共查询到20条相似文献,搜索用时 15 毫秒
1.
Charcoal root rot and wilt, are two economically important diseases of many crop plants in North and South America, Asia and Africa and some parts of Europe. Genetic variation in 43 isolates of Macrophomina phaseolina and 22 isolates of Fusarium species, collected from geographically distinct regions over a range of hosts, was studied using random amplified polymorphic DNA (RAPD) markers. Initially, 210 arbitrary nucleotide (10-mer) primers were tested for amplification of genomic DNA of one M. phaseolina isolate, 70 primers amplified the genomic DNA of M. phaseolina. One primer OPA-13 (5'-CAGCACCCAC-3') produced fingerprint profiles, which clearly distinguished between the different isolates of M. phaseolina. UPGMA analysis classified these isolates into five major groups. By primer OPA-13, 22 isolates of pathogenic and non-pathogenic Fusarium species of different formae-speciales and races, were also distinguished from M. phaseolina. This marker is useful for distinguishing between these two important plant pathogens irrespective of hosts, virulence spectrum and races. This is the first report of reliable diagnosis of two soilborne pathogens (root/collar rot and wilt causing pathogens) at the level of isolates, formae-speciales and races by a single primer RAPD procedure with uniform PCR conditions. 相似文献
2.
A. A. SALEH H. U. AHMED T. C. TODD S. E. TRAVERS† K. A. ZELLER‡ J. F. LESLIE K. A. GARRETT 《Molecular ecology》2010,19(1):79-91
Agricultural and wild ecosystems may interact through shared pathogens such as Macrophomina phaseolina , a generalist clonal fungus with more than 284 plant hosts that is likely to become more important under climate change scenarios of increased heat and drought stress. To evaluate the degree of subdivision in populations of M. phaseolina in Kansas agriculture and wildlands, we compared 143 isolates from maize fields adjacent to tallgrass prairie, nearby sorghum fields, widely dispersed soybean fields and isolates from eight plant species in tallgrass prairie. Isolate growth phenotypes were evaluated on a medium containing chlorate. Genetic characteristics were analysed based on amplified fragment length polymorphisms and the sequence of the rDNA-internal transcribed spacer (ITS) region. The average genetic similarity was 58% among isolates in the tallgrass prairie, 71% in the maize fields, 75% in the sorghum fields and 80% in the dispersed soybean fields. The isolates were divided into four clusters: one containing most of the isolates from maize and soybean, two others containing isolates from wild plants and sorghum, and a fourth containing a single isolate recovered from Solidago canadensis in the tallgrass prairie. Most of the sorghum isolates had the dense phenotype on media containing chlorate, while those from other hosts had either feathery or restricted phenotypes. These results suggest that the tallgrass prairie supports a more diverse population of M. phaseolina per area than do any of the crop species. Subpopulations show incomplete specialization by host. These results also suggest that inoculum produced in agriculture may influence tallgrass prairie communities, and conversely that different pathogen subpopulations in tallgrass prairie can interact there to generate 'hybrids' with novel genetic profiles and pathogenic capabilities. 相似文献
3.
Rashmi Aggarwal Veer B. Singh Renu Shukla Malkhan Singh Gurjar Sangeeta Gupta Tilak R. Sharma 《Journal of Phytopathology》2010,158(4):210-216
Spot blotch, caused by the pathogen Bipolaris sorokiniana is an important disease of wheat and is responsible for large economic losses world wide. In this study, molecular variability in B. sorokiniana isolates collected from different regions of India was investigated using URP‐PCR technique. All the 40 isolates used in the study were pathogenic when tested on susceptible host, Agra local, although they varied in pathogenicity. Isolate BS‐49 was least virulent showing 4.5 infection index while BS‐75 was the most virulent with 63.4 infection index. The universal rice primers (URPs’) are primers which have been derived from DNA repeat sequences in the rice genome. Out of the 12 URP markers used in the study, 10 markers were effective in producing polymorphic fingerprint patterns from DNA of B. sorokiniana isolates. The analysis of entire fingerprint profile using unweighted pair group method with arithmetic averages (UPGMA) differentiated B. sorokiniana isolates obtained from different geographic regions. One isolate BS‐53 from northern hill zone was different from rest of the isolates showing less than 50% similarity. Broadly, three major clusters were obtained using UPGMA method. One cluster consisted of isolates from North western plain zone; second cluster having isolates from North eastern plain zone and third cluster consisted of isolates from Peninsular zone showing more than 75% genetic similarity among them. One of the markers, URP‐2F (5′GTGTGCGATCAGTTGCTGGG3′) amplified three monomorphic bands of 0.60, 0.80 and 0.90 kb size which could be used as specific markers for identification of B. sorokiniana. Further, based on URP‐PCR analysis, the grouping of the isolates according to the geographic origin was possible. This analysis also provided important information on the degree of genetic variability and relationship between the isolates of B. sorokiniana. 相似文献
4.
