Rapid synthesis of oligodeoxyribonucleotides. IV. Improved solid phase synthesis of oligodeoxyribonucleotides through phosphotriester intermediates.

A phosphotriester solid phase method on a polyamide support has been used to prepare oligodeoxyribonucleotides up to 12 units long. Compared to solid phase phosphodiester synthesis the new methodology is quicker, more flexible and gives 10-60-fold better overall yields.     

Solid phase phosphotriester synthesis of large oligodeoxyribonucleotides on a polyamide support.

Phosphotriester solid phase methodology on a polyamide support [(1980) Nucleic Acids Research, 8, 1081-1096] has been extended for the rapid synthesis of the tetradecanucleotide, d(AGTTGTTTGTAGTT), the octadecanucleotide, d(GTGGGTTTGGGGCAGGTC), and the heneicosanucleotide, d(GTGCTCTTATCCTCTTGGCTC). Thus, oligodeoxyribonucleotides comparable in size to those obtained by solution synthesis are readily accessible using solid phase techniques. An approach to the purification of the synthetic octadecanucleotide without recourse to high performance liquid chromatography is described.     

Improved synthesis of oligodeoxyribonucleotides

An improved synthesis of oligodeoxyribonucleotides was achieved with NPE- and NPEOC-protected phosphoramidites leading to easier and time-saving purification and isolation of the gene fragments.     

Rapid synthesis of oligodeoxyribonucleotides VII. Solid phase synthesis of oligodeoxyribonucleotides by a continuous flow phosphotriester method on a kieselguhr-polyamide support

A new kieselguhr-polydimethylacrylamide support has been used in a continuous flow, column system for solid phase synthesis of oligodeoxyribonucleotides by a phosphotriester procedure. Using only protected mononucleotides a 14-mer, 20-mer and 27-mer were assembled in high repetitive yield using a simple manually operated, bench top apparatus.     

A rapid deprotection procedure for phosphotriester DNA synthesis.

An equimolar solution of aldoxime and tetramethylguanidine at 70 degrees C removes both the base and phosphate protection from oligonucleotides prepared by solid phase phosphate triester technology. The rate of cleavage from the succinyl linkage commonly used for solid phase synthesis is also increased. The method is simpler, faster and more easily automated than existing methods.     

Mutagenic properties of phosphotriester analogs of oligodeoxyribonucleotides

The high effectivity of using phosphotriester analogs of oligonucleotides for aimed mutagenesis in vitro and in vivo was shown. A general scheme, describing the mutagenic effects of phosphotriester analogs of oligonucleotides and their natural homologs, was derived by analysis of data on the structures of the obtained mutants. This scheme can serve as a foundation for selecting the structure of effective agents for aimed mutagenesis.     

Rapid synthesis of oligodeoxyribonucleotides VI. Efficient, mechanised synthesis of heptadecadeoxyribonucleotides by an improved solid phase phosphotriester route.

Efficient mechanised synthesis of heptadecadeoxyribonucleotides has been achieved on an economically small scale by an improved solid phase phosphotriester method on a polydimethylacrylamide resin. Improvements were made in the preparation of dinucleotide building blocks, reaction conditions for oligonucleotide assembly and in purification of deprotected oligonucleotides by h.p.l.c. Several milligrams of pure heptadecamers were obtained. Two of the heptadecamers were designed for sequencing in opposite directions of DNA cloned in phage M13mp2.     

The synthesis of oligodeoxyribonucleotides using RNA ligase.

T4 RNA ligase catalyzes the addition of a single deoxyribonucleoside 3',5'-bisphosphate to the 3'-hydroxyl of oligodeoxyribonucleotides (Hinton et al. (1978) Biochemistry 17, 5091). We have determined improved conditions for this reaction which give yields equal to or greater than 85% when any of five common deoxyribonucleoside bisphosphate (pdAp, pdCp, pdGp, pdTp, or pdUp) are added to dA(PDA)4. A low ATP concentration, which is constantly maintained by a regeneration system composed of phosphocreatine, creatine kinase, and myokinase, contributes to the attainment of high yields. The addition of RNase A and spermine also enhances the rates and yields of the reactions. These conditions facilitate the use of RNA ligase as a reagent for the stepwise synthesis of DNA of defined sequence.     

