Genetic control of lymphocyte antigens in sheep: TheOLA complex and two minor loci

Lymphocytotoxic reagents allowed us to define 11 lymphocyte factors in sheep. After a genetic control of monospecificity had been made, a genetic study based on 400 crossings indicated that nine factors are transmitted in two haplotypes containing 0.1 or 2 factors. The linked factors of the bifactorial haplotypes are the products of two genes at two closely linked loci,OLA- A andOLA- B, having a recombination rate of about 0.6%. The nine factors are the products of fiveOLA- A and fourOLA- B alleles. Allelic frequencies at the two loci, ranging from 0.05 to 0.23 were obtained by two methods. A linkage disequilibrium between the loci is described. Among the possible causes of this, inbreeding is excluded, whereas selective pressure or more probably old fusions between sheep populations must be retained. A tenth factor (frequency 0.33 to 0.35) has a 26% recombination with OLA factors; its locus (OL-X) would be on the same chromosome but very far from theOLA complex. An 11th factor (frequency 0.30) is probably independent ofOLA; its locus (OL-Z) may be on another chromosome. The two linkedOLA loci give evidence of a major histocompatibility complex in sheep; the observed linkage disequilibrium allows one to foretell certain applications in phylogeny and perhaps in selection.     

Sheep major histocompatibility (OLA) complex: linkage between a scrapie susceptibility/resistance locus and the OLA complex in Ile-de-France sheep progenies

As seen on their family trees, Ile-de-France sheep with scrapie show genetic susceptibility to this disease, which is transmitted via scr ^s, an autosomal recessive gene. Scrapie occurred in homozygous recessive sheep, whereas the presence of the dominant resistance allele Scr ^r sufficed to prevent this disease in heterozygous animals. This hypothesis, previously proposed by Parry (1962), was tested in a study involving 133 crossings of sheep of different genotypes, and verified in the observed progenies. In a contaminated environment, susceptibility to the disease seemed to be transmitted by the scr ^s gene, whose frequency was increasing and varied in different progenies: the gene was propagated by inbreeding combined with selection; scrapie did not appear in the progeny of a homozygous resistant ram with the Scr ^r/Scr^r genotype. On the family trees, linkage between the Scr locus and the OLA-A and -B loci is clearly visible; it often allowed the transmission of resistance or susceptibility haplotypes to be detected by OLA typing and followed from one generation to the next. The Scr ^r, OLA-A4, B6 haplotype was not found in any diseased sheep born before 1979, but was propagated by healthy sheep. During and after 1979, several recombinations of this haplotype were observed, giving a recombined haplotype with reciprocal linkage (scr ^s, OLA-A4, B6), disseminated by one sire in particular. The rate of recombination of Scr and OLA loci is estimated to be between 11 and 16 %. The possibility of early selection against the disease without loss of qualities desired by the breeder is discussed.     

Genetic Diversity of Protein Markers in Sheep Populations from Ukraine

Based on polymorphism of genes for antigen factors of six blood-group systems and four blood protein loci, genetic structure and the main variation parameters were studied in three sheep breeds and three sheep breed types constituting the basis of purebred sheep resources in Ukraine. Specific features of the distribution of genotypes and alleles of polymorphic loci were determined in each of the studied sheep groups depending on their origin and production type. The molecular–genetic markers used in the analysis of the genetic relationships between the sheep breeds and breed types were shown to objectively reflect their breeding history and evolution. Integrally, each of the studied gene pools had a specific profile of gene frequencies reflecting breeding specificity, breed history, and genetic differentiation of breeds.     

Genetic diversity of protein markers in sheep population from Ukraine

Based on polymorphism of genes for antigen factors of six blood-group systems and four blood protein loci, genetic structure and the main variation parameters were studied in three sheep breeds and three sheep breed types constituting the basis of purebred sheep resources in Ukraine. Specific features of the distribution of genotypes and alleles of polymorphic loci were determined in each of the studied sheep groups depending on their origin and production type. The molecular-genetic markers used in the analysis of the genetic relationships between the sheep breeds and breed types were shown to objectively reflect their breeding history and evolution. Integrally, each of the studied gene pools had a specific profile of gene frequencies reflecting breeding specificity, breed history, and genetic differentiation of breeds.     

