex DNA sequence was characterized by different biophysical techniques. The binding parameters were compared with daunomycin (DAN), a well‐known chemotherapeutic drug. The Scatchard binding isotherms revealed noncooperative binding for both with the binding affinity values of (1.01 ± 0.05) × 10⁶ and (1.78 ± 0.18) × 10⁶ M⁻¹ for ADG and DAN, respectively. Circular dichroism, ferrocyanide quenching study, anisotropy study, thiazole orange displacement, optical melting, differential scanning calorimetry study, and molecular docking study suggest significant stacking and stabilizing efficiency of ADG with comparison to DAN. The energetics of the interaction for ADG and DAN revealed that both reactions were predominantly entropy driven. Negative heat capacity values were obtained from the temperature dependence of the enthalpy change. The standard molar Gibbs energy change exhibited only marginal alterations with temperature suggesting the occurrence of enthalpy‐entropy compensation. These findings indicate that ADG can act as a stabilizer of telomeric G‐quadruplex DNA and thereby can be considered as a potential telomerase inhibitor.     

Binding of the 9-O-N-aryl/arylalkyl Amino Carbonyl Methyl Substituted Berberine Analogs to tRNAphe

Background

Three new analogs of berberine with aryl/arylalkyl amino carbonyl methyl substituent at the 9-position of the isoquinoline chromophore along with berberrubine were studied for their binding to tRNA^phe by wide variety of biophysical techniques like spectrophotometry, spectrofluorimetry, circular dichroism, thermal melting, viscosity and isothermal titration calorimetry.

Methodology/Principal Findings

Scatchard binding isotherms revealed that the cooperative binding mode of berberine was propagated in the analogs also. Thermal melting studies showed that all the 9-O-N-aryl/arylalkyl amino carbonyl methyl substituted berberine analogs stabilized the tRNA^phe more in comparison to berberine. Circular dichroism studies showed that these analogs perturbed the structure of tRNA^phe more in comparison to berberine. Ferrocyanide quenching studies and viscosity results proved the intercalative binding mode of these analogs into the helical organization of tRNA^phe. The binding was entropy driven for the analogs in sharp contrast to the enthalpy driven binding of berberine. The introduction of the aryl/arylalkyl amino carbonyl methyl substituent at the 9-position thus switched the enthalpy driven binding of berberine to entropy dominated binding. Salt and temperature dependent calorimetric studies established the involvement of multiple weak noncovalent interactions in the binding process.

Conclusions/Significance

The results showed that 9-O-N-aryl/arylalkyl amino carbonyl methyl substituted berberine analogs exhibited almost ten folds higher binding affinity to tRNA^phe compared to berberine whereas the binding of berberrubine was dramatically reduced by about twenty fold in comparison to berberine. The spacer length of the substitution at the 9-position of the isoquinoline chromophore appears to be critical in modulating the binding affinities towards tRNA^phe.     

Structure‐kinetic relationship analysis of the therapeutic complement inhibitor compstatin

Compstatin is a 13‐residue peptide that inhibits activation of the complement system by binding to the central component C3 and its fragments C3b and C3c. A combination of theoretical and experimental approaches has previously allowed us to develop analogs of the original compstatin peptide with up to 264‐fold higher activity; one of these analogs is now in clinical trials for the treatment of age‐related macular degeneration (AMD). Here we used functional assays, surface plasmon resonance (SPR), and isothermal titration calorimetry (ITC) to assess the effect of modifications at three key residues (Trp‐4, Asp‐6, Ala‐9) on the affinity and activity of compstatin and its analogs, and we correlated our findings to the recently reported co‐crystal structure of compstatin and C3c. The K_D values for the panel of tested analogs ranged from 10^?6 to 10^?8 M. These differences in binding affinity could be attributed mainly to differences in dissociation rather than association rates, with a >4‐fold range in k_on values (2–10 × 10⁵ M^?1 s^?1) and a k_off variation of >35‐fold (1–37 × 10^?2 s^?1) being observed. The stability of the C3b‐compstatin complex seemed to be highly dependent on hydrophobic effects at position 4, and even small changes at position 6 resulted in a loss of complex formation. Induction of a β‐turn shift by an A9P modification resulted in a more favorable entropy but a loss of binding specificity and stability. The results obtained by the three methods utilized here were highly correlated with regard to the activity/affinity of the analogs. Thus, our analyses have identified essential structural features of compstatin and provided important information to support the development of analogs with improved efficacy. Copyright © 2009 John Wiley & Sons, Ltd.     