Solid phase synthesis of polynucleotides. VIII. Synthesis of mixed oligodeoxyribonucleotides by the phosphotriester solid phase method.

A solid phase method for the simultaneous synthesis of mixed oligonucleotides using a phosphotriester approach has been developed. For this synthesis, a mixture of mono or dimeric coupling units is used, and a slight difference in the reactivity of those units is found. However, this difference does not hamper the simultaneous, mixed oligonucleotide synthesis, and the sequence analysis of a product demonstrates the existence of all desired sequences in the final mixture.     

The preparative synthesis of oligodeoxyribonucleotides using RNA ligase.

The synthesis of nmol quantities of defined sequences of oligodeoxyribonucleotides using T4 RNA ligase has been demonstrated. Reacting using from 18 to 200 nmol of substrates in which a single 2'-deoxyribonucleoside 3',5'-bisphosphate was added to an oligodeoxyribonucleotide resulted in yields from 13 to 95%. When two oligodeoxyribonucleotides were similarly joined using RNA ligase, the yields ranged from 10 to 50%. Although the reactions contained high concentrations of enzyme and were incubated from 5 to 21 days, there was little degradation of either substrates or products. We have also characterized an unusual product which arises when 3'-phosphate terminated oligodeoxyribonucleotides are incubated with RNA ligase and high concentrations of ATP. This product has an adenylyl group linked to the 3'-phosphate by an anhydride bond. The mechanistic and synthetic implications of forming this product are discussed.     

Polymer supported DNA synthesis using hydroxybenzotriazole activated phosphotriester intermediates.

Phosphorylation of N-acyl-5'-O-DMTr-d-nucleosides, or similarly protected DNA-dimers having a free 3'-OH group, with 2-chlorophenyl-0,0-bis(1-benzotriazolyl)phosphate affords reactive 3'-phosphotriester derivatives. The latter intermediates can be used, without further purification, for the synthesis of DNA-fragments on the controlled pore glass/long chain alkylamine support. Further, 2-cyano-1,1-dimethylethoxy dichlorophosphine proved to be very suitable for the preparation of 5'-phosphorylated DNA-fragments on the same type of solid support.     

Microwave-assisted rapid deprotection of oligodeoxyribonucleotides.

A novel method for the deprotection of oligodeoxyribonucleotides under microwave irradiation has been developed. The oligodeoxynucleotides having base labile, phenoxyacetyl (pac), protection for exocyclic amino functions were fully deprotected in 0. 2 M sodium hydroxide (methanol:water : : 1:1, v/v) = A and 1 M sodium hydroxide (methanol:water : : 1:1, v/v) = B using microwaves in 4 and 2 min, respectively. The deprotection of oligodeoxyribonucleotides carrying conventional protecting groups, dAbz, dCbzand dGpac, for exocyclic amino functions was achieved in 4 min in B without any side product formation. The deprotected oligonucleotides were compared with the oligomers deprotected using standard deprotection conditions (29% aq. ammonia, 16 h, 55 degrees C) with respect to their retention time on HPLC and biological activity.     

Inhibition of DNA chain elongation by a phosphotriester linkage in template oligodeoxyribonucleotides.

We synthesized two oligodeoxyribonucleotides bearing an isopropyl phosphotriester at defined positions using new phosphorobisamidite chemistry. Diastereomers were separated with HPLC and their template properties were analyzed. Priming oligodeoxyribonucleotides labeled with 32P at the 5'-end were annealed to the modified oligodeoxyribonucleotides and elongated with DNA polymerase I large fragment from Escherichia coli. Results show that the phosphotriester inhibits the DNA chain elongation partially and the extents of the inhibition are remarkably different between the two diastereomers.     