Nucleotide variants in prion-related protein (testis-specific) gene (PRNT) and effects on Chinese and Mongolian sheep phenotypes

ABSTRACT

Studies of the ovine prion-related protein (testis-specific) gene (PRNT), including studies of genetic diversity, have highlighted its potential relationship to scrapie infection and economically important ovine traits. PRNT was previously reported to be highly polymorphic in Portuguese sheep. To characterize genetic polymorphisms in this gene in Asian sheep, a direct sequencing method was used to detect polymorphic loci in PRNT in 285 individual sheep from four Chinese and one Mongolian breeds. Seven SNP variants in PRNT were identified, including three novel variants (g.93G>A, g.162G>T, and g.190A>G) and four previously reported variants (g.17 C>T, g.112G>C, g.129C>T, and g.144A>G). In the five breeds that we analyzed, the mutation frequencies of g.190A>G in Lanzhou Fat-tail sheep (LFTS) and g.129C>T in the other four varieties were high (F>0.5). Moreover, thirteen different haplotypes that had a comparable distribution in the tested breeds were also identified; ‘C-G-G-C-A-G-A’ occurred at the highest frequency in the five sheep breeds. Additionally, we previously explored the significance of relationships between polymorphisms in PRNP or PRND and ovine growth performance. Here, we also performed correlation analysis in all tested loci. These loci polymorphisms were significantly associated with ten different growth traits (P<0.05), except for g.93G>A. Meanwhile, in contrast to a previous study, there was no significant association between the seven SNP loci analyzed and our previously reported sheep PRND or PRNP insertion/deletion mutations. Our findings may provide new insights into polymorphic variation in ovine PRNT, which may contribute to genetic improvements in economic traits that are important for sheep breeding.     

Characterization of <Emphasis Type="Italic">PRNP</Emphasis> and <Emphasis Type="Italic">SPRN</Emphasis> coding regions from atypical scrapie cases diagnosed in Poland

Scrapie, a fatal transmissible spongiform encephalopathy (TSE) occurs in two phenotypes: classical and atypical. Many authors point out that the polymorphism of three codons (136, 154, 171) of the PRNP (PrP gene) is associated with a sheep susceptibility to classical scrapie. Until now, only one PRNP gene variant coding phenylalanine at codon 141 has been found to be associated with atypical scrapie. Another recently identified and interesting candidate gene for scrapie susceptibility in sheep is an SPRN gene coding for Shadoo protein (Sho). Sho is a highly interspecies conserved protein and an insertion/deletion (indel) found in a sheep Sho gene was associated with classical scrapie occurrence. Here we determined the polymorphism of PRNP and SPRN genes in nine atypical scrapie cases (six in native born sheep and three in imported sheep) and compared these results with a control group of healthy animals comprising six corresponding Polish sheep breeds. In atypical scrapie cases five PRNP diplotypes were identified: A₁₃₆R₁₅₄Q₁₇₁/ARQ, AHQ/ARQ, ARR/ARQ, ARR/AHQ and AHQ/AHQ. The ARR/AHQ diplotype was found only in imported sheep. A previously unobserved SNP in PRNP (E224K) was also found in both atypical scrapie and in a few control animals. In the ORF of the SPRN gene, six SNPs and one indel were identified. None of these variations was exclusive for scrapie animals and they were probably, naturally occurring polymorphisms. Special attention was given to the 6-bp indel SPRN polymorphism which was previously associated with classical scrapie occurrence.     

Prion‐like Doppel gene polymorphisms and scrapie susceptibility in portuguese sheep breeds