Biophysical probing of the binding properties of a Cu(II) complex with G‐quadruplex DNA: an experimental and computational study

Telomerase inhibition through G‐quadruplex stabilization by small molecules is of great interest as a novel anticancer therapeutic strategy. Here, we show that newly synthesized Cu‐complex binds to G‐quadruplex DNA and induces changes in its stability. This biophysical interaction was investigated in vitro using spectroscopic, voltammetric and computational techniques. The binding constant for this complex to G‐quadruplex using spectroscopic and electrochemical methods is in the order of 10⁵. The binding stoichiometry was investigated using spectroscopic techniques and corresponded to a ratio of 1: 1. Fluorescence titration results reveal that Cu‐complex is quenched in the presence of G‐quadruplex DNA. Analysis of the fluorescence emission at different temperatures shows that ΔH° > 0, ΔS° > 0 and ΔG° < 0, and indicates that hydrophobic interactions played a major role in the binding processes. MD simulation results suggested that this ligand could stabilize the G‐quadruplex structure. An optimized docked model of the G‐quadruplex–ligand mixture confirmed the experimental results. Based on the results, we conclude that Cu‐complex as an anticancer candidate can bind and stabilize the G‐quadruplex DNA structure. Copyright © 2015 John Wiley & Sons, Ltd.     

Binding of novel 9-O–N-aryl/arylalkyl amino carbonyl methyl berberine analogs to poly(U)-poly(A)·poly(U) triplex and comparison to the duplex poly(A)-poly(U)

Interaction of the 9-O–N-aryl/arylalkyl amino carbonyl methyl substituted analogs of the anticancer isoquinoline alkaloid berberine with RNA triplex, poly(U)-poly(A)·poly(U) has been studied in comparison to the duplex poly(A)-poly(U), using multiple biophysical techniques. Spectrophotometric and spectrofluorimetric studies established the non-cooperative binding mode of all the analogs with both the duplex and the triplex. However, berberine exhibited cooperative binding with poly(A)-poly(U) and non-cooperative binding with poly(U)-poly(A)·poly(U). Analog BER1 showed the highest affinity to both the duplex and the triplex followed by BER2 and BER3. The overall binding affinity varied as BER1 > BER2 > BER3 > BER. The magnitude of the quantum efficiency values (Q > 1) revealed that energy was transferred from the bases of the triplex and the duplex to the analogs. Comparative ferrocyanide quenching and viscosity studies unambiguously established a stronger intercalative geometry of the analogs to both the triplex and the duplex in comparison to berberine. Circular dichroism studies revealed that the alkaloids perturbed the conformation of both RNA helices. The binding of all the alkaloids was found to be exothermic from isothermal titration studies. Binding of the analogs was highly entropy driven while that of berberine was enthalpy dominated. The results presented here reveal strong and specific binding of these new berberine analogs to the RNA triplex and duplex and highlight the remarkable influence of the 9-substitution on the interaction profile.     

Interaction of 9-O-(ω-amino) alkyl ether berberine analogs with poly(dT)·poly(dA)*poly(dT) triplex and poly(dA)·poly(dT) duplex: a comparative study

Isoquinoline alkaloids and their analogs represent an important class of molecules for their broad range of clinical and pharmacological utility. These compounds are of current interest owing to their low toxicity and excellent chemo preventive properties. These alkaloids can play important role in stabilising the nucleic acid triple helices. The present study has focused on the interaction of five 9-O-(ω-amino) alkyl ether berberine analogs with the DNA triplex poly(dT)·poly(dA)*poly(dT) and the parent duplex poly(dA)·poly(dT) studied using various biophysical techniques. Scatchard analysis of the spectral data indicated that the analogs bind both to the duplex and triplex in a non-cooperative manner in contrast to the cooperative binding of berberine to the DNA triplex. Strong intercalative binding to the DNA triplex structure was revealed from ferrocyanide quenching, fluorescence polarization and viscosity results. Thermal melting studies demonstrated higher stabilization of the Hoogsteen base paired third strand of the DNA triplex compared to the Watson–Crick strand. Circular dichroism studies suggested a stronger perturbation of the DNA triplex conformation by the alkaloid analogs compared to the duplex. The binding was entropy-driven in each case and the entropy contribution to free energy increased as the length of the alkyl side chain increased. The analogs exhibited stronger binding affinity to the triple helical structure compared to the parent double helical structure.     