Michele B. Mann Elisandra Minotto Thaisa Feltrin Luciana P. Milagre Cristina Spadari Sueli T. Van Der Sand 《Current microbiology》2014,69(6):874-879
Spot blotch caused by Bipolaris sorokiniana is a destructive disease of wheat in warm and humid wheat-growing regions of the world. This fungus shows a high genetic diversity and morphological and physiologic variability. In this study, 19 polysporic and 57 monosporic isolates of B. sorokiniana were characterized using universal rice primers—URP-PCR. The results obtained when the dendrogram was constructed with all the data produced with the amplification products showed very distinct clusters. However, the similarity among the isolates was low where 37 and 26.3 % of the monosporic and polysporic isolates, respectively, showed similarity above 70 %. All primers amplified multiple DNA fragments of polysporic as well as the monosporic isolates. Isolates fingerprints were constructed based on binary characters revealed by the three primers. An amplified fragment of approximately 750 bp was observed among 40 % of the isolates, when primer URP-1F was used. When primers URP-4R and URP-2R were used, a fragment of 450 and 400 bp was present in 31.5 and 29 % of the isolates, respectively. It was expected a higher similarity among the isolates since the monosporic cultures were originated from the polysporic. The dendrogram did not enable the separation of B. sorokiniana isolates by their geographic origin. This low correlation suggests that gene transfer may have occurred by parasexual combination in this fungus population. However, in spite of the research efforts for that end, it has not been possible to establish patterns that characterize the profile of B. sorokiniana. 相似文献
5.
Sclerotinia sclerotiorum is one of the most devastating soil-inhabiting fungal plant pathogens infecting various crop plants including chickpea. Genetic
diversity of 24 isolates of S. sclerotiorum representing 10 different states of India was determined by different molecular markers and mycelial compatibility grouping
(MCG). The majority of the isolates showed more than 90% genetic similarity. Unweighted paired group method with arithmetic
average cluster analysis of DNA profiles generated by 21 RAPD primers grouped the isolates into seven categories showing high
magnitude of genetic homogeneity and showed partial correlation with geographical origin of the isolates. Identical ITS-RFLP
profiles were generated in all the isolates. Limited variability was observed among the nucleotide sequences of ITS region
of the isolates. The phylogenetic tree generated from bootstrap neighbor-joining analysis indicated that 50% of Indian populations
were distinct and grouped separately. The isolates were variable in mycelial compatibility and they were grouped into seven
MCGs, namely, MCG A, MCG B, MCG C, MCG D, MCG E, MCG F and MCG G. 相似文献
6.
A real-time qPCR assay was developed to detect and quantify Macrophomina phaseolina abundance in rhizosphere soil and plant tissue. Both TaqMan and SYBR green techniques were targeted on ~ 1 kb sequence characterized amplified region (SCAR) of M. phaseolina and two sets of specific primers were designed for SYBR green (MpSyK) and TaqMan (MpTqK) assays. No cross-hybridization and no fluorescent signal exceeding the baseline threshold was observed in TaqMan and SYBR green assays, respectively. The minimum detection limit or sensitivity of TaqMan assay was 30 fg/μL of M. phaseolina DNA and limit of quantification of M. phaseolina viable population was estimated as 0.66 × 10(5) CFU/g soil(-1) equivalent to 10 pg/μL of target DNA. This is the first report which demonstrated real-time qPCR assays with greater specificity and sensitivity to detect M. phaseolina population in soil and plant materials. 相似文献
7.