The establishment of an association between prion protein gene (PRNP) polymorphisms and scrapie susceptibility in sheep has enabled the development of breeding programmes to increase scrapie resistance in the European Union. Intense selection for PRNP genotype may lead to correlated selection for genes linked to PRNP. We intended to investigate if any association exists between genetic variation in prion‐like protein Doppel gene (PRND) and scrapie susceptibility, determined through PRNP genotyping. Sampling included 460 sheep from eight Portuguese breeds and the PRND gene coding region was analysed by multiple restriction fragment‐single strand conformation polymorphism (MRF‐SSCP), whereas PRNP genotyping was carried out by primer extension. A synonymous substitution (c.78G>A) was detected in codon 26 of the PRND gene, in all breeds except Churra Mondegueira. Linkage disequilibrium was found between the PRND and PRNP loci (P = 0.000). Specifically, PRND was monomorphic in the 45 animals with the more resistant ARR/ARR PRNP genotype (P = 0.003), whereas a higher frequency of PRND heterozygotes (GA) was associated with ARQ/AHQ (P = 0.029). These results constitute preliminary evidence of an association between a polymorphism in the PRND gene and scrapie susceptibility, and indicate that the possibility of undesirable consequences from widespread selection for PRNP genotype on genetic diversity and reproduction traits needs to be further investigated.     

SNP detection and haplotype analysis in partial sequence of MSTN gene in sheep

Polymerase chain reaction (PCR) products of the MSTN gene amplified from sixty sheep of nine Chinese indigenous sheep breeds and one imported sheep breed were sequenced to identify the single-nucleotide polymorphisms (SNPs) in a 378-bp fragment including intron 2 and exon 3 of the MSTN gene. A total of fifteen SNPs (A1937C, T1942G, C1956T, A1972C, A1990G, A2008C, A2011G, C2019T, A2025C, A2027C, T2085G, T2173C, C2198T, C2210T and C2213T) were detected among the sixty sequenced individuals and they were all located in intron 2. Twelve haplotypes were identified from these fifteen SNPs, of which haplotype I (CGTCGCGTCCGCTTT) and VIII (ATCAAAACAATTCCC) were the two major and basic ones with frequencies of 12.25% and 77.80%, respectively. Haplotype VIII was distributed in all sheep breeds and all individuals of the meat or meat-wool type sheep breeds were homozygous with respect to this haplotype. This suggests that haplotype VIII might be related to meat production traits in sheep. Haplotype I was only distributed in the fur, lambskin type and fur-meat type sheep breeds. This suggests that haplotype I may have some relationship with fur traits in sheep.     

Polymorphism analysis of prion protein gene in 11 Pakistani goat breeds

The association between caprine PrP gene polymorphisms and its susceptibility to scrapie has been investigated in current years. As the ORF of the PrP gene is extremely erratic in different breeds of goats, we studied the PrP gene polymorphisms in 80 goats which belong to 11 Pakistani indigenous goat breeds from all provinces of Pakistan. A total of 6 distinct polymorphic sites (one novel) with amino acid substitutions were identified in the PrP gene which includes 126 (A -> G), 304 (G -> T), 379 (A -> G), 414 (C -> T), 428 (A -> G) and 718 (C -> T). The locus c.428 was found highly polymorphic in all breeds as compare to other loci. On the basis of these PrP variants NJ phylogenetic tree was constructed through MEGA6.1 which showed that all goat breeds along with domestic sheep and Mauflon sheep appeared as in one clade and sharing its most recent common ancestors (MRCA) with deer species while Protein analysis has shown that these polymorphisms can lead to varied primary, secondary and tertiary structure of protein. Based on these polymorphic variants, genetic distance, multidimensional scaling plot and principal component analyses revealed the clear picture regarding greater number of substitutions in cattle PrP regions as compared to the small ruminant species. In particular these findings may pinpoint the fundamental control over the scrapie in Capra hircus on genetic basis.     

Impact of strong selection for the PrP major gene on genetic variability of four French sheep breeds (Open Access publication)

Effective selection on the PrP gene has been implemented since October 2001 in all French sheep breeds. After four years, the ARR "resistant" allele frequency increased by about 35% in young males. The aim of this study was to evaluate the impact of this strong selection on genetic variability. It is focussed on four French sheep breeds and based on the comparison of two groups of 94 animals within each breed: the first group of animals was born before the selection began, and the second, 3–4 years later. Genetic variability was assessed using genealogical and molecular data (29 microsatellite markers). The expected loss of genetic variability on the PrP gene was confirmed. Moreover, among the five markers located in the PrP region, only the three closest ones were affected. The evolution of the number of alleles, heterozygote deficiency within population, expected heterozygosity and the Reynolds distances agreed with the criteria from pedigree and pointed out that neutral genetic variability was not much affected. This trend depended on breed, i.e. on their initial states (population size, PrP frequencies) and on the selection strategies for improving scrapie resistance while carrying out selection for production traits.     