Diverse modes of 5′‐[4‐(aminoiminomethyl)phenyl]‐[2,2′‐bifuran]‐5‐carboximidamide (DB832) interaction with multi‐stranded DNA structures

The modes of binding of 5′‐[4‐(aminoiminomethyl)phenyl]‐[2,2′‐Bifuran]‐5‐carboximidamide (DB832) to multi‐stranded DNAs: human telomere quadruplex, monomolecular R‐triplex, pyr/pur/pyr triplex consisting of 12 T*(T·A) triplets, and DNA double helical hairpin were studied. The optical adsorption of the ligand was used for monitoring the binding and for determination of the association constants and the numbers of binding sites. CD spectra of DB832 complexes with the oligonucleotides and the data on the energy transfer from DNA bases to the bound DB832 assisted in elucidating the binding modes. The affinity of DB832 to the studied multi‐stranded DNAs was found to be greater (K_ass ≈ 10⁷M^?1) than to the duplex DNA (K_ass ≈ 2 × 10⁵M^?1). A considerable stabilizing effect of DB832 binding on R‐triplex conformation was detected. The nature of the ligand tight binding differed for the studied multi‐stranded DNA depending on their specific conformational features: recombination‐type R‐triplex demonstrated the highest affinity for DB832 groove binding, while pyr/pur/pyr TTA triplex favored DB832 intercalation at the end stacking contacts and the human telomere quadruplex d[AG₃(T₂AG₃)₃] accommodated the ligand in a capping mode. Additionally, the pyr/pur/pyr TTA triplex and d[AG₃(T₂AG₃)₃] quadruplex bound DB832 into their grooves, though with a markedly lesser affinity. DB832 may be useful for discrimination of the multi‐sranded DNA conformations and for R‐triplex stabilization. © 2009 Wiley Periodicals, Inc. Biopolymers 93: 8–20, 2010. This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com     

ILPR repeats adopt diverse G‐quadruplex conformations that determine insulin binding

The insulin‐linked polymorphic region (ILPR) is a VNTR region located upstream of the insulin (INS) gene consisting of the repeat 5′‐ACAGGGGTGTGGGG (repeat a) and several less abundant sequence repeats (b–n). Here, we have investigated the structural polymorphism of G‐quadruplexes formed from the most common repeat sequences (a–c) and their effect on insulin protein binding. We first established that the ILPR repeats “b” and “c” can form quadruplex structures. Insulin has previously been shown to bind a G‐quadruplex formed by a dimer of the repeat “a”. Our findings show that insulin binds preferentially to the repeat “a” G‐quadruplex (K_d = 0.17 ± 0.03 μM) over G‐quadruplexes formed from other ILPR repeats that were tested (K_ds from 0.71 ± 0.15 to 1.07 ± 0.09 μM). Additionally, the Watson‐Crick complementary relationship between the loop regions of repeat “a” (ACA and TGT) seemingly play an important role in favoring a specific G‐quadruplex conformation, which based on our data is critical for insulin binding. Affinity for insulin is reduced in sequences lacking the putative WC complementarity, however upon engineered restoration of complementarity, insulin binding is recovered. A DMS footprinting assay on the repeat “a” G‐quadruplex in the presence of insulin, combined with binding affinities for ILPR mutants led to identification of a loop nucleotide critical for binding. Uniquely, insulin shows clear preference for binding to the G‐quadruplexes with the more antiparallel feature. Collectively, our results illustrate the specific nature of insulin binding to the ILPR G‐quadruplexes and begin to provide molecular details on such interactions. © 2009 Wiley Periodicals, Inc. Biopolymers 93: 21–31, 2010. This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com     

Interaction of Isoquinoline Alkaloids with Polymorphic DNA Structures

The interaction of berberine, palmatine, and coralyne with the B, Z, and H^L form of poly[d(G‐C)] was studied. Berberine and palmatine showed moderate binding to the B form, while coralyne showed higher binding, as revealed from spectroscopic and thermodynamic data. Berberine and coralyne binding to the B form was exothermic and enthalpy‐driven, while palmatine showed exothermic binding which was favored by both negative enthalpy and negative entropy changes. Berberine and palmatine neither bind nor converted the Z‐form structure to B form. Coralyne, on the other hand, exhibited a strong binding affinity to Z DNA structure that was enthalpy‐driven. Berberine binding to the H^L form was cooperative, exothermic, and favored by both negative enthalpy and negative entropy changes with the formation of an induced CD band. Palmatine showed weak binding, while coralyne showed a strong binding with the H^L form. The structural differences in the isoquinoline alkaloids appear to influence the affinity and mode of interactions with these polymorphic DNA structures.     