Pre-activation strategy for oligodeoxyribonucleotide synthesis using triaryloxydichlorophosphoranes in the phosphotriester method.

Triaryloxydichlorophosphoranes were tested as condensing agents for oligodeoxyribonucleotide synthesis in the phosphotriester method. Tris(2,4,6-tribromophenoxy)dichlorophosphorane (BDCP) was found to be a relatively stable crystalline material which could be used as a chemical reagent. A notable feature of the BDCP-promoted condensation reaction was studied by 31P-NMR. A small amount of BDCP compared to the conventional condensing agent was effective for the generation of active nucleotide intermediates and BDCP itself was quantitatively converted into an inert material, tris(2,4,6-tribromophenyl)phosphate (2). Thus, BDCP enabled us to separate the activation step from the condensation process in the phosphotriester method. This preactivation method was applied to the solid-phase synthesis.     

An approach to the stereoselective synthesis of Sp-dinucleoside phosphorothioates using phosphotriester chemistry.

An approach to the stereoselective synthesis of Sp- dinucleoside phosphorothioates has been investigated which utilizes phosphotriester chemistry. The stereoselectivity of internucleotide bond formation between N4-benzoyl-5'-O-(4,4'-dimethoxytrityl)-2'-deoxycytidine-3'-O-(S2-cyano-e thyl) phosphorothioate (3) and 3'-O-acetylthymidine has been studied using either mesitylenesulphonyl-5-(pyridin-2-yl)tetrazole (MSPy) or 1-mesitylenesulphonyl-3-nitro-1,2,4-triazole (MSNT) as the activating agent. The removal of the cyanoethyl group from the protected dinucleoside phosphorothioate has been studied, and conditions are reported which provide rapid deprotection without concomittant desulphurisation.     

Convenient synthesis of arabinonucleoside containing oligodeoxyribonucleotides.

C2 substituted arabinofuranosyluracil derivatives were synthesized and its incorporations into DNA were easily carried out by using post-synthetic modification.     

One pot solution synthesis of cyclic oligodeoxyribonucleotides.

Several cyclic oligodeoxynucleotides with different base composition and size have been prepared from 5',3'-unprotected linear precursors, using a bifunctional phosphorylating reagent. The final deprotected oligomers have been characterized by 1H- and 31P-NMR. The present procedure is particularly useful for millimolar scale syntheses.     

Improvements to solid phase phosphotriester synthesis of deoxyoligonucleotides.

A solution of benzenesulphonic acid (3%, w/v) in a dimethylformamide and dichloromethane mixture (9:1, v/v) is shown to be a very effective reagent for the detritylation of deoxyoligonucleotides attached to a solid support. The levels of depurination with this reagent were lower than those observed with other reagents such as trichloroacetic acid. Coupling reactions are described using above ambient temperatures with no detectable increase in side products. Both procedures have been successfully incorporated into an automated system, which can compete with the rate of synthesis by the phosphite approach.     

Enzymatic synthesis of oligodeoxyribonucleotides of defined sequence. Polynucleotide phosphorylase catalysed synthesis using pyrimidine analog-containing deoxyribonucleoside 5''-diphosphates.

The E. coli polynucleotide phosphorylase-catalysed reaction of the deoxynucleoside 5'-diphosphates of 5-methyldeoxycytidine, N4-hydroxydeoxycytidine, deoxyuridine and 5-mercurideoxyuridine with the primers d(pT-T-A-G) and d(pT-T-T-T-T-T) have been studied under conditions where the primer is extended, predominantly, by one or two nucleotide residues. In experiments with 5-mercurideoxyuridine 5'-diphosphate, no 5-mercurideoxy-uridine-containing oligonucleotides were produced. The other three nucleotide analogs were found to be good substrates for E. coli PNPase and the conditions established for synthesis with these analogs will allow the construction of a number of biologically useful types of oligodeoxyribonucleotide.