Genetic diversity of 89 isolates of Rhizoctonia solani isolated from different pulse crops representing 21 states from 16 agro-ecological regions of India, 49 morphological, and 7 anastomosis groups (AGs) was analyzed using 12 universal rice primers (URPs), 22 random amplified polymorphic DNA (RAPD), and 23 inter-simple sequence repeats (ISSR) markers. Both URPs and RAPD markers provided 100?% polymorphism with the bands ranging from 0.1 to 5?kb in size, whereas ISSR markers gave 99.7?% polymorphism with the bands sizes ranging from 0.1 to 3?kb. The marker URP 38F followed by URP13R, URP25F, and URP30F, RAPD marker R1 followed by OPM6, A3 and OPA12 and ISSR3 followed by ISSR1, ISSR4, and ISSR20 produced the highest number of amplicons. R. solani isolates showed a high level of genetic diversity. Unweighted pair group method with an arithmetic average (UPGMA) analysis grouped the isolates into 7 major clusters at 35?% genetic similarity using the three sets of markers evaluated. In spite of using three different types of markers, about 95?% isolates shared common grouping patterns. The majority of the isolates representing various AGs were grouped together into different sub-clusters using all three types of markers. Molecular groups of the isolates did not correspond to agro-ecological regions or states and crops of the origin. An attempt was made for the first time in the present study to determine the genetic diversity of R. solani populations isolated from different pulse crops representing various AGs and agro-ecological regions. 相似文献
8.
Neutral and pathogenicity markers were used to analyse the population structure of Magnaporthe grisea rice isolates from the north‐western Himalayan region of India. Random amplified polymorphic DNA (RAPD)‐based DNA fingerprinting of 48 rice isolates of M. grisea with five primers (OPA‐04, OPA‐10, OPA‐13, OPJ‐06 and OPJ‐19) showed a total of 65 RAPD bands, of which 54 were polymorphic. Cluster analysis of 48 rice isolates of M. grisea on the basis of these 65 RAPD bands revealed the presence of high genotypic diversity and continuous DNA fingerprint variation in the pathogen population. No correlation was observed between RAPD patterns and virulence characteristics of the pathogen. The observed population structure contrasted with presumed clonal reproductive behaviour of the pathogen and indicated the possibility of ongoing genetic recombination in the pathogen population. Analysis of the virulence organization of five RAPD groups (RG1–RG5) using 20 rice genotypes comprising at least 15 resistance genes revealed that no combination of resistance genes would confer resistance against all RAPD fingerprint groups present in the M. grisea rice population. The possible implications of the observed population structure of M. grisea for blast resistance breeding have been discussed. 相似文献
9.
Earthworms are one of the most important and beneficial macrofauna, and are used extensively in organic farming. Earthworms mediate soil biological regulation systems, and produce biogenic structures. They help to maintain soil structure, water infiltration, and regulate the availability of nutrients assimilated by plants. The objectives of this study were to perform morphological and molecular characterizations of 24 earthworm individuals collected from geographically diverse locations to assess the level of genetic variation. For molecular analysis, the effectiveness of RAPD, ISSR, and Universal rice primers (URPs) markers was investigated to identify polymorphism among 24 isolates of earthworms. A total of 62 molecular markers were used for amplification of genomic DNA of earthworms. Of these, 10 RAPD, 10 ISSR, and 10 URPs markers were used for characterization, which showed 95.7%, 96.7% and 98.3% polymorphism, respectively. The dendrogram, generated from the DNA markers by the unweighted pair group method using arithmetic averages, grouped all the isolates into two main clusters. All Eisenia fetida isolates were clustered in group A, whereas group B included three isolates belonging to Eudrilus eugeniae. Molecular markers allowed a rapid assessment of genetic variation among these closely related isolates of earthworms. These results suggest that molecular markers are a good choice for diversity analysis of earthworm individuals. 相似文献
10.