Relative stability of G‐quadruplex structures: Interactions between the human Bcl2 promoter region and derivatives of carbazole and diphenylamine

The bcl2 promoter region forms a G‐quadruplex structure, which is a crucial target for anticancer drug development. In this study, we provide theoretical predictions of the stability of different G‐quadruplex folds of the 23‐mer bcl2 promoter region and G‐quadruplex ligand. We take into account the whole G‐quadruplex structure, including bound‐cations and solvent effects, in order to compute the ligand binding free energy using molecular dynamics simulation. Two series of the carbazole and diphenylamine derivatives are used to screen for the most potent drug in terms of stabilization. The energy analysis identifies the predominant energy components affecting the stability of the various different G‐quadruplex folds. The energy associated with the stability of the G‐quadruplex‐K⁺ structures obtained displays good correlation with experimental T_m measurements. We found that loop orientation has an intrinsic influence on G‐quadruplex stability and that the basket structure is the most stable. Furthermore, parallel loops are the most effective drug binding site. Our studies also demonstrate that rigidity and planarity are the key structural elements of a drug that stabilizes the G‐quadruplex structure. BMVC‐4 is the most potential G‐quadruplex ligand. This approach demonstrates significant promise and should benefit drug design. © 2014 Wiley Periodicals, Inc. Biopolymers 101: 1038–1050, 2014.     

Stability of human telomere quadruplexes at high DNA concentrations

For mimicking macromolecular crowding of DNA quadruplexes, various crowding agents have been used, typically PEG, with quadruplexes of micromolar strand concentrations. Thermal and thermodynamic stabilities of these quadruplexes increased with the concentration of the agents, the rise depended on the crowder used. A different phenomenon was observed, and is presented in this article, when the crowder was the quadruplex itself. With DNA strand concentrations ranging from 3 µM to 9 mM, the thermostability did not change up to ～2 mM, above which it increased, indicating that the unfolding quadruplex units were not monomolecular above ～2 mM. The results are explained by self‐association of the G‐quadruplexes above this concentration. The ΔG^o₃₇ values, evaluated only below 2 mM, did not become more negative, as with the non‐DNA crowders, instead, slightly increased. Folding topology changed from antiparallel to hybrid above 2 mM, and then to parallel quadruplexes at high, 6–9 mM strand concentrations. In this range, the concentration of the DNA phosphate anions approached the concentration of the K⁺ counterions used. Volume exclusion is assumed to promote the topological changes of quadruplexes toward the parallel, and the decreased screening of anions could affect their stability. © 2013 Wiley Periodicals, Inc. Biopolymers 101: 428–438, 2014.     

Evidence for a new subclass of calcitonin/ calcitonin gene-related peptide binding site in rat brain

Binding sites for calcitonin and calcitonin gene-related peptide are widely distributed in the central nervous system. In this study, binding of [¹²⁵I]-alpha-rat calcitonin gene-related peptide and [¹²⁵I]-salmon calcitonin in adjacent sections of rat brain revealed clearly distinct patterns of binding in most regions although in some restricted areas such as parts of the ventral striatum, including the nucleus accumbens, there was some overlap in the patterns of binding. In the primary olfactory cortex, which bound only calcitonin gene-related peptide, salmon calcitonin was very weak in inhibiting the binding of calcitonin gene-related peptide. In the nucleus accumbens, high affinity binding of calcitonin and calcitonin gene-related peptide at their homologous receptors was observed, with affinity constants for calcitonin and calcitonin gene-related peptide of 1.4 × 10⁹ M⁻¹ and 1.2 × 10⁹ M⁻¹ respectively. Cross competition studies in this nucleus demonstrated that salmon calcitonin was able to compete for [¹²⁵I]-rat calcitonin gene-related peptide labelled sites with high affinity, with an affinity constant of 0.8 × 10⁹ M⁻¹. However, rat calcitonin gene-related peptide was less potent in inhibiting the binding of [¹²⁵I]-salmon calcitonin labelled sites with only 28% inhibition at 10⁻⁶M. Further characterization of the calcitonin sensitive calcitonin gene-related peptide labelled sites demonstrated that a range of calcitonin analogs inhibited the binding of [¹²⁵I]-rat calcitonin gene-related peptide with the same order of potency as the analogs competed for [¹²⁵I]-salmon calcitonin labelled sites. Digital substraction mapping revealed calcitonin-sensitive calcitonin gene-related peptide binding sites over parts of the ventral striatum, including mid-caudal nucleus accumbens and fundus striati; over the lateral border of the lateral bed nucleus of the stria terminalis; part of the central amygdaloid nucleus; the organum vasculosum of the lamina terminalis and area postrema and over the wings of the dorsal raphe.These results demonstrate the existence of a new subtype of calcitonin/calcitonin gene-related peptide binding site, which has high affinity for the two otherwise biochemically distinct peptides.     

