Variants in the APOC3 promoter insulin responsive element modulate insulin secretion and lipids in middle-aged men

Variation in the insulin responsive element (IRE) of the APOC3 promoter has been shown to be associated with insulin and glucose concentrations after an oral glucose tolerance test (OGTT) in young healthy men. We evaluated two variants in the IRE (-455T>C and -482C>T) in the Ely study, a prospective cohort study of middle-aged men (n=223) and women (n=279), to determine if the effect of these variants on glucose homeostasis could be explained by altered nonesterified fatty acid (NEFA) levels and if these effects are modulated by age and gender. Both variants had significant effects on the 30-min insulin incremental response in men alone (-482C>T, P=0.007; -455T>C, P=0.0155), with rare allele homozygotes having a 33.3% and 23.3% lower insulin increment as compared to common allele homozygotes, respectively. Thirty-minute NEFA concentrations were also significantly associated with genotype in men and levels were approximately 10% higher in carriers homozygous for the rare alleles as compared to subjects homozygous for the common alleles (-482C>T, P=0.04; -455T>C, P=0.006). In addition, there was a strong interaction between both variants and cigarette smoking affecting fasting triglyceride levels in both men (interaction: -455T>C, P=0.02; -482C>T, P=0.008) and women (interaction: -455T>C, P=0.007; -482C>T, P=0.013). Taken together, the data shows that men who carry the rare alleles of the IRE variants have disturbed glucose homeostasis and an unfavourable lipid phenotype. The finding of an elevated 30-min NEFA may be an important mechanistic link between triglyceride-rich lipoprotein (TRL) metabolism and glucose homeostasis.     

Identification of a Vitamin D response element in the human insulin receptor gene promoter

The present study was designed to explore the possible presence and location of Vitamin D response elements (VDREs) in the human insulin receptor (hIR) gene promoter. To this end, the -1819 to -271 bp fragment of the hIR promoter (wild type promoter) and progressive 5' deletions of this promoter (up to -1473 and -876 bp) were linked to the luciferase pGL2-basic vector to construct the reported plasmids: phIR (-1819)-GL2, phIR(-1473)-GL2 and phIR(-876)-GL2, respectively. U-937 cells were transiently transfected with these plasmids, and then the cells were either untreated or treated for 24h with 10(-8) M 1,25-dihydroxyvitamin D(3) (1,25D(3)). Luciferase determinations revealed that, while the activity of the wild promoter was increased 1.6-fold by the hormone, the activities of progressive 5' deletions of this promoter were enhanced 1.7-, and 1.6-fold, respectively. Thus, the region extending from -876 to -271bp of the hIR promoter, appears to contain VDREs, and to be sufficient for induction by 1,25D(3). In order to identify these potential VDREs, we performed a computer search of candidate sequences by homology with a consensus VDRE sequence. This search yielded a sequence located between -761 and -732 bp (5'CGTCGGGCCTGTGGGGCGCCTCCGGGGGTC3'), which includes an overlapping AP-2 like sequence, as a good candidate. Electrophoretic mobility shift assays revealed that the Vitamin D receptor (VDR) specifically recognized this sequence, since a VDR-DNA complex was able to compete with the unlabeled probe and was cleared by the specific anti-VDR antibody 9A7. These data represent the first identification of a VDRE in the hIR gene promoter.     

The gene encoding the glutamate dehydrogenase in Lactococcus lactis is part of a remnant Tn3 transposon carried by a large plasmid

The gene responsible for the uncommon glutamate dehydrogenase (GDH) activity of Lactococcus lactis was identified and characterized. It encodes a GDH of family I that is mainly active in glutamate biosynthesis, is carried by a large plasmid, and is included, with functional cadmium resistance genes, in a remnant Tn3-like transposon.     

Genetic determinants of a nickel-specific transport system are part of the plasmid-encoded hydrogenase gene cluster in Alcaligenes eutrophus.

Nickel-deficient (Nic-) mutants of Alcaligenes eutrophus requiring high levels of nickel ions for autotrophic growth with hydrogen were characterized. The Nic- mutants carried defined deletions in the hydrogenase gene cluster of the indigenous pHG megaplasmid. Nickel deficiency correlated with a low level of the nickel-containing hydrogenase activity, a slow rate of nickel transport, and reduced activity of urease. The Nic+ phenotype was restored by a cloned DNA sequence (hoxN) of a megaplasmid pHG1 DNA library of A. eutrophus H16. hoxN is part of the hydrogenase gene cluster. The nickel requirement of Nic- mutants was enhanced by increasing the concentration of magnesium. This suggests that the Nic- mutants are impaired in the nickel-specific transport system and thus depend on the second transport activity which normally mediates the uptake of magnesium.     

