Highly effective non-explosive activators based on saccharin for the synthesis of oligonucleotides and phosphoramidites

A new class of non-explosive activators has been developed based on heterocyclic tertiary amine salts of saccharin. These salts have been found to be highly effective in the synthesis of oligonucleotides and nucleoside phosphoramidites.     

Influence of diastereomeric ratios of deoxyribonucleoside phosphoramidites on the synthesis of phosphorothioate oligonucleotides

Extensive investigations on the influence of diastereomeric ratios of deoxyribonucleoside phosphoramidites on stereo-reproducibility of solid phase synthesis of phosphorothioate oligodeoxyribonucleotides via the phosphoramidite approach indicate that the process is stereoreproducible and under inherent process control.     

The synthesis of diene-containing nucleoside phosphoramidites and their use in the labeling of oligonucleotides

A variety of furan-modified nucleoside phosphoramidite monomers has been prepared and efficiently incorporated into oligonucleotides. These take part in Diels-Alder reactions with fluorescent maleimides to give fluorescent-labeled oligonucleotides. This represents a strategy for oligonucleotide labeling that is orthogonal to amine-based methods.     

1,2-Diol and hydrazide phosphoramidites for solid-phase synthesis and chemoselective ligation of 2'-modified oligonucleotides

The preparation of two novel 2'-O-alkyl phosphoramidites bearing 1,2-diol and hydrazide functions for a chemoselective ligation is described. The former amidite was used to obtain 2'-modified oligodeoxyribonucleotides, which can be later oxidised by NaIO4 to generate 2'-aldehyde oligonucleotides. These were successfully conjugated to acceptor molecules. The latter amidite also showed good coupling yields, but the hydrazide function was demonstrated to be labile under basic deprotection conditions.     

Chemico-enzymatic method of synthesis of mixed oligonucleotides

Oligo (ribodeoxyribo)nucleotide d(TGTGTAT)r(GCCAU) was synthesized from oligonucleotide blocks by chemical ligation, the oligoribonucleotide and oligodeoxynucleotide blocks being prepared by enzymatic and chemical synthesis, resp. A general procedure of the hybride duplex strand separation is described.     

Phosphoramidite reagents and solid-phase supports based on hydroxyprolinol for the synthesis of modified oligonucleotides

The synthesis of phosphoramidite reagents and solid-phase supports based on hydroxyprolinol for the introduction of the residues of biotin, lipoic acid, amino groups, and terminal acetylene groups at different positions of the oligonucleotide chain has been described. The efficiency of the reagents and supports has been confirmed by the synthesis of the corresponding modified oligonucleotides.     

Modification of guanine bases by nucleoside phosphoramidite reagents during the solid phase synthesis of oligonucleotides.

Nucleoside 3'-phosphoramidite and chlorophosphite reagents have been found to react with the lactam function of guanine. This reaction caused unsatisfactory results when oligodeoxyribonucleotides containing a large number of guanine bases were prepared in an automated solid phase synthesizer. The guanine modification is unstable, and leads to depurination and chain cleavage. This side reaction can be eliminated by protecting the O6-position. A new O6-p-nitrophenylethyldeoxyguanosine phosphoramidite derivative, 8, was used to prepare sequences containing up to 24 guanine bases with greatly improved results. A hexatriacontanucleotide, d(CGCGGGGTGGAGCAGCCTGGTAGCTCGTCGGGCTCA), was also prepared using O6-protected deoxyguanosine nucleosides.     

New phosphoramidite reagents for the synthesis of oligonucleotides containing a cysteine residue useful in peptide conjugation

The preparation is described of four 2-cyanoethyl-N,N-diisopropyl phosphoramidites of N-alpha-Fmoc-S-protected cysteine hydroxyalkyl amides. The phosphoramidites were used in solid-phase synthesis of 5'-cysteinyl oligonucleotides, useful intermediates in the preparation of peptide-oligonucleotide conjugates through reaction with a maleimide peptide or with a peptide thioester via "native ligation".     

An efficient oxidizing reagent for the synthesis of mixed backbone oligonucleotides via the H-phosphonate approach

The mixture of carbon tetrachloride, N-methyl morpholine (NMM), pyridine and water in acetonitrile has been exploited for the oxidation of dinucleoside H-phosphonate diesters to the corresponding phosphates. The system is found to be inert to the phosphoramidate (P-N) and the phosphorothioate (P-S) linkages and has successfully been applied to the solid phase synthesis of mixed-backbone oligonucleotides (MBOs).     

The primer generator: a program that facilitates the selection of oligonucleotides for site-directed mutagenesis.

