Members of the IclR family of bacterial transcriptional regulators function as activators and/or repressors

Members of the IclR family of regulators are proteins with around 250 residues. The IclR family is best defined by a profile covering the effector binding domain. This is supported by structural data and by a number of mutants showing that effector specificity lies within a pocket in the C-terminal domain. These regulators have a helix-turn-helix DNA binding motif in the N-terminal domain and bind target promoters as dimers or as a dimer of dimers. This family comprises regulators acting as repressors, activators and proteins with a dual role. Members of the IclR family control genes whose products are involved in the glyoxylate shunt in Enterobacteriaceae , multidrug resistance, degradation of aromatics, inactivation of quorum-sensing signals, determinants of plant pathogenicity and sporulation. No clear consensus exists on the architecture of DNA binding sites for IclR activators: the MhpR binding site is formed by a 15-bp palindrome, but the binding sites of PcaU and PobR are three perfect 10-bp sequence repetitions forming an inverted and a direct repeat. IclR-type positive regulators bind their promoter DNA in the absence of effector. The mechanism of repression differs among IclR-type regulators. In most of them the binding sites of RNA polymerase and the repressor overlap, so that the repressor occludes RNA polymerase binding. In other cases the repressor binding site is distal to the RNA polymerase, so that the repressor destabilizes the open complex.     

Identification of the hutUH operator (hutUo) from Klebsiella aerogenes by DNA deletion analysis.

Expression of Klebsiella aerogenes histidine utilization operons hutUH and hutIG is negatively regulated by the product of hutC. Multiple copies of the hutUH promoter region [hut(P)] present in trans were able to titrate the limited amount of host-encoded hut repressor (HutC). Thus, the hut(P) region contains a specific binding site for HutC. To identify DNA sequences required for HutC titration, we constructed and characterized a set of 40 left-entering and 28 right-entering deletions within a 250-bp DNA sequence containing the hut(P) region. Mutants carrying deletions that altered a unique dyad symmetric sequence, ATGCTTGTATAGACAAGTAT, from -11 to -30 relative to the hutUH promoter (hutUp) were unable to titrate hut repressor; mutants carrying deletions that left this sequence intact retained their ability to titrate hut repressor. Thus, we identify ATGCTTGT ACAAGTAT as the hutUH operator.     

Physical maps of Klebsiella aerogenes and Salmonella typhimurium hut genes.

The recognition sites for several restriction endonucleases were mapped within deoxyribonucleic acid coding for histidine utilization (hut) genes of Salmonella typhimurium and Klebsiella aerogenes. Deoxyribonucleic acid fragments containing the two hut promoters were identified by ribonucleic acid polymerase binding.