The OLA major histocompatibility complex of sheep. Genetic frequencies compared in Prélpe sheep with and without scrapie

The OLA genic frequencies were studied in both normal "Préalpe" Sheep and those affected with Scrapie. In the non-affected Sheep of contaminated flocks, frequencies were generally decreased, compared with frequencies of the same factors in sick Sheep or in non-infected controls. Three OLA-A genes significantly decreased; at this locus, results in "Préalpe" and "Ile-de-France" Sheep were inversed. This observation excludes OLA genes being involved in pathogeny or resistance to the disease, but suggests the existence of a linkage between the OLA loci and at least one resistance or susceptibility locus.     

Gene frequencies of blood groups in Dutch swine breeds

Gene frequencies of blood groups at 6 loci were estimated within two Dutch breeds of swine, Dutch Landrace and Dutch Large White. At all loci there were significant differences between breeds. The relationship of the two breeds with, respectively, the German Landrace breed and the German Large White breed could be confirmed by the gene frequencies.     

Phase behaviour of oleanolic acid,pure and mixed with stearic acid: Interactions and crystallinity

The phase behaviour of pure oleanolic acid (OLA) and in mixtures with stearic acid (SA) was characterized by differential scanning calorimetry (DSC), X-ray powder diffraction (XRD), diffuse reflectance infrared Fourier transform spectroscopy (DRIFTS) and nuclear magnetic resonance (NMR). The crystalline OLA as received (OLA_ar) becomes amorphous after being dissolved in chloroform and vacuum-dried at 50 °C (OLA₅₀). Upon heating, both forms transform to the needle shape crystalline form (OLA₂₂₀). Dimerization through H-bonding between COOH groups was detected both in OLA_ar and OLA₂₂₀. Dimers are stronger in OLA₂₂₀, where H-bonding also involves the alcohol groups and plays a role in the crystalline organization. A eutectic type phase diagram was established for mixtures, with the eutectic composition close to pure SA. Mixtures rich in SA are miscible in the liquid and in the amorphous solid states, where the presence of SA–OLA co-dimers, formed through H-bonding between carboxyl groups, was detected. Miscibility and SA crystallinity decrease drastically with the OLA content.     

Genetic characterisation of a domestic dog<Emphasis Type="Italic">Canis familiaris</Emphasis> breed endemic to South African rural areas

Allozyme electrophoresis (horizontal starch gel and PAGE) and histochemical staining techniques were used to study the genetic composition of an endemic southern African domestic dogCanis familiaris Linnaeus, 1758, the Africanis breed. Genetic differentiation was analysed at 21 protein-coding loci. The results were compared to those for three other populations/breeds: representatives of established Western breeds, crossbred dogs of Western descent from rural areas in South Africa, and indigenous Saluki dogs from the Middle East. Nine polymorphic loci were found (Ak-1,-2, Ck, Per, Hb, Po-A-1 to-3 andPo-Tf). Two unique alleles at theCk andPo-A-2 loci separated the Africanis breed from the other groups. There were also significant differences between Africanis and the other breeds in pair-wise comparisons of allelic frequencies at polymorphic loci. An assignment test, fixation index values, gene flow and genetic distance values indicated a closer genetic association between the Africanis and Saluki breeds than with dogs of Western origin. This finding supports archaeological evidence that the endemic Africanis breed was introduced from the Middle East into Africa thousands of years ago, and not through later western influences. The average heterozygosity ranged from 0.106–0.15, with least heterozygosity in the Africanis and most in the rural crossbred group. The percentage of polymorphic loci, the mean number of alleles per locus (biologically more significant than heterozygosity), and conformation of genotypes to Hardy-Weinberg proportions showed no evidence of recent loss of genetic diversity in Africanis. Genetic differentiation and support of archaeological evidence by genetics indicate that the endemic southern African domestic dog breed is unique.     