Marisa Rovera Nicolás Pastor Marina Niederhauser Susana B. Rosas 《Biocontrol Science and Technology》2014,24(9):1012-1025
Pseudomonas chlororaphis subsp. aurantiaca SR1 was evaluated for control of Macrophomina phaseolina in vitro and in soybean plants, for growth promotion of soybean plants and for production of antifungal compounds. Strain SR1 caused a significant inhibition of M. phaseolina in vitro and reduced damping-off in the in vivo assays. In addition, strain SR1 significantly increased shoot and root length and shoot and root dry weight of soybean plants in M. phaseolina infested soil, as compared to control plants in infested soil. Fragments for the phenazine-1-carboxylic acid, pyrrolnitrin and hydrogen cyanide encoding genes were amplified from the DNA of strain SR1 after polymerase chain reaction (PCR) assays with specific primers. Thus, this study establishes that P. chlororaphis subsp. aurantiaca SR1 provides control of M. phaseolina in vivo and suggests that strain SR1 might be applied as an effective biocontrol agent to protect soybean plants from this phytopathogen. 相似文献
11.
Dzierzewicz Z Szczerba J Weglarz L Swiatkowska L Jasinska D Wilczok T 《FEMS microbiology letters》2003,222(1):69-74
Fifteen (soil and intestinal) strains of Desulfovibrio desulfuricans species were typed by PCR method with the use of primers specific for repetitive extragenic palindromic (REP) and enterobacterial repetitive intergenic consensus (ERIC) sequences. As a result, characteristic DNA fingerprints for the strains were obtained. Moreover, the genetic profiles were found to be useful for typing and distinguishing the strains of D. desulfuricans. According to cluster analysis, PCR with primers complementary to the sequences REP appeared to be slightly more discriminatory than PCR with ERIC primers for the investigated strains. Distinct fingerprint patterns of two isolates derived from the same patient pointed to the different origin of both strains. 相似文献
12.
Latif MA Omar MY Tan SG Siraj SS Ali ME Rafii MY 《Genetics and molecular research : GMR》2012,11(1):30-41
Contamination of insect DNA for RAPD-PCR analysis can be a problem because many primers are non-specific and DNA from parasites or gut contents may be simultaneously extracted along with that of the insect. We measured the quantity of food ingested and assimilated by two sympatric populations of brown planthopper (BPH), Nilaparvata lugens, one from rice and the other from Leersia hexandra (Poaceae), a wetland forage grass, and we also investigated whether host plant DNA contaminates that of herbivore insects in extractions of whole insects. Ingestion and assimilation of food were reduced significantly when individuals derived from one host plant were caged on the other species. The bands, OPA3 (1.25), OPD3 (1.10), OPD3 (0.80), OPD3 (0.60), pUC/M13F (0.35), pUC/M13F (0.20), BOXAIR (0.50), peh#3 (0.50), and peh#3 (0.17) were found in both rice-infesting populations of brown planthopper and its host plant (rice). Similarly, the bands, OPA4 (1.00), OPB10 (0.70), OPD3 (0.90), OPD3 (0.80), OPD3 (0.60), pUC/ M13F (0.35), pUC/M13F (0.20), and BOXAIR (0.50) were found in both Leersia-infesting populations of brown planthopper and the host plant. So, it is clear that the DNA bands amplified in the host plants were also found in the extracts from the insects feeding on them. 相似文献
13.
Charcoal rot caused by Macrophomina phaseolina is an economically important disease in sorghum grown during the post rainy season in India. Variations in random amplified polymorphic DNA (RAPD) polymorphisms, chlorate sensitivity and pathogenicity were studied among sorghum isolates of M. phaseolina collected from different parts of India. RAPD data based on 14 random primers of Kit A and C (OPA and OPC) on 20 isolates showed a high degree of polymorphism (98.1%) in different isolates. UPGMA dendrogram on RAPD data produced 7 clusters at the level of 37% similarity. Isolates from the same locations showed a tendency to group closer, substantiating closer genetic relatedness. Sorghum infecting Macrophomina isolates showed a mixed response for sensitivity to potassium chlorate (120 mM). Chlorate-resistant isolates were predominant (>65% of the isolates) over sensitive isolates. Chlorate-sensitive isolates were found to be genetically closer among them than the resistant ones. For the first time it was shown that chlorate sensitivity in Macrophomina had some relations with charcoal rot severity in sorghum. 相似文献
14.