Cell‐specific responses to the cytokine TGFβ are determined by variability in protein levels

The cytokine TGFβ provides important information during embryonic development, adult tissue homeostasis, and regeneration. Alterations in the cellular response to TGFβ are involved in severe human diseases. To understand how cells encode the extracellular input and transmit its information to elicit appropriate responses, we acquired quantitative time‐resolved measurements of pathway activation at the single‐cell level. We established dynamic time warping to quantitatively compare signaling dynamics of thousands of individual cells and described heterogeneous single‐cell responses by mathematical modeling. Our combined experimental and theoretical study revealed that the response to a given dose of TGFβ is determined cell specifically by the levels of defined signaling proteins. This heterogeneity in signaling protein expression leads to decomposition of cells into classes with qualitatively distinct signaling dynamics and phenotypic outcome. Negative feedback regulators promote heterogeneous signaling, as a SMAD7 knock‐out specifically affected the signal duration in a subpopulation of cells. Taken together, we propose a quantitative framework that allows predicting and testing sources of cellular signaling heterogeneity.     

Phyllotactic pattern and stem cell fate are determined by the Arabidopsis homeobox gene BELLRINGER

Lateral organs in plants arise from the meristem in a stereotypical pattern known as phyllotaxy. Spiral patterns result from initiation of successive organs at a fixed angle of divergence but variable patterns of physical contact. Such patterns ultimately give rise to individual leaves and flowers at positions related to each other by consecutive terms in the mathematical series first described by Leonardo Fibonacci. We demonstrate that a BELL1 related homeodomain protein in Arabidopsis, BELLRINGER, maintains the spiral phyllotactic pattern. In the absence of BELLRINGER, the regular pattern of organ initiation is disturbed and lateral organs are initiated more frequently. BELLRINGER is also required for maintenance of stem cell fate in the absence of the regulatory genes SHOOT MERISTEMLESS and ASYMMETRIC LEAVES1. We propose a model whereby BELLRINGER coordinates the maintenance of stem cells with differentiation of daughter cells in stem cell lineages.     

Plasma PTX3 protein levels inversely correlate with insulin secretion and obesity, whereas visceral adipose tissue PTX3 gene expression is increased in obesity

Plasma acutephase protein pentraxin 3 (PTX3) concentration is dysregulated in human obesity and metabolic syndrome. Here, we explore its relationship with insulin secretion and sensitivity, obesity markers, and adipose tissue PTX3 gene expression. Plasma PTX3 protein levels were analyzed in a cohort composed of 27 lean [body mass index (BMI) ≤ 25 kg/m(2)] and 48 overweight (BMI 25-30 kg/m(2)) men (cohort 1). In this cohort, plasma PTX3 was negatively correlated with fasting triglyceride levels and insulin secretion after intravenous and oral glucose administration. Plasma PTX3 protein and PTX3 gene expression in visceral (VAT) and subcutaneous (SAT) whole adipose tissue and adipocyte and stromovascular fractions were analyzed in cohort 2, which was composed of 19 lean, 28 overweight, and 15 obese subjects (BMI >30 kg/m(2)). An inverse association with body weight and waist/hip ratio was observed in cohort 2. In VAT depots, PTX3 mRNA levels were higher in subjects with BMI >25 kg/m(2) than in lean subjects, positively correlated with IL-1β mRNA levels, and higher in the adipocyte than stromovascular fraction. Human preadipocyte SGBS cell line was used to study PTX3 production in response to factors that obesity entails. In SGBS adipocytes, PTX3 gene expression was enhanced by IL-1β and TNFα but not IL-6 or insulin. In conclusion, the negative correlation between PTX3 and glucose-stimulated insulin secretion suggests a role for PTX3 in metabolic control. PTX3 gene expression is upregulated in VAT depots in obesity, despite lower plasma PTX3 protein, and by some proinflammatory cytokines in cultured adipocytes.     