Disease phenotype in sheep after infection with cloned murine scrapie strains

Prion diseases exhibit different disease phenotypes in their natural hosts and when transmitted to rodents, and this variability is regarded as indicative of prion strain diversity. Phenotypic characterization of scrapie strains in sheep can be attempted by histological, immunohistochemical and biochemical approaches, but it is widely considered that strain confirmation and characterization requires rodent bioassay. Examples of scrapie strains obtained from original sheep isolates by serial passage in mice include ME7, 79A, 22A and 87V. In order to address aspects of prion strain stability across the species barrier, we transmitted the above murine strains to sheep of different breeds and susceptible Prnp genotypes. The experiment included 40 sheep dosed by the oral route alone and 36 sheep challenged by combined subcutaneous and intracerebral routes. Overall, the combined route produced higher attack rates (~100%) than the oral route (~50%) and 2–4 times shorter incubation periods. Uniquely, 87V given orally was unable to infect any sheep. Overall, scrapie strains adapted and cloned in mice produce distinct but variable disease phenotypes in sheep depending on breed or Prnp genotype. Further re-isolation experiments in mice are in progress in order to determine whether the original cloned murine disease phenotype will reemerge.     

Study of polymorphisms in the promoter region of ovine β-lactoglobulin gene and phylogenetic analysis among the Valle del Belice breed and other sheep breeds considered as ancestors

The aim of this work was to sequence the promoter region of β-lactoglobulin (BLG) gene in four sheep breeds, in order to identify polymorphisms, infer and analyze haplotypes, and phylogenetic relationship among the Valle del Belice breed and the other three breeds considered as ancestors. Sequencing analysis and alignment of the obtained sequences showed the presence of 36 single nucleotide polymorphisms (SNPs) and one deletion. A total of 22 haplotypes found in “best” reconstruction were inferred considering the 37 polymorphic sites identified. Haplotypes were used for the reconstruction of a phylogenetic tree using the Neighbor-Joining algorithm. The number of polymorphisms identified showed high variability within breeds. Analysis of genetic diversity indexes showed that the Sarda breed presented the lowest nucleotide diversity, whereas the Comisana breed presented the highest one. Comparing the nucleotide diversity among breeds, the highest value was obtained between Valle del Belice and Pinzirita breeds, whereas the lowest one was between Valle del Belice and Sarda breeds. Considering that polymorphisms in the promoter region of BLG gene could have a functional role associated with milk composition, the lowest value of nucleotide diversity between Valle del Belice and Sarda breeds may be related to a higher similarity of milk composition of these two breeds compared to the others. Further analyses will be conducted in order to evaluate the possible correlation between the genetic diversity indexes and the BLG content in milk of our breeds.     

Phase behaviour of oleanolic acid/stearyl stearate binary mixtures in bulk and at the air-water interface

The solid-liquid phase behaviour of oleanolic acid (OLA)/stearyl stearate (SS) was investigated by differential scanning calorimetry and polarizing optical microscopy. A eutectic type diagram, with the eutectic composition close to pure SS was obtained. Complementary studies by NMR, X-ray diffraction (XRD) and diffuse reflectance infrared Fourier transform (DRIFT) spectroscopy were performed. A mutual influence was detected in mixtures: the low melting form of SS is favoured at low OLA molar fractions (X_OLA) and spherulitic structures appear at high X_OLA and high temperature. Additionally, H-bonding between OLA carbonyl groups increases in the presence of SS. The study of OLA/SS by the Langmuir method and Brewster angle microscopy revealed the organization at the air-water interface: OLA interacts with water in the first layer, while SS is completely segregated to the upper layer for X_OLA > 0.3, and it distributes in the first and upper layers for X_OLA < 0.3.     