Sharifi-Tehrani A Shakiba M Okhovat M Zakeri Z 《Communications in agricultural and applied biological sciences》2005,70(3):189-192
Charcoal rot caused by Tiarosporella phaseolina (Tassi) Van der Aa is an important disease of soybean in Gorgan province of Iran. Experiments were carried out with 95 bactenal isolates that were collected from the rhizosphere of soybean plant. Among these bacteria only 50 isolates showed antagonistic effect on Tiarosporella phaseolina using dual culture test. Six highly effective bacteria were selected for subsequent studies. Based on biochemical physiological and morphological tests, isolates Pf-12 and Pf-63 were identified as Pseudomonas fluorescens, isolates B-13, B-42,B-126 and B-84 as Bacillus subtilis. The isolates of P. fluorescens produced antibiotics as well as volatile metabolites that inhibited mycelial growth of fungus. Bacillus subtilis isolates inhibited the fungal growth through volatile and non-volatile metabolites production. Only P. fluorescens isolates produced hydrogen cyanide. In greenhouse studies, the isolates B-13 and B-126 reduced 59% and 66% the intensity of charcoal rot of soybean respectively. The combinations of isolates B-13 and B-126 were also effective on reducing the intensity of disease. 相似文献
15.
Isolates of three races of Bipolaris maydis from China (races O, C and T) were compared using two techniques. Random Amplified Polymorphic DNA (RAPD) analysis using 24 primers indicated that race O and C isolates were more similar to one another than to the race T isolate. Twenty of the primers produced RAPD profiles that were similar for the race O and C isolates but differed for the race T isolate (four primers did not amplify products in any of the isolates). Four primers produced profiles which differed for all three races and two of these (A-09 and B-18) clearly differentiated the race O and race C isolates. Genetic fingerprinting of B. maydis using M13 DNA as a probe differentiated race O and C isolates from the race T with all four restriction enzymes used. Furthermore, when DNA was digested with Hind III, the hybridization profiles of the race O and C isolates differed from one another. 相似文献
16.
Li S Hartman GL Domier LL Boykin D 《TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik》2008,117(3):343-352
Fusarium solani f. sp. glycines (FSG; syn. F. virguliforme Akoi, O'Donnell, Homma & Lattanzi) is a soil-borne fungus that infects soybean roots and causes sudden death syndrome (SDS), a widespread and destructive soybean disease. The goal of this study was to develop and use a real-time quantitative polymerase chain reaction (QPCR) assay to compare the accumulation of genomic DNA among 30 FSG isolates in inoculated soybean roots. Isolates differed significantly (P < or = 0.05) in their DNA accumulation on a susceptible soybean cultivar when detected and quantified using a FSG-specific probe/primers set derived from the sequences of the nuclear-encoded, mitochondrial small subunit ribosomal RNA gene. QPCR results that were normalized as the fold change over the sample collection times after inoculation were significantly (P < or = 0.001) correlated with the log(10) transformed colony-forming unit (CFU) values of FSG obtained from plating of inoculated ground roots on FSG semi-selective agar medium. Several isolates were identified that accumulated more FSG DNA and had higher CFU values than the reference isolate FSG1 (Mont-1). Compared to other isolates, FSG5 was the most aggressive root colonizer based on DNA accumulation and CFU values in infested roots. The described QPCR assay should provide more specificity, greater sensitivity, and less variability than alternatives to the culturing-dependent and time-consuming plating assays. Evaluation of isolate relative DNA differences on host plants using the QPCR approach provides useful information for evaluating isolates based on the extent and/or degree of colonization on soybean roots and for selecting isolates for breeding SDS-resistant soybean lines. 相似文献
17.