Hypertriglyceridemia and the apolipoprotein CIII gene locus: lack of association with the variant insulin response element in Italian school children

Hypertriglyceridemia is a common metabolic disorder with a major inherited component. In some individuals the condition is suspected to occur as a result of overproduction of apolipoprotein (apo)CIII, a major constituent of triglyceride-rich lipoproteins. Population studies have established an association with the apoCIII gene but the identity of the causal mutation remains unknown. In the present study we have examined a series of six 5′ polymorphic nucleotides (G^–935 to A, C^–641 to A, G^–630 to A, deletion of T^–625, C^–482 to T, and T^–455 to C) that lie within the promoter region of the apoCIII gene for evidence of possible involvement in disease susceptibility. The polymorphic nucleotides at positions –455 and –482 reside within a negative insulin-response element. We show, in a community-based sample of 503 school children, that a DNA polymorphism (S2 allele) within the 3′-noncoding region of the apoCIII gene was associated with elevated apoCIII and triglyceride levels, but that the polymorphic nucleotides of the promoter were not. In addition, no obvious effect of any extended apoCIII promoter haplotype on plasma apoCIII or triglyceride levels, over and above that conferred by the presence of the S2 polymorphic nucleotide, was detected. These results demonstrate that none of the 5′ apoCIII polymorphisms can account for the association of the apoCIII gene locus with hypertriglyceridemia and, moreover, owing to linkage disequilibrium, raise the possibility that the region conferring susceptibility maps downstream, rather than upstream, of the apoCIII gene promoter sequences. Received: 8 January 1996 / Revised: 30 May 1996     

Plasma selenium levels in healthy blood bank donors in the central-eastern part of Belgium

Graphite furnace atomic absorption spectrometry, with Zeeman background correction and after improved matrix modification, was used to measure the plasma selenium content of healthy blood bank donors in the central part of Belgium.

The mean plasma selenium concentration of 80 men and 80 women was 79.7±4.4 ng/mL with a range of 55.0–117.4 ng/mL.

There was no gender difference observed. Plasma selenium level was significantly highest for the adult group, aged 45–64 years, compared to the others, except the young adults (18–24 years).

The mean plasma selenium concentration measured corresponded well with literature data for Belgium. The obtained values were found to be in the medium range, compared with recent literature values for the European countries.     

Phycoerythrins of the oxyphotobacterium Prochlorococcus marinus are associated to the thylakoid membrane and are encoded by a single large gene cluster

An intrinsic divinyl-chlorophyll a/b antenna and a particular form of phycobiliprotein, phycoerythrin (PE) III, coexist in the marine oxyphotobacterium Prochlorococcus marinus CCMP 1375. The genomic region including the cpeB/A operon of P. marinus was analysed. It encompasses 10153 nucleotides that encode three structural phycobiliproteins and at least three (possibly five) different polypeptides analogous to cyanobacterial or red algal proteins involved either in the linkage of subunits or the synthesis and attachment of chromophoric groups. This gene cluster is part of the chromosome and is located within a distance of less than 110 kb from a previously characterized region containing the genes aspA-psbA-aroC. Whereas the Prochlorococcus phycobiliproteins are characterized by distinct deletions and amino acid replacements with regard to analogous proteins from other organisms, the gene arrangement resembles the organization of phycobiliprotein genes in some other cyanobacteria, in particular marine Synechococcus strains. The expression of two of the Prochlorococcus polypeptides as recombinant proteins in Escherichia coli allowed the production of individual homologous antisera to the Prochlorococcus and PE subunits. Experiments using these sera show that the Prochlorococcus PEs are specifically associated to the thylakoid membrane and that the protein level does not significantly vary as a function of light irradiance or growth phase.     

Ligand-dependent and -independent transactivation by thyroid hormone receptor beta 2 is determined by the structure of the hormone response element.

Chicken thyroid hormone receptor beta 2 (cTR beta 2) is likely to serve specific functions in gene regulation since it possesses a unique N-terminal domain and is expressed in very few tissues. We demonstrate here that TR beta 2 exhibits distinct transactivation properties which are dependent on the availability of ligand and on the structure of the hormone response element. First, a strong ligand-independent transactivation was observed with hormone response elements composed of direct repeats and everted repeats. Second, TR beta 2 was induced by triiodothyronine to transactivate more efficiently than TR beta 0 on palindromic and everted-repeat types of hormone response elements. However, coexpression of the retinoid X receptor reduced the strong transactivation by TR beta 2 but not by TR beta 0 via palindromic response elements, suggesting that TR beta 2 can transactivate as a homodimer. Finally, the N terminus of TR beta 2 contains two distinct transactivation regions rich in tyrosines, which are essential for transactivation. Our results thus show that the activity of the novel transactivating region of TR beta 2 is dependent on the organization of the half-sites in the response element.