Multilocus genotypic data reveal high genetic diversity and low population genetic structure of Iranian indigenous sheep

Iranian livestock diversity is still largely unexplored, in spite of the interest in the populations historically reared in this country located near the Fertile Crescent, a major livestock domestication centre. In this investigation, the genetic diversity and differentiation of 10 Iranian indigenous fat‐tailed sheep breeds were investigated using 18 microsatellite markers. Iranian breeds were found to host a high level of diversity. This conclusion is substantiated by the large number of alleles observed across loci (average 13.83, range 7–22) and by the high within‐breed expected heterozygosity (average 0.75, range 0.72–0.76). Iranian sheep have a low level of genetic differentiation, as indicated by the analysis of molecular variance, which allocated a very small proportion (1.67%) of total variation to the between‐population component, and by the small fixation index (F_ST = 0.02). Both Bayesian clustering and principal coordinates analysis revealed the absence of a detectable genetic structure. Also, no isolation by distance was observed through comparison of genetic and geographical distances. In spite of high within‐breed variation, signatures of inbreeding were detected by the F_IS indices, which were positive in all and statistically significant in three breeds. Possible factors explaining the patterns observed, such as considerable gene flow and inbreeding probably due to anthropogenic activities in the light of population management and conservation programmes, are discussed.     

Detection of a new 20-bp insertion/deletion (indel) within sheep PRND gene using mathematical expectation (ME) method

Prion-related protein doppel gene (PRND), as an essential member of the mammalian prion gene family, is associated with the scrapie susceptibility as well as phenotype traits, so the genetic variation of the PRND has been highly concerned recently, including the single nucleiotide polymorphism (SNP) and insertion/deletion (indel). Therefore, the objective of present study was to examine the possible indel variants by mathematical expectation (ME) detection method as well as explore its associations with phenotype traits. A novel 20-bp indel was verified in 623 tested individuals representing 4 diversity sheep breeds. The results showed that 3 genotypes were detected and the minor allelic frequency were 0.008 (Lanzhou Fat-Tail sheep, LFTS), 0.084 (Small Tail Han sheep, STHS), 0.021(Tong sheep, TS) and 0.083 (Hu sheep, HS), respectively. Comparing with the traditional method of detecting samples one by one, the reaction times with ME method was decreased by 36.22% (STHS), 37.00% (HS), 68.67% (TS) and 83.33% (LFTS), respectively. Besides, this locus was significantly associated to cannon circumference index (P = 0.012) and trunk index (P = 0.037) in the Hu sheep breed. Notably, it was not concordance with the present result of DNA sequencing (GCTGTCCCTGCAGGGCTTCT) and dbSNPase of NCBI (NC_443194: g.46184887- 46184906delCTGCTGTCCCTGCAGGGCTT). Consequently, it was the first time to detect the new 20-bp indel of sheep PRND gene by ME strategy, which might provide a valuable theoretical basis for marker-assisted selection in sheep genetics and breeding.     

Linkage disequilibrium across six prion gene regions spanning 20 kbp in U.S. sheep

Single nucleotide polymorphisms (SNPs) and haplotype alleles within the prion gene (PRNP) coding sequence of domestic sheep (Ovis aries) are associated with genetic predisposition to scrapie, a transmissible spongiform encephalopathy disease of sheep. This report describes regions of linkage disequilibrium (LD) throughout the PRNP gene region in U.S. sheep and provides a genetic framework for identifying additional PRNP determinants associated with scrapie resistance. Four sequence tagged sites (i.e., STS or amplicons) totaling 3869 bp and spanning 20 kbp of genomic PRNP sequence were sequenced in a diverse panel of 90 sires representing ten popular U.S. breeds of sheep. Analysis of these sequences identified 36 previously unreported polymorphisms. In combination with two previously characterized STS, 62 polymorphisms were analyzed in a 20-kbp PRNP region in this panel of U.S. sheep. Two regions of strong LD and ten common haplotypes were identified. The haplotype encoding amino acid residues A, R, and Q at codons 136, 154, and 171, respectively, was observed on nine larger haplotypes spanning PRNP from the promoter region to the 3′ untranslated region. The haplotype encoding VRQ was observed on two larger haplotypes, whereas ARR, ARH, and AHQ were each present on a single haplotype. The existence of multiple haplotypes encoding ARQ raises the question of whether sheep bearing these different haplotypes are equally susceptible to scrapie. The haplotype structure within the 20-kbp region of PRNP identified in this study is important for higher-resolution analysis of genetics contributions to scrapie susceptibility. Nucleotide sequence data reported are available in the DDBJ/EMBL/GenBank databases under the accession number DQ077504.