Site-directed mutagenesis is a powerful tool that has enabled molecular biologists to perform functional analysis of altered nucleic acids and proteins. Newer PCR-based mutagenesis techniques have reduced the process of mutagenesis to as little as one day. While each technique has its advantages, both require a strategy to isolate the desired clone from a population that contains mutagenized and wild-type genes. In this report, we describe a World Wide Web-based computer program that facilitates the design of mutagenic primers such that successfully mutagenized clones can be identified by the presence or absence of a unique restriction site.     

Bifunctional phosphoramidite reagents for the introduction of histidyl and dihistidyl residues into oligonucleotides.

The synthesis and characterization of reagents for the incorporation of histidyl residues into oligonucleotides by automated chemical synthesis is described. Automated oligonucleotide synthesis utilizing a bifunctional reagent for the incorporation of a dihistidyl residue into oligonucleotides is described. Oligonucleotides incorporating one to three dihistidyl residues were prepared and characterized. The interaction of these oligonucleotides with a metal chelating IMAC matrix was explored.     

Targeted random mutagenesis: the use of ambiguously synthesized oligonucleotides to mutagenize sequences immediately 5'' of an ATG initiation codon

The nine base pairs immediately 5' of the initiation codon for the bovine growth hormone (BGH) structural gene have been mutagenized. The mutagenesis method employs the ligation of an ambiguously synthesized oligonucleotide duplex into a previously engineered gap in an expression plasmid for BGH. The mutation method, coupled with hybridization screening, is efficient at isolating 1 and 2 base pair changes within the targeted region. The E. coli cultures harboring the mutant plasmids were assayed for relative levels of BGH expression. The most notable result is the varied effect of substitution of G into the mRNA at various positions in this region.     

Changes in the specificity of antibodies by site-specific mutagenesis followed by random mutagenesis.

The specificity for 11-deoxycortisol (11-DOC) of a monoclonal antibody (mAb), designated SCET, was changed to specificity for cortisol (CS) by site-specific mutagenesis followed by random mutagenesis. The Fab form of SCET was expressed on the surface of a phage. During the first step, mutations were introduced at 14 amino acid positions in three complementarity-determining regions (CDRs) of the VH domain that seemed likely to form the steroid-binding pocket. A clone, DcC16, was isolated from the resultant library with multiple mutations and this clone was shown to have CS-binding activity but also to retain high 11-DOC-binding activity. During the second step, mutations were introduced randomly into the entire VH-coding region of the DcC16 clone by an error-prone polymerase chain reaction, and CS-specific mutant antibodies were selected in the presence of 11-DOC as a competitor. Three representative clones were analyzed with the BIAcore instrument, and each revealed a large increase in the binding constant for CS and a decrease in that for 11-DOC. Structural models, constructed by computer simulation, indicated the probable molecular basis for these changes in specificity.     

Syringe method for stepwise chemical synthesis of oligonucleotides.

A simple procedure is described for synthesis of oligonucleotides by phosphate chemistry. Chains can be constructed rapidly with minimal equipment (a syringe and reagent bottles). The method is illustrated by synthesis of d-TGCAGGTT. Pertinent supporting data on the effect of variations in the detritylation, condensation, oxidation, capping and cleavage steps in the synthetic approach and in isolation procedures are also presented.     

Silica gel: an improved support for the solid-phase phosphotriester synthesis of oligonucleotides.

The phosphotriester method for the stepwise synthesis of deoxyoligonucleotides has been employed using HPLC-grade silica gel (Porasil B) as the solid support. The procedure results in a convenient flow-through system for the synthesis of oligomers where all the reaction steps including the zinc bromide method of detritylation are compatible with the selected support. Deoxyoligonucleotides of 25-30 nucleotides in length can be synthesized in high yields utilising stable phosphotriester intermediates. Ease of handling of the solid support allows convenient synthesis of mixed oligonucleotide sequences.     

Transposon mutagenesis in Desulfovibrio desulfuricans: development of a random mutagenesis tool from Tn7.

The transposons Tn5, Tn7, Tn9, and Tn10 or their derivatives have been examined for transposition in the sulfate-reducing bacterium Desulfovibrio desulfuricans G20. Tn7 inserted with a frequency of 10(-4) to 10(-3) into a unique attachment site that shows strong homology with those sites identified in other gram-negative bacteria. Inactivation of the tnsD gene in Tn7, encoding the function directing insertion into the unique site, yielded a derivative that transposed essentially randomly with a frequency of ca. 10(-6) per donor. Derivatives of Tn5, but not wild-type Tn5, were also found to undergo random transposition at a similar frequency. No evidence was obtained for transposition of Tn9 or Tn10.