Akiko Yamagashira Chihiro Iwai Masahiko Moroishi Masakazu Misaka Yoshikatsu Fujita Kenji Hirata Motoaki Kusaba 《Mycoscience》2008,49(6):351-358
The population structure of Magnaporthe oryzae from green foxtail (Setaria viridis) in Japan was examined by DNA fingerprint analyses using the transposable elements MGR586 and MAGGY as probes. Fifteen M. oryzae isolates from green foxtail were collected from 11 Japanese prefectures so that a macrogeographic population of this pathogen
is represented. All the 15 isolates were sorted into distinct haplotypes by DNA fingerprint analyses with both probes. Furthermore,
similarities between the DNA fingerprint profiles of the 15 isolates were exclusively low; i.e., if lineages are arbitrarily
established based on greater than 70% similarities in isolates, the 15 isolates could be categorized into 13 distinct lineages
by DNA fingerprinting with both probes. We also examined the MGR586 DNA fingerprint variations of this pathogen in 9 microgeographic
populations each of which contained 20 to 24 isolates collected from a 1 m2 or 50 m2 area. In all the 9 populations, more than 2 haplotypes, which shared less than 70% similarities, were identified in the DNA
fingerprint profiles. These results suggested that M. oryzae isolates from the green foxtail in Japan possessed a complex lineage structure, even at the microgeographic scale. 相似文献
18.
C. N. Neeraja N. Vijayabhanu V. V. Shenoy C. S. Reddy N. P. Sarma 《Journal of plant biochemistry and biotechnology.》2002,11(1):43-48
Rice sheath blight fungus Rhizoctonia solani has a wide host range and is highly variable in pathogenecity, sclerotial production and cultural characteristics. In India, breeding for sheath blight resistant cultivars has been a priority area of research. However, lack of adequate information about the genetic variability of the fungal populations occurring in India, non-availability of appropriate markers and the non-availability of resistant donors are some of the limiting factors to achieve this objective. To assess the genetic variability in sheath blight fungus, 18 isolates collected from different rice growing regions of India were analyzed by using random amplified polymorphic DNA (RAPD) markers.The similarity values of RAPD profiles ranged from 0.41 to 0.85 with an average of 0.66 among all the isolates. The percentage polymorphism detected per primer varied from 79.2 to 100%. All the primers could be used to fingerprint the individual isolates. The cluster analysis using unweighted paired group method with arithmetic averages could distinguish between R. solani isolates as well as the virulent and avirulent isolates on rice. 相似文献
19.
Masaru Matsumoto Myo Zaw Seint San Aye 《Archives Of Phytopathology And Plant Protection》2013,46(13-16):777-784
A modified baiting technique was conducted for selective isolation, fungal DNA diagnosis and fungal cell lipid assay derived from Myanmar isolates of Rhizoctonia spp., causal agents of rice sheath diseases by trapping selective plant stem segments. Bait plant materials of rice, mat rush and cotton were successfully used to isolate R. solani AG1-IA, R. oryzae and R. oryzae-sativae. Moreover, the three plant materials were also effectively used to detect genomic DNA derived from all Rhizoctonia spp. obtained from Myanmar. Rice segment was the most successful materials for detection of fungal cell lipids including palmitic, stearic and linoleic acids. The results of this experiment demonstrate that bait plant materials of rice, mat rush and cotton were the best useful tools for not only direct isolation, but also fungal DNA diagnosis and cell lipid assay of Myanmar soil environmental conditions. 相似文献
20.
Inter-simple sequence repeat (ISSR) primers designed to anneal to microsatellites were used to obtain deoxyribonucleic acid (DNA) fingerprint profiles to distinguish among 16 established insect cell lines derived from an assortment of lepidopteran, dipteran, and coleopteran species. Three different levels of cell line comparison were made: (1) between parents and their clones, (2) among cell lines derived from different tissues from the same species, and (3) among cell lines derived from different insect species. Of the 16 repeat oligonucleotide primers used in this study, nine primers generated several unique markers to distinguish between parental cell lines and their clones. Four of the 16 primers also generated DNA profiles with a number of unique bands, enabling the distinction among cell lines derived from specific tissues from the same species. In addition, ISSR-generated DNA profiles provided the greatest number of unique markers to distinguish easily among insect cell lines derived from different species. 相似文献