Verification of both the sequence and conformational specificity of neurotensin in binding to mast cells

Neurotensin (NT) analogs, modified at Arg⁸ and Arg⁹, were used to assess the role of Arg in NT binding to mast cells. [D-Arg⁸]- and [D-Arg⁹]-NT bound 4–5 times better than NT, whereas [D-Arg^8,9]-NT had the same binding affinity as NT. Binding of [Ala⁸]-NT was not parallel to NT and exhibited a dissociation constant 38-fold lower than NT while [Ala⁹]-NT had 32% binding. C-terminal peptides, NT_8–13 and NT_9–13, had about 65% binding. These data suggest that Arg⁸ plays a greater role than Arg⁹ in the binding to mast cell NT receptors. Reduction of the disulfide bond in [Cys^2,13]-NT produced an analog 4-times more potent than NT, while the cyclized form had only 3% binding. Thus, a linear peptide with a free C-terminus appears to be required for binding.     

Muscarinic agonist, (±)-quinuclidin-3-yl-(4-fluorophenethyl)(phenyl)carbamate: High affinity,but low subtype selectivity for human M1 – M5 muscarinic acetylcholine receptors

Novel quinuclidinyl N-phenylcarbamate analogs were synthesized, and binding affinities at M₁-M₅ muscarinic acetylcholine receptor (mAChR) subtypes were determined using Chinese hamster ovary (CHO) cell membranes stably expressing one specific subtype of human mAChR. Although not subtype selective, the lead analog (±)-quinuclidin-3-yl-(4-fluorophenethyl)(phenyl)carbamate (3c) exhibited the highest affinity (K_i?=?2.0, 13, 2.6, 2.2, 1.8?nM) at each of the M₁-M₅ mAChRs, respectively. Based on results from the [³H]dopamine release assay using rat striatal slices, 3c acted as an agonist at mAChRs. The effect of 3c was inhibited by the nonselective mAChR antagonist, scopolamine, and 3c augmented release evoked by oxotremorine. A potent analog from the same scaffold, (±)-quinuclidin-3-yl-(4-methoxyphenethyl)(phenyl)-carbamate (3b) exhibited the greatest selectivity (17-fold) at M₃ over M₂ mAChRs. These analogs could serve as leads for further discovery of novel subtype-selective muscarinic ligands with the goal of providing therapeutics for substance use disorders and chronic obstructive pulmonary disease.     

Microflow injection potassium bioassay based on G‐quadruplex DNAzyme‐enhanced chemiluminescence

By taking advantage of microflow injection chemiluminescence analysis, we developed a distinctive microfluidic bioassay method based on G‐Quadruplex DNAzyme‐enhanced chemiluminescence for the determination of K⁺ in human serum. AGRO100, the G‐rich oligonucleotide with high hemin binding affinity was primarily selected as a K⁺ recognition element. In the presence of K⁺, AGRO100 folded into G‐quadruplex and bound hemin to form DNAzyme, which catalyzed the oxidation of luminol by H₂O₂ to produce chemiluminescence. The intensity of chemiluminescence increased with the K⁺ concentration. In the study, the DNAzyme showed both long‐term stability and high catalytic activity; other common cations at their physiological concentration did not cause notable interference. With only 6.7 × 10^?13 mol of AGRO100 consumption per sample, a linear response of K⁺ ranged from 1 to 300 µmol/L, the concentration detection limit 0.69 µmol/L (S/N = 3) and the absolute detection limit 1.38 × 10^?12 mol were obtained. The precision of 10 replicate measurements of 60 µmol/L K⁺ was found to be 1.72% (relative standard deviation). The accuracy of the method was demonstrated by analyzing real human serum samples. Copyright © 2014 John Wiley & Sons, Ltd.